Starting /dee2/code/volunteer_pipeline.sh SRR7168826 current disk space = 3103610404864 free memory = 1449625116 SRR7168826 SRAfilesize f8ef866f515de19d98d760eb0e3b5c7d SRR7168826.sra SRR7168826.sra file validated SRR7168826 is paired end SRR7168826 is conventional basespace SRR7168826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21075 34.0 33.0 34.0 32.0 34.0 2 33.08825 34.0 33.0 34.0 32.0 34.0 3 33.07625 34.0 33.0 34.0 32.0 34.0 4 33.1985 34.0 33.0 34.0 32.0 34.0 5 33.244 34.0 33.0 34.0 33.0 34.0 6 36.95725 38.0 37.0 38.0 36.0 38.0 7 37.25875 38.0 38.0 38.0 36.0 38.0 8 37.34375 38.0 38.0 38.0 37.0 38.0 9 37.334 38.0 38.0 38.0 37.0 38.0 10-14 37.3793 38.0 38.0 38.0 37.0 38.0 15-19 37.385200000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.33325 38.0 38.0 38.0 37.0 38.0 25-29 37.29815 38.0 38.0 38.0 37.0 38.0 30-34 37.2973 38.0 38.0 38.0 37.0 38.0 35-39 37.23255 38.0 38.0 38.0 36.8 38.0 40-44 37.15325 38.0 38.0 38.0 36.6 38.0 45-49 37.1439 38.0 38.0 38.0 36.2 38.0 50-54 37.120349999999995 38.0 38.0 38.0 36.4 38.0 55-59 37.0964 38.0 38.0 38.0 36.0 38.0 60-64 37.026349999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.02715 38.0 38.0 38.0 36.0 38.0 70-74 36.8692 38.0 38.0 38.0 35.6 38.0 75-79 36.7741 38.0 38.0 38.0 35.0 38.0 80-84 36.78675 38.0 38.0 38.0 35.4 38.0 85-89 36.580799999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.49425 38.0 38.0 38.0 34.0 38.0 95-99 36.354800000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.17805 38.0 37.6 38.0 33.6 38.0 105-109 36.08295 38.0 37.2 38.0 33.2 38.0 110-114 35.86405 38.0 37.0 38.0 32.2 38.0 115-119 35.665949999999995 38.0 37.0 38.0 31.4 38.0 120-124 35.367 38.0 36.2 38.0 29.8 38.0 125-129 35.05929999999999 38.0 35.8 38.0 28.0 38.0 130-134 34.98575 38.0 35.8 38.0 27.6 38.0 135-139 34.5292 38.0 34.4 38.0 26.4 38.0 140-144 34.0787 38.0 34.0 38.0 24.8 38.0 145-149 32.80714999999999 38.0 33.0 38.0 16.2 38.0 150-151 28.86325 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 4.0 14 1.0 15 3.0 16 3.0 17 2.0 18 3.0 19 6.0 20 2.0 21 6.0 22 4.0 23 9.0 24 16.0 25 15.0 26 22.0 27 26.0 28 24.0 29 51.0 30 43.0 31 64.0 32 81.0 33 102.0 34 164.0 35 260.0 36 712.0 37 2374.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.458999484270244 12.94481691593605 12.480660134089737 34.11552346570397 2 23.325000000000003 17.349999999999998 33.675 25.650000000000002 3 19.8 22.975 26.525 30.7 4 22.900000000000002 31.825 22.400000000000002 22.875 5 21.7 35.15 23.849999999999998 19.3 6 20.4 35.825 24.775 19.0 7 14.7 23.525 43.1 18.675 8 17.974999999999998 23.425 30.475 28.125 9 18.175 24.4 33.2 24.224999999999998 10-14 20.205000000000002 28.720000000000002 27.495000000000005 23.580000000000002 15-19 20.505000000000003 27.98 27.68 23.835 20-24 20.23 28.439999999999998 27.85 23.48 25-29 20.285 28.349999999999998 27.74 23.625 30-34 20.115 28.744999999999997 27.279999999999998 23.86 35-39 20.65 27.884999999999998 27.725 23.74 40-44 20.3 28.67 27.555000000000003 23.474999999999998 45-49 20.32 28.505000000000003 27.655 23.52 50-54 20.075000000000003 28.965000000000003 26.955000000000002 24.005000000000003 55-59 20.335 28.299999999999997 27.62 23.745 60-64 20.575 28.294999999999998 27.52 23.61 65-69 20.05 28.335 27.42 24.195 70-74 20.25 28.57 27.395000000000003 23.785 75-79 20.19 28.355000000000004 27.51 23.945 80-84 20.24 28.22 26.75 24.79 85-89 20.255000000000003 28.125 27.87 23.75 90-94 20.79 28.255000000000003 27.544999999999998 23.41 95-99 20.955 28.115000000000002 27.205000000000002 23.724999999999998 100-104 20.445 29.015 27.345000000000002 23.195 105-109 20.565 28.115000000000002 27.83 23.49 110-114 21.085 27.939999999999998 27.155 23.82 115-119 21.135 28.565 27.1 23.200000000000003 120-124 20.745 27.634999999999998 27.794999999999998 23.825 125-129 20.54 27.845 27.315 24.3 130-134 20.985 28.685 26.695 