Starting /dee2/code/volunteer_pipeline.sh SRR7168828 current disk space = 2820670402560 free memory = 1579274772 SRR7168828 SRAfilesize 262c1d9ede05e2f938c52b3c5b8c7686 SRR7168828.sra SRR7168828.sra file validated SRR7168828 is paired end SRR7168828 is conventional basespace SRR7168828 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.612 34.0 33.0 34.0 32.0 34.0 2 33.2415 34.0 33.0 34.0 32.0 34.0 3 33.363 34.0 33.0 34.0 33.0 34.0 4 33.36625 34.0 33.0 34.0 33.0 34.0 5 33.43575 34.0 34.0 34.0 33.0 34.0 6 37.1355 38.0 38.0 38.0 36.0 38.0 7 37.4495 38.0 38.0 38.0 37.0 38.0 8 37.5005 38.0 38.0 38.0 37.0 38.0 9 37.47925 38.0 38.0 38.0 38.0 38.0 10-14 37.503 38.0 38.0 38.0 37.6 38.0 15-19 37.5198 38.0 38.0 38.0 38.0 38.0 20-24 37.510149999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.4632 38.0 38.0 38.0 37.6 38.0 30-34 37.459199999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.44855 38.0 38.0 38.0 37.2 38.0 40-44 37.3731 38.0 38.0 38.0 37.0 38.0 45-49 37.3673 38.0 38.0 38.0 37.0 38.0 50-54 37.28620000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.28555 38.0 38.0 38.0 37.0 38.0 60-64 37.27295 38.0 38.0 38.0 37.0 38.0 65-69 37.25619999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.188700000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.116099999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.0543 38.0 38.0 38.0 36.0 38.0 85-89 36.9528 38.0 38.0 38.0 36.0 38.0 90-94 36.873000000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.736450000000005 38.0 38.0 38.0 35.2 38.0 100-104 36.69355 38.0 38.0 38.0 35.0 38.0 105-109 36.57535 38.0 38.0 38.0 34.2 38.0 110-114 36.4154 38.0 38.0 38.0 34.0 38.0 115-119 36.35815 38.0 38.0 38.0 34.0 38.0 120-124 36.02204999999999 38.0 37.0 38.0 32.8 38.0 125-129 35.74915 38.0 36.8 38.0 31.2 38.0 130-134 35.58215 38.0 36.0 38.0 31.0 38.0 135-139 35.233 38.0 36.0 38.0 30.6 38.0 140-144 34.7615 38.0 34.8 38.0 28.2 38.0 145-149 34.0871 38.0 33.8 38.0 25.6 38.0 150-151 29.634124999999997 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 1.0 16 1.0 17 3.0 18 1.0 19 2.0 20 2.0 21 7.0 22 4.0 23 7.0 24 12.0 25 9.0 26 12.0 27 20.0 28 16.0 29 32.0 30 45.0 31 37.0 32 43.0 33 78.0 34 128.0 35 226.0 36 613.0 37 2696.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.30194472876151 14.841351074718526 10.59365404298874 34.26305015353122 2 21.7 18.85 34.1 25.35 3 20.125 26.525 25.85 27.500000000000004 4 23.025000000000002 32.375 23.325000000000003 21.275 5 22.3 36.525 22.1 19.075 6 18.925 37.775 24.675 18.625 7 15.625 23.575 41.949999999999996 18.85 8 18.5 24.55 30.275000000000002 26.674999999999997 9 17.875 25.025 31.374999999999996 25.724999999999998 10-14 20.05 29.42 26.51 24.02 15-19 19.900000000000002 29.21 27.055 23.835 20-24 19.96 28.165000000000003 28.18 23.695 25-29 20.044999999999998 28.194999999999997 28.189999999999998 23.57 30-34 19.665 28.470000000000002 27.57 24.295 35-39 20.03 28.875 27.950000000000003 23.145 40-44 19.814999999999998 29.025000000000002 27.400000000000002 23.76 45-49 19.994999999999997 28.63 27.79 23.585 50-54 20.29 28.63 27.815 23.265 55-59 19.655 28.43 27.905 24.01 60-64 19.945 28.58 27.975 23.5 65-69 19.814999999999998 29.01 27.255000000000003 23.919999999999998 70-74 20.025000000000002 28.694999999999997 27.779999999999998 23.5 75-79 19.830000000000002 28.59 27.985 23.595 80-84 19.99 28.21 28.395 23.405 85-89 19.835 28.975 27.71 23.48 90-94 20.62 27.810000000000002 28.04 23.53 95-99 20.305 28.360000000000003 27.675 23.66 100-104 20.395 28.925 27.334999999999997 23.345 105-109 20.39 28.410000000000004 27.48 23.72 110-114 20.185 28.625 27.565 23.625 115-119 20.615 28.9 27.375 23.11 