Starting /dee2/code/volunteer_pipeline.sh SRR7168825 current disk space = 3102389559296 free memory = 1580515132 SRR7168825 SRAfilesize 4980cb1fc608a382069021abc5f17b25 SRR7168825.sra SRR7168825.sra file validated SRR7168825 is paired end SRR7168825 is conventional basespace SRR7168825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08775 34.0 33.0 34.0 32.0 34.0 2 33.2085 34.0 33.0 34.0 32.0 34.0 3 33.309 34.0 33.0 34.0 32.0 34.0 4 33.45375 34.0 34.0 34.0 33.0 34.0 5 33.45225 34.0 33.0 34.0 33.0 34.0 6 37.21525 38.0 38.0 38.0 36.0 38.0 7 37.469 38.0 38.0 38.0 37.0 38.0 8 37.48475 38.0 38.0 38.0 37.0 38.0 9 37.4875 38.0 38.0 38.0 37.0 38.0 10-14 37.50834999999999 38.0 38.0 38.0 37.6 38.0 15-19 37.5244 38.0 38.0 38.0 37.8 38.0 20-24 37.510749999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.45485 38.0 38.0 38.0 37.6 38.0 30-34 37.4855 38.0 38.0 38.0 37.2 38.0 35-39 37.45955 38.0 38.0 38.0 37.4 38.0 40-44 37.40069999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.37205 38.0 38.0 38.0 37.0 38.0 50-54 37.38869999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.3367 38.0 38.0 38.0 37.0 38.0 60-64 37.27075000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.219849999999994 38.0 38.0 38.0 36.8 38.0 70-74 37.19355 38.0 38.0 38.0 36.6 38.0 75-79 37.071 38.0 38.0 38.0 36.2 38.0 80-84 36.96685 38.0 38.0 38.0 36.2 38.0 85-89 36.845349999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.7716 38.0 38.0 38.0 35.4 38.0 95-99 36.60785 38.0 38.0 38.0 35.0 38.0 100-104 36.53815 38.0 38.0 38.0 34.6 38.0 105-109 36.5178 38.0 38.0 38.0 34.0 38.0 110-114 36.29335 38.0 38.0 38.0 33.8 38.0 115-119 36.15065 38.0 37.6 38.0 33.6 38.0 120-124 35.9977 38.0 37.2 38.0 33.2 38.0 125-129 35.84845 38.0 36.8 38.0 32.6 38.0 130-134 35.4185 38.0 36.0 38.0 31.2 38.0 135-139 35.1105 38.0 36.0 38.0 29.4 38.0 140-144 34.77695 38.0 35.6 38.0 28.0 38.0 145-149 34.011399999999995 38.0 33.4 38.0 25.2 38.0 150-151 29.322625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 0.0 12 2.0 13 2.0 14 1.0 15 4.0 16 2.0 17 2.0 18 7.0 19 6.0 20 3.0 21 2.0 22 3.0 23 4.0 24 7.0 25 7.0 26 11.0 27 14.0 28 25.0 29 21.0 30 39.0 31 42.0 32 57.0 33 95.0 34 138.0 35 235.0 36 546.0 37 2722.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.482623464854974 13.117324274888947 10.765612751502482 36.634439508753594 2 21.975 18.375 34.475 25.174999999999997 3 19.85 24.55 26.0 29.599999999999998 4 22.3 32.525 21.275 23.9 5 21.50537634408602 36.734183545886474 22.58064516129032 19.179794948737182 6 19.125 35.575 25.35 19.950000000000003 7 13.750000000000002 24.099999999999998 42.925000000000004 19.225 8 19.425 24.474999999999998 29.9 26.200000000000003 9 17.75 23.425 32.975 25.85 10-14 19.6 29.45 26.77 24.18 15-19 19.919999999999998 27.92 28.42 23.74 20-24 19.744999999999997 28.185 28.050000000000004 24.02 25-29 20.24 28.444999999999997 27.22 24.095 30-34 19.915 28.415000000000003 28.13 23.54 35-39 19.85 28.625 28.225 23.3 40-44 20.265 28.7 27.415 23.62 45-49 19.575 28.57 27.439999999999998 24.415 50-54 19.985 28.845 27.74 23.43 55-59 20.0 28.815 28.01 23.175 60-64 19.794999999999998 29.12 27.27 23.815 65-69 20.325 28.939999999999998 26.779999999999998 23.955000000000002 70-74 20.28 28.435 27.715 23.57 75-79 19.985 29.015 27.52 23.48 80-84 20.46 28.575 27.41 23.555 85-89 20.505000000000003 28.155 27.87 23.47 90-94 20.395 28.005000000000003 27.825 23.775 95-99 20.025000000000002 28.32 28.16 23.494999999999997 100-104 20.335 29.125 27.215 23.325000000000003 105-109 