Starting /dee2/code/volunteer_pipeline.sh SRR7168827 current disk space = 3097708670976 free memory = 1582659188 SRR7168827 SRAfilesize 08bc9e3e284e795aafcb373e1d072c99 SRR7168827.sra SRR7168827.sra file validated SRR7168827 is paired end SRR7168827 is conventional basespace SRR7168827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.721 34.0 33.0 34.0 32.0 34.0 2 33.228 34.0 33.0 34.0 32.0 34.0 3 33.346 34.0 33.0 34.0 33.0 34.0 4 33.39225 34.0 33.0 34.0 33.0 34.0 5 33.45325 34.0 33.0 34.0 33.0 34.0 6 37.147 38.0 38.0 38.0 36.0 38.0 7 37.4135 38.0 38.0 38.0 37.0 38.0 8 37.51675 38.0 38.0 38.0 37.0 38.0 9 37.55275 38.0 38.0 38.0 38.0 38.0 10-14 37.55455 38.0 38.0 38.0 37.8 38.0 15-19 37.5535 38.0 38.0 38.0 37.8 38.0 20-24 37.51520000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.524649999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.49555 38.0 38.0 38.0 37.8 38.0 35-39 37.448499999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.4245 38.0 38.0 38.0 37.0 38.0 45-49 37.424749999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3214 38.0 38.0 38.0 37.0 38.0 55-59 37.30215 38.0 38.0 38.0 37.0 38.0 60-64 37.28294999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.271750000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.213049999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.0981 38.0 38.0 38.0 36.0 38.0 80-84 37.059250000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.94805 38.0 38.0 38.0 35.8 38.0 90-94 36.88085 38.0 38.0 38.0 35.6 38.0 95-99 36.79515 38.0 38.0 38.0 35.2 38.0 100-104 36.7067 38.0 38.0 38.0 35.0 38.0 105-109 36.58085 38.0 38.0 38.0 34.2 38.0 110-114 36.41555 38.0 38.0 38.0 34.0 38.0 115-119 36.3515 38.0 37.8 38.0 34.0 38.0 120-124 36.0194 38.0 37.2 38.0 32.8 38.0 125-129 35.760000000000005 38.0 36.8 38.0 31.4 38.0 130-134 35.466449999999995 38.0 36.0 38.0 30.6 38.0 135-139 35.22285000000001 38.0 36.0 38.0 30.2 38.0 140-144 34.62295 38.0 34.8 38.0 28.0 38.0 145-149 34.0246 38.0 33.6 38.0 25.8 38.0 150-151 29.492624999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 3.0 21 3.0 22 4.0 23 4.0 24 7.0 25 3.0 26 15.0 27 12.0 28 24.0 29 30.0 30 28.0 31 56.0 32 66.0 33 85.0 34 153.0 35 229.0 36 571.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.88775510204081 11.964285714285715 12.321428571428573 38.826530612244895 2 22.55 18.275 34.575 24.6 3 19.950000000000003 23.400000000000002 25.374999999999996 31.275 4 22.475 32.550000000000004 21.575 23.400000000000002 5 22.15 34.625 24.25 18.975 6 18.9 37.325 24.575 19.2 7 13.225000000000001 23.0 44.425 19.35 8 19.05 23.7 31.275 25.974999999999998 9 18.125 24.525 32.35 25.0 10-14 20.005 29.805 26.419999999999998 23.77 15-19 19.97 28.355000000000004 28.315 23.36 20-24 19.885 28.52 27.975 23.62 25-29 20.29 28.615000000000002 27.894999999999996 23.200000000000003 30-34 19.645000000000003 28.96 27.51 23.885 35-39 20.044999999999998 28.64 27.985 23.330000000000002 40-44 20.244999999999997 28.88 27.794999999999998 23.080000000000002 45-49 20.215 28.46 27.765 23.56 50-54 19.93 28.775000000000002 27.445000000000004 23.849999999999998 55-59 20.549999999999997 28.599999999999998 27.555000000000003 23.294999999999998 60-64 20.674999999999997 28.485 27.265 23.575 65-69 20.165 28.375 27.825 23.635 70-74 20.485 28.884999999999998 27.279999999999998 23.35 75-79 20.585 28.74 27.72 22.955000000000002 80-84 20.01 28.660000000000004 27.63 23.7 85-89 20.294999999999998 28.335 27.555000000000003 23.815 90-94 20.21 28.515 27.935 23.34 95-99 20.810000000000002 28.439999999999998 27.07 23.68 100-104 20.794999999999998 28.67 27.16 23.375 105-109 20.69 28.265 27.705000000000002 23.34 110-114 20.36 28.244999999999997 27.145000000000003 24.25 115-119 20.86 28.625 26.545 23.97 120-124 21.54 28.58 27.134999999999998 22.745 125-129 20.91 28.53 27.01 23.549999999999997 130-134 21.285 