120-124 20.669999999999998 28.525 27.544999999999998 23.26 125-129 20.369999999999997 28.794999999999998 27.575 23.26 130-134 21.015 28.810000000000002 27.1 23.075000000000003 135-139 21.055 28.915000000000003 26.57 23.46 140-144 21.125 28.265 26.900000000000002 23.71 145-149 20.565 29.205 26.39 23.84 150-151 21.1875 28.1875 26.687499999999996 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 1.0 23 1.5 24 1.5 25 1.0 26 5.5 27 9.0 28 10.5 29 13.0 30 22.5 31 29.0 32 36.5 33 43.5 34 54.5 35 75.5 36 85.5 37 117.0 38 140.5 39 160.0 40 201.0 41 226.0 42 244.0 43 280.0 44 279.5 45 250.5 46 249.5 47 240.0 48 220.0 49 190.5 50 166.0 51 158.0 52 128.5 53 88.0 54 61.5 55 46.5 56 44.5 57 34.5 58 21.5 59 17.5 60 13.0 61 8.5 62 5.5 63 3.0 64 3.0 65 2.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.6125 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.2625 0.0 0.0 0.0 0.0 134-135 6.675 0.0 0.0 0.0 0.0 136-137 7.175 0.0 0.0 0.0 0.0 138-139 8.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAAC 10 0.0068343505 144.975 2 TTAGTTA 10 0.0068343505 144.975 145 >>END_MODULE SRR7168828 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.847 33.0 33.0 34.0 32.0 34.0 2 32.95975 34.0 33.0 34.0 32.0 34.0 3 33.013 34.0 33.0 34.0 32.0 34.0 4 32.99925 34.0 33.0 34.0 32.0 34.0 5 32.96225 34.0 33.0 34.0 33.0 34.0 6 37.13 38.0 38.0 38.0 37.0 38.0 7 37.16375 38.0 38.0 38.0 37.0 38.0 8 37.214 38.0 38.0 38.0 37.0 38.0 9 37.0635 38.0 38.0 38.0 37.0 38.0 10-14 37.17100000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.15265000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.15225 38.0 38.0 38.0 37.0 38.0 25-29 37.15474999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.186749999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.1614 38.0 38.0 38.0 37.0 38.0 40-44 37.11880000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.10475 38.0 38.0 38.0 37.0 38.0 50-54 37.0653 38.0 38.0 38.0 37.0 38.0 55-59 37.007000000000005 38.0 38.0 38.0 36.8 38.0 60-64 36.97585 38.0 38.0 38.0 36.6 38.0 65-69 36.91754999999999 38.0 38.0 38.0 36.4 38.0 70-74 36.8744 38.0 38.0 38.0 36.0 38.0 75-79 36.7791 38.0 38.0 38.0 36.0 38.0 80-84 36.7128 38.0 38.0 38.0 36.0 38.0 85-89 36.61715 38.0 38.0 38.0 35.6 38.0 90-94 36.5264 38.0 38.0 38.0 35.2 38.0 95-99 36.524800000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.41715 38.0 38.0 38.0 34.4 38.0 105-109 36.28315 38.0 38.0 38.0 34.2 38.0 110-114 36.1034 38.0 38.0 38.0 33.8 38.0 115-119 35.962199999999996 38.0 38.0 38.0 33.6 38.0 120-124 35.781850000000006 38.0 37.4 38.0 33.0 38.0 125-129 35.56105 38.0 37.2 38.0 31.4 38.0 130-134 35.28235 38.0 36.2 38.0 30.6 38.0 135-139 34.92925 38.0 36.0 38.0 28.8 38.0 140-144 34.5792 38.0 36.0 38.0 28.2 38.0 145-149 33.570750000000004 38.0 33.4 38.0 21.6 38.0 150-151 28.735374999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 2.0 5 0.0 6 0.0 7 2.0 8 1.0 9 2.0 10 3.0 11 3.0 12 2.0 13 2.0 14 1.0 15 4.0 16 3.0 17 4.0 18 5.0 19 8.0 20 6.0 21 7.0 22 8.0 23 14.0 24 8.0 25 18.0 26 16.0 27 21.0 28 22.0 29 21.0 30 30.0 31 56.0 32 54.0 33 84.0 34 121.0 35 199.0 36 511.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 19.625 15.7 26.35 2 25.924999999999997 27.150000000000002 30.3 16.625 3 21.125 29.2 31.075000000000003 18.6 4 23.225 35.3 22.775000000000002 18.7 5 24.525 35.975 22.225 17.275 6 20.575 37.3 23.875 18.25 7 19.650000000000002 19.35 40.975 20.025000000000002 8 20.95 23.775 28.375 26.900000000000002 9 22.85 24.575 29.45 23.125 10-14 22.935 28.725 27.105 21.235 15-19 22.785 27.705000000000002 28.38 21.13 20-24 23.09 27.72 28.410000000000004 20.78 25-29 22.595000000000002 28.625 27.965 20.815 30-34 22.935 