23.635 135-139 21.349999999999998 27.76 27.034999999999997 23.855 140-144 21.6 27.62 26.555 24.224999999999998 145-149 21.23 28.565 26.290000000000003 23.915 150-151 21.087500000000002 28.3875 26.0625 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 0.0 24 0.0 25 1.0 26 3.5 27 4.5 28 6.5 29 9.5 30 14.0 31 18.5 32 26.5 33 41.0 34 60.5 35 74.0 36 89.5 37 117.5 38 133.5 39 157.0 40 178.0 41 197.5 42 224.5 43 249.0 44 266.5 45 259.0 46 276.0 47 266.0 48 225.0 49 224.0 50 198.0 51 147.0 52 119.5 53 98.5 54 78.0 55 59.5 56 41.5 57 35.5 58 30.5 59 22.5 60 17.0 61 10.5 62 6.0 63 3.5 64 1.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5374999999999996 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.3625 0.0 0.0 0.0 0.0 124-125 4.825 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.800000000000001 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.7625 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAAA 10 0.0063298983 148.6923 1 AAACCAT 10 0.0068343505 144.975 7 >>END_MODULE SRR7168826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65425 33.0 33.0 34.0 32.0 34.0 2 32.76925 33.0 33.0 34.0 32.0 34.0 3 32.71925 33.0 33.0 34.0 31.0 34.0 4 32.7825 33.0 33.0 34.0 32.0 34.0 5 32.78825 33.0 33.0 34.0 32.0 34.0 6 36.9285 38.0 38.0 38.0 36.0 38.0 7 36.97075 38.0 38.0 38.0 36.0 38.0 8 36.98925 38.0 38.0 38.0 36.0 38.0 9 36.9305 38.0 38.0 38.0 36.0 38.0 10-14 36.87384999999999 38.0 38.0 38.0 36.0 38.0 15-19 36.878550000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.8686 38.0 38.0 38.0 36.0 38.0 25-29 36.8634 38.0 38.0 38.0 36.0 38.0 30-34 36.783100000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.83105 38.0 38.0 38.0 36.0 38.0 40-44 36.81345 38.0 38.0 38.0 36.0 38.0 45-49 36.71195 38.0 38.0 38.0 36.0 38.0 50-54 36.6959 38.0 38.0 38.0 36.0 38.0 55-59 36.5903 38.0 38.0 38.0 35.6 38.0 60-64 36.5781 38.0 38.0 38.0 35.2 38.0 65-69 36.5003 38.0 38.0 38.0 34.8 38.0 70-74 36.4053 38.0 38.0 38.0 34.8 38.0 75-79 36.310300000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.1727 38.0 38.0 38.0 34.0 38.0 85-89 36.091750000000005 38.0 38.0 38.0 33.8 38.0 90-94 36.06075 38.0 38.0 38.0 33.8 38.0 95-99 35.948299999999996 38.0 38.0 38.0 33.2 38.0 100-104 35.82015 38.0 37.6 38.0 32.6 38.0 105-109 35.67065 38.0 37.4 38.0 31.6 38.0 110-114 35.541199999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.2769 38.0 37.0 38.0 29.8 38.0 120-124 35.0085 38.0 36.0 38.0 27.8 38.0 125-129 34.763 38.0 36.0 38.0 27.6 38.0 130-134 34.312200000000004 38.0 35.2 38.0 23.8 38.0 135-139 33.739850000000004 38.0 34.6 38.0 21.4 38.0 140-144 33.19935 38.0 33.2 38.0 17.8 38.0 145-149 32.08735 38.0 33.0 38.0 8.6 38.0 150-151 27.10175 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 10.0 4 0.0 5 1.0 6 1.0 7 5.0 8 3.0 9 2.0 10 2.0 11 4.0 12 4.0 13 1.0 14 2.0 15 8.0 16 5.0 17 5.0 18 8.0 19 9.0 20 10.0 21 9.0 22 16.0 23 10.0 24 22.0 25 33.0 26 26.0 27 28.0 28 37.0 29 29.0 30 44.0 31 67.0 32 75.0 33 122.0 34 138.0 35 245.0 36 595.0 37 2416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.074999999999996 20.424999999999997 16.525000000000002 24.975 2 26.85 27.575 28.725 16.85 3 19.975 30.9 29.975 19.15 4 23.599999999999998 35.199999999999996 22.675 18.525 5 24.025 36.05 22.075 17.849999999999998 6 20.849999999999998 37.05 22.525000000000002 19.575 7 20.1 20.349999999999998 38.175 21.375 8 21.4 24.625 27.525 26.450000000000003 9 21.625 25.35 29.275000000000002 23.75 10-14 23.385 28.505000000000003 26.424999999999997 21.685 15-19 23.445 27.83 27.474999999999998 21.25 20-24 23.305 28.265 28.060000000000002 20.369999999999997 25-29 22.945 28.18 28.125 20.75 30-34 23.24 27.66 27.74 21.36 35-39 23.810000000000002 28.395 27.08 20.715 40-44 22.814999999999998 28.125 27.48 21.58 45-49 22.99 27.805000000000003 28.575 20.630000000000003 50-54 23.715 28.555000000000003 26.939999999999998 