28.355000000000004 26.735 23.625 135-139 20.79 28.325 26.43 24.455 140-144 20.945 28.249999999999996 26.68 24.125 145-149 20.74 28.26 26.745 24.255 150-151 21.15 28.1625 26.924999999999997 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 1.0 24 2.5 25 3.5 26 5.0 27 7.5 28 11.5 29 17.0 30 18.5 31 23.0 32 33.0 33 39.5 34 54.0 35 82.5 36 93.5 37 110.5 38 144.0 39 179.0 40 206.5 41 208.0 42 223.0 43 250.0 44 263.0 45 270.0 46 271.0 47 249.0 48 221.5 49 198.5 50 170.0 51 131.0 52 101.5 53 93.0 54 76.0 55 61.0 56 49.5 57 31.0 58 27.0 59 22.5 60 12.0 61 10.0 62 7.5 63 4.5 64 3.5 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.525 0.0 0.0 0.0 0.0 120-121 4.95 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 6.012499999999999 0.0 0.0 0.0 0.0 126-127 6.5375 0.0 0.0 0.0 0.0 128-129 7.025 0.0 0.0 0.0 0.0 130-131 7.675 0.0 0.0 0.0 0.0 132-133 8.225000000000001 0.0 0.0 0.0 0.0 134-135 8.6375 0.0 0.0 0.0 0.0 136-137 9.1875 0.0 0.0 0.0 0.0 138-139 9.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.884 33.0 33.0 34.0 32.0 34.0 2 33.0145 34.0 33.0 34.0 32.0 34.0 3 33.02925 34.0 33.0 34.0 32.0 34.0 4 32.9895 34.0 33.0 34.0 32.0 34.0 5 32.979 34.0 33.0 34.0 32.0 34.0 6 37.24025 38.0 38.0 38.0 37.0 38.0 7 37.289 38.0 38.0 38.0 37.0 38.0 8 37.30225 38.0 38.0 38.0 37.0 38.0 9 37.22425 38.0 38.0 38.0 37.0 38.0 10-14 37.251400000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.22525 38.0 38.0 38.0 37.0 38.0 20-24 37.23514999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.2155 38.0 38.0 38.0 37.0 38.0 30-34 37.2028 38.0 38.0 38.0 37.0 38.0 35-39 37.237 38.0 38.0 38.0 37.0 38.0 40-44 37.195 38.0 38.0 38.0 37.0 38.0 45-49 37.1793 38.0 38.0 38.0 37.0 38.0 50-54 37.13205 38.0 38.0 38.0 37.0 38.0 55-59 37.083600000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.05275 38.0 38.0 38.0 36.8 38.0 65-69 37.0325 38.0 38.0 38.0 36.8 38.0 70-74 36.96635 38.0 38.0 38.0 36.2 38.0 75-79 36.8566 38.0 38.0 38.0 36.0 38.0 80-84 36.774100000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.6728 38.0 38.0 38.0 35.4 38.0 90-94 36.5664 38.0 38.0 38.0 35.0 38.0 95-99 36.593450000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.471799999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.3389 38.0 38.0 38.0 34.4 38.0 110-114 36.20575 38.0 38.0 38.0 33.8 38.0 115-119 35.981449999999995 38.0 38.0 38.0 33.4 38.0 120-124 35.785849999999996 38.0 37.6 38.0 32.6 38.0 125-129 35.5336 38.0 37.2 38.0 31.6 38.0 130-134 35.2884 38.0 36.2 38.0 30.6 38.0 135-139 34.91385 38.0 36.0 38.0 29.2 38.0 140-144 34.37245 38.0 36.0 38.0 26.4 38.0 145-149 33.34965 38.0 33.4 38.0 19.0 38.0 150-151 28.582375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 4.0 12 1.0 13 1.0 14 4.0 15 4.0 16 3.0 17 1.0 18 2.0 19 5.0 20 8.0 21 7.0 22 9.0 23 12.0 24 17.0 25 11.0 26 14.0 27 20.0 28 34.0 29 34.0 30 32.0 31 45.0 32 59.0 33 90.0 34 112.0 35 181.0 36 549.0 37 2727.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.975 17.599999999999998 16.925 30.5 2 25.924999999999997 25.575 31.924999999999997 16.575 3 21.224999999999998 28.725 29.95 20.1 4 23.775 35.825 21.975 18.425 5 24.725 36.625 21.825 16.825000000000003 6 21.275 35.875 24.05 18.8 7 18.5 19.25 41.3 20.95 8 21.6 23.974999999999998 28.999999999999996 25.424999999999997 9 21.425 23.45 31.075000000000003 24.05 10-14 22.765 29.325000000000003 26.640000000000004 21.27 15-19 23.03 27.334999999999997 28.865000000000002 20.77 20-24 22.975 28.075 27.99 20.96 25-29 22.975 27.845 28.48 20.7 30-34 22.005 28.02 28.665000000000003 21.310000000000002 35-39 22.16 28.425 27.915 21.5 40-44 22.650000000000002 27.994999999999997 28.360000000000003 20.995 45-49 22.625 28.384999999999998 27.894999999999996 21.095 50-54 23.005 27.765 28.035 21.195 55-59 22.725 27.689999999999998 27.99 21.595 60-64 22.994999999999997 27.715 28.035 21.255 65-69 23.11 