20.61 28.565 27.365000000000002 23.46 110-114 20.86 27.994999999999997 27.534999999999997 23.61 115-119 20.715 28.68 27.13 23.474999999999998 120-124 20.915 28.51 26.715 23.86 125-129 20.505000000000003 28.87 27.045 23.580000000000002 130-134 20.68 28.335 27.48 23.505000000000003 135-139 21.17 28.625 26.700000000000003 23.505000000000003 140-144 21.6 28.139999999999997 26.529999999999998 23.73 145-149 21.085 28.87 26.095000000000002 23.95 150-151 21.386486147674564 29.133759558731352 25.98721323805942 23.492541055534662 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 3.0 24 4.0 25 3.5 26 3.5 27 8.5 28 10.0 29 9.5 30 18.5 31 27.0 32 36.5 33 56.5 34 67.0 35 73.0 36 88.5 37 104.0 38 130.0 39 163.0 40 194.0 41 215.5 42 236.5 43 266.5 44 268.5 45 265.0 46 263.5 47 239.5 48 224.0 49 202.5 50 170.5 51 134.0 52 106.5 53 90.0 54 69.5 55 59.5 56 52.0 57 41.0 58 25.0 59 17.5 60 13.0 61 6.5 62 4.0 63 3.0 64 4.0 65 3.0 66 2.0 67 2.5 68 2.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0125 0.0 0.0 0.0 84-85 0.2 0.025 0.0 0.0 0.0 86-87 0.25 0.025 0.0 0.0 0.0 88-89 0.2625 0.025 0.0 0.0 0.0 90-91 0.275 0.025 0.0 0.0 0.0 92-93 0.375 0.025 0.0 0.0 0.0 94-95 0.4625 0.025 0.0 0.0 0.0 96-97 0.625 0.025 0.0 0.0 0.0 98-99 0.7375 0.025 0.0 0.0 0.0 100-101 0.8875 0.025 0.0 0.0 0.0 102-103 0.9874999999999999 0.025 0.0 0.0 0.0 104-105 1.1749999999999998 0.025 0.0 0.0 0.0 106-107 1.5 0.025 0.0 0.0 0.0 108-109 1.7625000000000002 0.025 0.0 0.0 0.0 110-111 2.025 0.025 0.0 0.0 0.0 112-113 2.375 0.025 0.0 0.0 0.0 114-115 2.9625 0.025 0.0 0.0 0.0 116-117 3.2625 0.025 0.0 0.0 0.0 118-119 3.5375 0.025 0.0 0.0 0.0 120-121 3.8875 0.025 0.0 0.0 0.0 122-123 4.2125 0.025 0.0 0.0 0.0 124-125 4.75 0.025 0.0 0.0 0.0 126-127 5.237500000000001 0.025 0.0 0.0 0.0 128-129 5.8625 0.025 0.0 0.0 0.0 130-131 6.199999999999999 0.025 0.0 0.0 0.0 132-133 6.675 0.025 0.0 0.0 0.0 134-135 7.1875 0.025 0.0 0.0 0.0 136-137 8.0125 0.025 0.0 0.0 0.0 138-139 8.725 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCATT 10 0.0068343505 144.975 6 >>END_MODULE SRR7168825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.764 33.0 33.0 34.0 32.0 34.0 2 32.857 34.0 33.0 34.0 32.0 34.0 3 32.86725 34.0 33.0 34.0 32.0 34.0 4 32.826 34.0 33.0 34.0 32.0 34.0 5 32.93525 34.0 33.0 34.0 32.0 34.0 6 36.99575 38.0 38.0 38.0 36.0 38.0 7 37.17675 38.0 38.0 38.0 37.0 38.0 8 37.101 38.0 38.0 38.0 37.0 38.0 9 37.07125 38.0 38.0 38.0 37.0 38.0 10-14 37.0724 38.0 38.0 38.0 37.0 38.0 15-19 37.039649999999995 38.0 38.0 38.0 36.6 38.0 20-24 36.976350000000004 38.0 38.0 38.0 36.2 38.0 25-29 36.89265 38.0 38.0 38.0 36.0 38.0 30-34 36.904650000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.8983 38.0 38.0 38.0 36.0 38.0 40-44 36.83990000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.8237 38.0 38.0 38.0 36.0 38.0 50-54 36.62660000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.57815000000001 38.0 38.0 38.0 35.0 38.0 60-64 36.4708 38.0 38.0 38.0 34.4 38.0 65-69 36.379749999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.2864 38.0 38.0 38.0 34.0 38.0 75-79 36.15325 38.0 38.0 38.0 33.4 38.0 80-84 35.91175 38.0 37.4 38.0 32.4 38.0 85-89 35.70545 38.0 37.0 38.0 31.0 38.0 90-94 35.4276 38.0 37.0 38.0 29.4 38.0 95-99 35.31675 38.0 37.0 38.0 28.8 38.0 100-104 35.16745 38.0 36.4 38.0 28.6 38.0 105-109 35.0377 38.0 36.0 38.0 27.8 38.0 110-114 34.77785 38.0 36.0 38.0 26.8 38.0 115-119 34.269999999999996 38.0 35.0 38.0 23.8 38.0 120-124 33.763999999999996 38.0 34.2 38.0 21.8 38.0 125-129 33.439550000000004 38.0 34.0 38.0 15.0 38.0 130-134 32.5849 38.0 33.0 38.0 14.8 38.0 135-139 31.54005 37.6 31.0 38.0 13.0 38.0 140-144 30.545849999999994 36.0 30.4 38.0 8.6 38.0 145-149 28.90485 36.0 25.6 38.0 2.0 38.0 150-151 23.552999999999997 31.0 7.