20.79 55-59 23.25 26.93 28.549999999999997 21.27 60-64 23.035 27.61 28.035 21.32 65-69 23.044999999999998 26.56 29.03 21.365000000000002 70-74 23.61 26.784999999999997 28.04 21.565 75-79 23.425 27.08 28.244999999999997 21.25 80-84 23.335 28.32 26.979999999999997 21.365000000000002 85-89 24.27 27.500000000000004 27.474999999999998 20.755000000000003 90-94 23.51 27.22 28.025 21.245 95-99 23.369999999999997 28.1 27.47 21.060000000000002 100-104 23.95 27.694999999999997 27.700000000000003 20.655 105-109 23.905 27.310000000000002 28.425 20.36 110-114 23.945 27.245 28.315 20.495 115-119 23.705000000000002 27.965 27.295 21.035 120-124 24.19 27.875 27.389999999999997 20.544999999999998 125-129 24.45 27.544999999999998 27.785 20.22 130-134 24.558683802570386 27.74916237435615 26.929039355903384 20.763114467170077 135-139 24.9 27.955000000000002 27.115000000000002 20.03 140-144 25.025 27.48 27.3 20.195 145-149 25.835 28.225 26.41 19.53 150-151 25.837500000000002 28.212500000000002 26.687499999999996 19.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 5.0 28 6.5 29 6.5 30 10.0 31 14.0 32 17.5 33 26.0 34 38.0 35 62.0 36 85.0 37 102.5 38 134.0 39 153.0 40 186.5 41 224.0 42 253.5 43 278.5 44 280.0 45 284.0 46 257.5 47 233.5 48 245.0 49 224.5 50 175.0 51 145.0 52 123.0 53 103.0 54 87.5 55 70.0 56 47.0 57 26.5 58 24.5 59 21.5 60 12.0 61 7.0 62 8.0 63 7.0 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6555723651033787 1.3 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.225 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9625 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.675 0.0 0.0 0.0 0.0 134-135 7.175000000000001 0.0 0.0 0.0 0.0 136-137 7.762499999999999 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 20 0.00593511 29.0 140-144 >>END_MODULE Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941239 spots for SRR7168826.sra Written 941239 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra Read 941229 spots for SRR7168826.sra Written 941229 spots for SRR7168826.sra SRR ids: ['SRR7168826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3hzf8tqh SRR7168826.sra spots: 18824590 blocks: [[1, 941229], [941230, 1882458], [1882459, 2823687], [2823688, 3764916], [3764917, 4706145], [4706146, 5647374], [5647375, 6588603], [6588604, 7529832], [7529833, 8471061], [8471062, 9412290], [9412291, 10353519], [10353520, 11294748], [11294749, 12235977], [12235978, 13177206], [13177207, 14118435], [14118436, 15059664], [15059665, 16000893], [16000894, 16942122], [16942123, 17883351], [17883352, 18824590]] SRR7168826 file size 6357335 SRR7168826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168826 SRR7168826_1.fastq SRR7168826_2.fastq Input file: SRR7168826_1.fastq Paired file: SRR7168826_2.fastq trimmed: SRR7168826-trimmed-pair1.fastq, SRR7168826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 02:43:30 2025 >> started Sat Feb 15 02:44:06 2025 >> done (35.435s) 18824590 read pairs processed; of these: 35006 ( 0.19%) short read pairs filtered out after trimming by size control 33870 ( 0.18%) empty read pairs filtered out after trimming by size control 18755714 (99.63%) read pairs available; of these: 10879234 (58.00%) trimmed read pairs available after processing 7876480 (42.