27.389999999999997 28.535 20.965 70-74 23.29 27.62 28.235 20.855 75-79 23.200000000000003 28.15 27.975 20.674999999999997 80-84 23.49 27.675 27.584999999999997 21.25 85-89 23.244999999999997 28.43 27.894999999999996 20.43 90-94 23.630000000000003 27.62 27.815 20.935000000000002 95-99 23.466173308665432 28.30641532076604 27.296364818240914 20.93104655232762 100-104 23.51617580879044 27.861393069653484 28.07640382019101 20.54602730136507 105-109 23.563534530179528 28.274241136170424 27.764164624693706 20.398059708956342 110-114 23.876193809690484 27.701385069253465 27.711385569278463 20.71103555177759 115-119 24.196209810490522 28.38641932096605 27.246362318115906 20.171008550427523 120-124 24.8162408120406 27.721386069303467 27.411370568528426 20.051002550127507 125-129 24.474999999999998 27.665 27.139999999999997 20.72 130-134 24.996249812490625 27.84639231961598 27.366368318415923 19.790989549477477 135-139 25.456272813640684 27.711385569278463 26.96634831741587 19.865993299664982 140-144 25.415 28.125 26.685 19.775000000000002 145-149 25.2 28.105000000000004 27.265 19.43 150-151 25.112499999999997 29.15 26.6 19.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 3.0 27 4.0 28 8.5 29 14.0 30 18.0 31 21.5 32 27.5 33 40.0 34 52.0 35 68.0 36 83.5 37 106.0 38 139.0 39 153.5 40 187.5 41 237.0 42 258.5 43 276.0 44 288.0 45 283.5 46 271.0 47 250.5 48 237.0 49 203.5 50 151.0 51 125.0 52 106.0 53 90.0 54 75.5 55 62.0 56 45.5 57 26.0 58 25.0 59 19.0 60 8.0 61 8.5 62 10.5 63 5.5 64 0.5 65 1.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.005 105-109 0.015 110-114 0.005 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.5999999999999996 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.550000000000001 0.0 0.0 0.0 0.0 124-125 6.0875 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.1 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.3125 0.0 0.0 0.0 0.0 134-135 8.7625 0.0 0.0 0.0 0.0 136-137 9.3125 0.0 0.0 0.0 0.0 138-139 10.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGCTG 10 0.006830828 145.0 7 TACTCCT 10 0.006830828 145.0 9 GCATCAC 10 0.006830828 145.0 5 >>END_MODULE Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736548 spots for SRR7168827.sra Written 736548 spots for SRR7168827.sra Read 736560 spots for SRR7168827.sra Written 736560 spots for SRR7168827.sra SRR ids: ['SRR7168827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ekogxzt SRR7168827.sra spots: 14730972 blocks: [[1, 736548], [736549, 1473096], [1473097, 2209644], [2209645, 2946192], [2946193, 3682740], [3682741, 4419288], [4419289, 5155836], [5155837, 5892384], [5892385, 6628932], [6628933, 7365480], [7365481, 8102028], [8102029, 8838576], [8838577, 9575124], [9575125, 10311672], [10311673, 11048220], [11048221, 11784768], [11784769, 12521316], [12521317, 13257864], [13257865, 13994412], [13994413, 14730972]] SRR7168827 file size 4970142 SRR7168827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168827 SRR7168827_1.fastq SRR7168827_2.fastq Input file: SRR7168827_1.fastq Paired file: SRR7168827_2.fastq trimmed: SRR7168827-trimmed-pair1.fastq, SRR7168827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:30:58 2025 >> started Sat Feb 15 04:31:16 2025 >> done (17.182s) 14730972 read pairs processed; of these: 16117 ( 0.11%) short read pairs filtered out after trimming by size control 24252 ( 0.16%) empty read pairs filtered out after trimming by size control 14690603 (99.73%) read pairs available; of these: 7935411 (54.02%) trimmed read pairs available after processing 6755192 (45.