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 2.0 5 3.0 6 0.0 7 2.0 8 1.0 9 2.0 10 1.0 11 3.0 12 2.0 13 2.0 14 2.0 15 7.0 16 13.0 17 15.0 18 5.0 19 12.0 20 13.0 21 13.0 22 18.0 23 30.0 24 28.0 25 24.0 26 24.0 27 43.0 28 50.0 29 54.0 30 75.0 31 82.0 32 113.0 33 168.0 34 233.0 35 379.0 36 823.0 37 1747.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.39419709854928 19.334667333666832 15.93296648324162 26.338169084542272 2 25.093820365273956 27.145359019264447 32.724543407555664 15.036277207905929 3 21.42142142142142 27.952952952952952 30.555555555555557 20.07007007007007 4 22.633950926389584 36.10415623435153 22.083124687030544 19.178768152228344 5 24.84984984984985 36.811811811811815 21.946946946946948 16.39139139139139 6 21.660830415207606 36.26813406703352 23.186593296648326 18.884442221110557 7 18.084042021010504 20.68534267133567 39.99499749874937 21.235617808904454 8 21.305326331582897 24.55613903475869 28.68217054263566 25.456364091022753 9 21.930482620655166 25.93148287071768 27.906976744186046 24.23105776444111 10-14 23.88955582232893 28.666466586634655 26.065426170468186 21.37855142056823 15-19 23.151575787893947 27.888944472236116 28.134067033516757 20.825412706353177 20-24 22.77366419851911 28.041825095057032 27.951771062637583 21.23273964378627 25-29 23.48761571178384 28.376282211658744 27.030272704528397 21.10582937202902 30-34 23.086160312218553 28.269788852196537 27.929550685479835 20.71450015010507 35-39 22.445812684587274 28.27751914701907 28.12734644841568 21.149321719977976 40-44 22.934173669467786 27.66106442577031 28.45138055222089 20.95338135254102 45-49 22.520134060327145 28.157670951928367 28.452803761692763 20.86939122605172 50-54 22.595167825521482 27.622430093542093 27.97758991546196 21.804812165474463 55-59 23.605343473257616 27.698003702406567 27.91814679541702 20.778506028918798 60-64 23.219287715086033 27.971188475390157 27.74109643857543 21.068427370948378 65-69 22.898739243546128 27.821693015809483 28.437062237342403 20.842505503301982 70-74 23.232424318238678 27.52064048036027 28.40630472854641 20.84063047285464 75-79 23.473779023218576 27.46196957566053 27.807245796637307 21.257005604483588 80-84 23.541187068361523 27.569812831548397 27.78500650585527 21.10399359423481 85-89 23.57328794553464 27.678213856627952 27.86844213055667 20.880056067280737 90-94 23.08654327163582 28.179089544772385 27.963981990995496 20.770385192596297 95-99 23.07076769192298 28.27706926731683 27.851962990747687 20.800200050012503 100-104 23.231969590877263 27.648294488346504 28.373512053616086 20.74622386716015 105-109 23.772131639491846 27.9333800140042 27.70831249374812 20.58617585275583 110-114 23.77688844422211 27.573786893446723 27.828914457228613 20.82041020510255 115-119 24.243333833608485 28.215518535194356 27.435089299114512 20.106058332082647 120-124 24.85612770855227 28.27403292798879 26.782765350547965 20.087074012910975 125-129 24.385727868688384 27.613471450733122 27.67352249412 20.32727818645849 130-134 24.530475284218962 28.451945710422194 27.06966494716282 19.947914058196023 135-139 24.746034129009658 27.958764950207676 27.29820347295201 19.996997447830655 140-144 25.163840112061635 27.865325929261093 27.36004802641453 19.610785932262743 145-149 25.32139462758241 28.55785103296483 26.511930368665897 19.608823970786855 150-151 25.650000000000002 28.6375 26.1125 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 3.0 26 2.5 27 4.5 28 8.5 29 10.5 30 16.5 31 21.0 32 25.5 33 34.0 34 42.0 35 64.5 36 88.0 37 108.0 38 132.5 39 161.0 40 190.5 41 231.5 42 272.5 43 280.5 44 269.0 45 268.0 46 259.5 47 246.0 48 235.0 49 198.0 50 159.0 51 135.0 52 113.0 53 99.0 54 87.0 55 62.5 56 44.0 57 28.5 58 18.5 59 20.0 60 15.5 61 8.0 62 9.0 63 8.0 64 3.0 65 1.5 66 0.