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 3 0.00% 21 9 0.00% 22 5 0.00% 23 7 0.00% 24 3 0.00% 25 4 0.00% 26 5 0.00% 27 7 0.00% 28 11 0.00% 29 6 0.00% 30 12 0.00% 31 13 0.00% 32 11 0.00% 33 24 0.00% 34 13 0.00% 35 21 0.00% 36 25 0.00% 37 20 0.00% 38 24 0.00% 39 25 0.00% 40 33 0.00% 41 41 0.00% 42 37 0.00% 43 39 0.00% 44 49 0.00% 45 54 0.00% 46 60 0.00% 47 70 0.00% 48 102 0.00% 49 91 0.00% 50 119 0.00% 51 129 0.00% 52 139 0.00% 53 174 0.00% 54 177 0.00% 55 180 0.00% 56 219 0.00% 57 233 0.00% 58 242 0.00% 59 319 0.00% 60 358 0.00% 61 391 0.00% 62 442 0.00% 63 513 0.00% 64 586 0.00% 65 694 0.00% 66 755 0.00% 67 883 0.00% 68 1112 0.01% 69 2309 0.01% 70 1982 0.01% 71 1411 0.01% 72 1639 0.01% 73 1821 0.01% 74 1959 0.01% 75 2252 0.01% 76 2476 0.01% 77 2758 0.01% 78 3073 0.02% 79 3350 0.02% 80 3943 0.02% 81 4438 0.02% 82 4983 0.03% 83 5628 0.03% 84 7424 0.04% 85 8765 0.05% 86 9194 0.05% 87 9908 0.05% 88 10449 0.06% 89 10931 0.06% 90 11818 0.06% 91 12966 0.07% 92 13919 0.07% 93 14953 0.08% 94 16177 0.09% 95 17037 0.09% 96 18226 0.10% 97 18937 0.10% 98 19796 0.11% 99 21016 0.11% 100 22247 0.12% 101 24166 0.13% 102 25262 0.13% 103 26816 0.14% 104 28526 0.15% 105 30642 0.16% 106 31581 0.17% 107 32700 0.17% 108 34103 0.18% 109 35062 0.19% 110 36759 0.20% 111 37717 0.20% 112 39783 0.21% 113 42056 0.22% 114 43966 0.23% 115 45703 0.24% 116 47487 0.25% 117 48966 0.26% 118 50463 0.27% 119 51876 0.28% 120 53103 0.28% 121 54973 0.29% 122 57527 0.31% 123 60601 0.32% 124 63662 0.34% 125 65892 0.35% 126 69191 0.37% 127 71160 0.38% 128 73250 0.39% 129 76237 0.41% 130 78412 0.42% 131 81866 0.44% 132 86047 0.46% 133 90851 0.48% 134 94951 0.51% 135 101082 0.54% 136 106761 0.57% 137 112423 0.60% 138 120121 0.64% 139 128365 0.68% 140 136501 0.73% 141 148914 0.79% 142 163682 0.87% 143 183014 0.98% 144 210258 1.12% 145 248501 1.32% 146 309532 1.65% 147 409270 2.18% 148 599413 3.20% 149 1130560 6.03% 150 4683188 24.97% 151 7876480 42.00% 18755714 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=1.9 sequence=ACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=95.79 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=9.1 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=6.68 fanout-score-rank=10 prefix-density=1.09 prefix-fanout=1.8 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=32 fanout-score=30.92 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=5.5 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7168826 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 02:45:36 Started mapping on | Feb 15 02:45:42 Finished on | Feb 15 02:47:49 Mapping speed, Million of reads per hour | 531.66 Number of input reads | 18755714 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17533180 Uniquely mapped reads % | 93.48% Average mapped length | 290.88 Number of splices: Total | 16301385 Number of splices: Annotated (sjdb) | 15970300 Number of splices: GT/AG | 15971391 Number of splices: GC/AG | 280620 Number of splices: AT/AC | 9246 Number of splices: Non-canonical | 40128 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494436 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 91031 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 761721 761721 761721 N_multimapping 494436 494436 494436 N_noFeature 560294 17244412 734685 N_ambiguous 239737 1393 124283 UnstrandedReadsAssigned:16733149 PositiveStrandReadsAssigned:287375 NegativeStrandReadsAssigned:16674212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168826-trimmed-pair1.fastq SRR7168826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,755,714 reads, 16,809,638 reads pseudoaligned [quant] estimated average fragment length: 235.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7168826.ke.tsv 34699 SRR7168826.se.tsv 87100 total ==> SRR7168826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.91 364 13.2572 Potri.005G024800.1.v4.1 1035 800.909 185 15.0076 Potri.004G059700.1.v4.1 961 726.942 3 0.268129 Potri.007G009000.2.v4.1 1416 1181.91 0 0 Potri.003G141000.2.v4.1 2943 2708.91 571.848 13.7154 Potri.016G087400.1.v4.1 270 87.2011 611.981 455.973 Potri.015G069301.1.v4.1 564 335.42 0 0 Potri.010G195200.1.v4.1 1773 1538.91 2 0.0844384 Potri.012G127500.1.v4.1 977 742.937 364 31.8326 ==> SRR7168826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 206 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168826 completed mapping pipeline successfully