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 6 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 3 0.00% 26 10 0.00% 27 11 0.00% 28 6 0.00% 29 8 0.00% 30 7 0.00% 31 5 0.00% 32 6 0.00% 33 11 0.00% 34 14 0.00% 35 9 0.00% 36 12 0.00% 37 17 0.00% 38 16 0.00% 39 21 0.00% 40 32 0.00% 41 39 0.00% 42 38 0.00% 43 50 0.00% 44 41 0.00% 45 37 0.00% 46 72 0.00% 47 69 0.00% 48 84 0.00% 49 88 0.00% 50 109 0.00% 51 102 0.00% 52 135 0.00% 53 140 0.00% 54 188 0.00% 55 172 0.00% 56 203 0.00% 57 232 0.00% 58 295 0.00% 59 310 0.00% 60 323 0.00% 61 441 0.00% 62 492 0.00% 63 595 0.00% 64 633 0.00% 65 742 0.01% 66 784 0.01% 67 846 0.01% 68 1039 0.01% 69 1498 0.01% 70 1546 0.01% 71 1428 0.01% 72 1733 0.01% 73 1913 0.01% 74 2183 0.01% 75 2528 0.02% 76 2651 0.02% 77 2972 0.02% 78 3217 0.02% 79 3805 0.03% 80 4129 0.03% 81 4707 0.03% 82 5327 0.04% 83 6011 0.04% 84 7115 0.05% 85 8090 0.06% 86 8629 0.06% 87 9217 0.06% 88 9818 0.07% 89 10500 0.07% 90 11577 0.08% 91 12166 0.08% 92 13255 0.09% 93 14542 0.10% 94 15599 0.11% 95 16500 0.11% 96 17352 0.12% 97 18164 0.12% 98 18736 0.13% 99 19480 0.13% 100 20528 0.14% 101 21780 0.15% 102 22946 0.16% 103 24377 0.17% 104 25654 0.17% 105 27192 0.19% 106 28509 0.19% 107 29209 0.20% 108 29921 0.20% 109 30841 0.21% 110 31860 0.22% 111 32854 0.22% 112 34257 0.23% 113 35867 0.24% 114 37685 0.26% 115 39376 0.27% 116 40219 0.27% 117 41355 0.28% 118 42532 0.29% 119 43158 0.29% 120 43894 0.30% 121 45299 0.31% 122 46517 0.32% 123 47916 0.33% 124 50719 0.35% 125 52129 0.35% 126 53502 0.36% 127 54909 0.37% 128 56743 0.39% 129 57843 0.39% 130 59033 0.40% 131 61010 0.42% 132 63123 0.43% 133 65250 0.44% 134 68609 0.47% 135 72114 0.49% 136 75556 0.51% 137 78916 0.54% 138 83003 0.57% 139 87255 0.59% 140 91854 0.63% 141 98603 0.67% 142 106710 0.73% 143 118350 0.81% 144 136246 0.93% 145 159857 1.09% 146 196278 1.34% 147 258238 1.76% 148 382785 2.61% 149 747872 5.09% 150 3510262 23.89% 151 6755192 45.98% 14690603 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=42.06 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=50.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.2 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7168827 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:32:04 Started mapping on | Feb 15 04:32:04 Finished on | Feb 15 04:33:42 Mapping speed, Million of reads per hour | 539.65 Number of input reads | 14690603 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13751717 Uniquely mapped reads % | 93.61% Average mapped length | 290.40 Number of splices: Total | 12712621 Number of splices: Annotated (sjdb) | 12422445 Number of splices: GT/AG | 12470484 Number of splices: GC/AG | 196641 Number of splices: AT/AC | 7108 Number of splices: Non-canonical | 38388 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433289 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 60239 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518399 518399 518399 N_multimapping 433289 433289 433289 N_noFeature 501893 13436101 688284 N_ambiguous 227951 1476 97582 UnstrandedReadsAssigned:13021873 PositiveStrandReadsAssigned:314140 NegativeStrandReadsAssigned:12965851 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168827-trimmed-pair1.fastq SRR7168827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,690,603 reads, 12,977,587 reads pseudoaligned [quant] estimated average fragment length: 225.35 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7168827.ke.tsv 34699 SRR7168827.se.tsv 87100 total ==> SRR7168827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.65 863 35.8364 Potri.005G024800.1.v4.1 1035 810.65 296 27.1962 Potri.004G059700.1.v4.1 961 736.687 19 1.92097 Potri.007G009000.2.v4.1 1416 1191.65 0 0 Potri.003G141000.2.v4.1 2943 2718.65 887.778 24.3221 Potri.016G087400.1.v4.1 270 89.3332 718 598.635 Potri.015G069301.1.v4.1 564 343.615 0 0 Potri.010G195200.1.v4.1 1773 1548.65 183.92 8.8456 Potri.012G127500.1.v4.1 977 752.661 253 25.0364 ==> SRR7168827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 605 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR7168827 completed mapping pipeline successfully