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.1 4 0.15 5 0.1 6 0.05 7 0.05 8 0.025 9 0.025 10-14 0.04 15-19 0.05 20-24 0.06 25-29 0.075 30-34 0.06999999999999999 35-39 0.11499999999999999 40-44 0.04 45-49 0.045 50-54 0.045 55-59 0.065 60-64 0.04 65-69 0.06 70-74 0.075 75-79 0.08 80-84 0.09 85-89 0.12 90-94 0.05 95-99 0.025 100-104 0.03 105-109 0.03 110-114 0.05 115-119 0.055 120-124 0.08499999999999999 125-129 0.08499999999999999 130-134 0.165 135-139 0.08499999999999999 140-144 0.055 145-149 0.045 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.5297679112008072 1.05 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.8 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.637499999999999 0.0 0.0 0.0 0.0 134-135 7.075 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720872 spots for SRR7168825.sra Written 720872 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra Read 720857 spots for SRR7168825.sra Written 720857 spots for SRR7168825.sra SRR ids: ['SRR7168825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjmi5232 SRR7168825.sra spots: 14417155 blocks: [[1, 720857], [720858, 1441714], [1441715, 2162571], [2162572, 2883428], [2883429, 3604285], [3604286, 4325142], [4325143, 5045999], [5046000, 5766856], [5766857, 6487713], [6487714, 7208570], [7208571, 7929427], [7929428, 8650284], [8650285, 9371141], [9371142, 10091998], [10091999, 10812855], [10812856, 11533712], [11533713, 12254569], [12254570, 12975426], [12975427, 13696283], [13696284, 14417155]] SRR7168825 file size 4863800 SRR7168825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168825 SRR7168825_1.fastq SRR7168825_2.fastq Input file: SRR7168825_1.fastq Paired file: SRR7168825_2.fastq trimmed: SRR7168825-trimmed-pair1.fastq, SRR7168825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 03:34:13 2025 >> started Sat Feb 15 03:34:31 2025 >> done (17.891s) 14417155 read pairs processed; of these: 18019 ( 0.12%) short read pairs filtered out after trimming by size control 46478 ( 0.32%) empty read pairs filtered out after trimming by size control 14352658 (99.55%) read pairs available; of these: 8018023 (55.86%) trimmed read pairs available after processing 6334635 (44.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 7 0.00% 23 7 0.00% 24 4 0.00% 25 3 0.00% 26 9 0.00% 27 21 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 12 0.00% 32 8 0.00% 33 12 0.00% 34 13 0.00% 35 19 0.00% 36 19 0.00% 37 15 0.00% 38 16 0.00% 39 33 0.00% 40 21 0.00% 41 28 0.00% 42 40 0.00% 43 47 0.00% 44 42 0.00% 45 62 0.00% 46 62 0.00% 47 53 0.00% 48 85 0.00% 49 64 0.00% 50 78 0.00% 51 93 0.00% 52 118 0.00% 53 131 0.00% 54 137 0.00% 55 133 0.00% 56 166 0.00% 57 161 0.00% 58 206 0.00% 59 229 0.00% 60 288 0.00% 61 287 0.00% 62 351 0.00% 63 440 0.00% 64 459 0.00% 65 558 0.00% 66 569 0.00% 67 613 0.00% 68 770 0.01% 69 1270 0.01% 70 1238 0.01% 71 1145 0.01% 72 1266 0.01% 73 1347 0.01% 74 1474 0.01% 75 1649 0.01% 76 1856 0.01% 77 2005 0.01% 78 2251 0.02% 79 2643 0.02% 80 2798 0.02% 81 3297 0.02% 82 3750 0.03% 83 4277 0.03% 84 5234 0.04% 85 5804 0.04% 86 6227 0.04% 87 6606 0.05% 88 7341 0.05% 89 7746 0.05% 90 8491 0.06% 91 8926 0.06% 92 9704 0.07% 93 10567 0.07% 94 11822 0.08% 95 12447 0.09% 96 13134 0.09% 97 13621 0.09% 98 14437 0.10% 99 15110 0.11% 100 16460 0.11% 101 17082 0.12% 102 18462 0.13% 103 19409 0.14% 104 20504 0.14% 105 21624 0.15% 106 22606 0.16% 107 23452 0.16% 108 24391 0.17% 109 25569 0.18% 110 26222 0.18% 111 27560 0.19% 112 29223 0.20% 113 30285 0.21% 114 31762 0.22% 115 33247 0.23% 116 34588 0.24% 117 35645 0.25% 118 36961 0.26% 119 38100 0.27% 120 39113 0.27% 121 41255 0.29% 122 42358 0.30% 123 44439 0.31% 124 46876 0.33% 125 49051 0.34% 126 50984 0.36% 127 53012 0.37% 128 55099 0.38% 129 56909 0.40% 130 59325 0.41% 131 61659 0.43% 132 63822 0.44% 133 67534 0.47% 134 71609 0.50% 135 76126 0.53% 136 79409 0.55% 137 84785 0.59% 138 90291 0.63% 139 95935 0.67% 140 102830 0.72% 141 111489 0.78% 142 122380 0.85% 143 138106 0.96% 144 156384 1.09% 145 184926 1.29% 146 228126 1.59% 147 298001 2.08% 148 432862 3.02% 149 808242 5.63% 150 3475930 24.22% 151 6334635 44.14% 14352658 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=13 prefix-density=0.47 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=402.56 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.47 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=42.76 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=GAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7168825 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 03:35:24 Started mapping on | Feb 15 03:35:24 Finished on | Feb 15 03:37:00 Mapping speed, Million of reads per hour | 538.22 Number of input reads | 14352658 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13419359 Uniquely mapped reads % | 93.50% Average mapped length | 291.20 Number of splices: Total | 12584359 Number of splices: Annotated (sjdb) | 12301657 Number of splices: GT/AG | 12342479 Number of splices: GC/AG | 198432 Number of splices: AT/AC | 6959 Number of splices: Non-canonical | 36489 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387153 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 97623 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559841 559841 559841 N_multimapping 387153 387153 387153 N_noFeature 569723 13155552 721353 N_ambiguous 203809 1365 90551 UnstrandedReadsAssigned:12645827 PositiveStrandReadsAssigned:262442 NegativeStrandReadsAssigned:12607455 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168825-trimmed-pair1.fastq SRR7168825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,352,658 reads, 12,655,615 reads pseudoaligned [quant] estimated average fragment length: 230.876 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,290 rounds 52401 SRR7168825.ke.tsv 34699 SRR7168825.se.tsv 87100 total ==> SRR7168825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.12 606 27.5763 Potri.005G024800.1.v4.1 1035 805.124 203 20.5161 Potri.004G059700.1.v4.1 961 731.185 8 0.890273 Potri.007G009000.2.v4.1 1416 1186.12 0 0 Potri.003G141000.2.v4.1 2943 2713.12 849.662 25.4822 Potri.016G087400.1.v4.1 270 85.8341 553 524.235 Potri.015G069301.1.v4.1 564 338.521 0 0 Potri.010G195200.1.v4.1 1773 1543.12 34 1.79283 Potri.012G127500.1.v4.1 977 747.152 98 10.6728 ==> SRR7168825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 673 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7168825 completed mapping pipeline successfully