28.194999999999997 28.125 20.745 35-39 22.54 28.255000000000003 28.18 21.025 40-44 23.105 28.175 28.17 20.549999999999997 45-49 23.0 28.04 28.165000000000003 20.794999999999998 50-54 23.26 27.83 28.48 20.43 55-59 23.015 27.58 28.505000000000003 20.9 60-64 23.07 28.38 28.16 20.39 65-69 23.03 28.365000000000002 27.805000000000003 20.8 70-74 22.585 27.985 28.485 20.945 75-79 23.064999999999998 27.6 28.37 20.965 80-84 23.380000000000003 27.92 28.02 20.68 85-89 23.375 28.01 27.839999999999996 20.775 90-94 23.75 28.26 27.794999999999998 20.195 95-99 23.44117205860293 27.936396819840994 28.686434321716085 19.93599679983999 100-104 23.74737473747375 28.052805280528055 27.97779777977798 20.22202220222022 105-109 23.577357735773578 27.747774777477748 28.18781878187819 20.487048704870485 110-114 23.651182559127957 28.401420071003553 27.811390569528477 20.136006800340017 115-119 24.131206560328017 27.961398069903492 27.78138906945347 20.126006300315016 120-124 24.031201560078003 27.69638481924096 27.551377568878443 20.721036051802592 125-129 24.09 27.584999999999997 27.894999999999996 20.43 130-134 24.611230561528078 28.05140257012851 27.146357317865892 20.191009550477524 135-139 24.611230561528078 27.861393069653484 27.67638381919096 19.85099254962748 140-144 24.82 28.22 26.815 20.145 145-149 25.590000000000003 28.035 27.48 18.895 150-151 25.4375 27.3625 28.237499999999997 18.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 1.5 24 3.5 25 4.5 26 4.5 27 6.0 28 11.5 29 13.5 30 15.5 31 20.0 32 26.0 33 37.0 34 54.0 35 76.5 36 97.5 37 121.0 38 149.0 39 183.5 40 200.5 41 212.0 42 252.5 43 273.0 44 272.0 45 271.0 46 251.0 47 244.5 48 239.5 49 200.5 50 154.0 51 129.5 52 112.5 53 87.0 54 64.5 55 51.5 56 46.0 57 37.0 58 21.5 59 14.5 60 13.0 61 8.5 62 6.0 63 4.5 64 2.0 65 0.5 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.01 105-109 0.01 110-114 0.005 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.025 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.8875 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 8.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGACT 10 0.006830828 145.0 4 >>END_MODULE Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767892 spots for SRR7168828.sra Written 767892 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra Read 767881 spots for SRR7168828.sra Written 767881 spots for SRR7168828.sra SRR ids: ['SRR7168828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_ab57kt SRR7168828.sra spots: 15357631 blocks: [[1, 767881], [767882, 1535762], [1535763, 2303643], [2303644, 3071524], [3071525, 3839405], [3839406, 4607286], [4607287, 5375167], [5375168, 6143048], [6143049, 6910929], [6910930, 7678810], [7678811, 8446691], [8446692, 9214572], [9214573, 9982453], [9982454, 10750334], [10750335, 11518215], [11518216, 12286096], [12286097, 13053977], [13053978, 13821858], [13821859, 14589739], [14589740, 15357631]] SRR7168828 file size 5182496 SRR7168828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168828 SRR7168828_1.fastq SRR7168828_2.fastq Input file: SRR7168828_1.fastq Paired file: SRR7168828_2.fastq trimmed: SRR7168828-trimmed-pair1.fastq, SRR7168828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:13:23 2025 >> started Thu Apr 10 15:13:40 2025 >> done (17.219s) 15357631 read pairs processed; of these: 20514 ( 0.13%) short read pairs filtered out after trimming by size control 28271 ( 0.18%) empty read pairs filtered out after trimming by size control 15308846 (99.68%) read pairs available; of these: 8095747 (52.88%) trimmed read pairs available after processing 7213099 (47.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 3 0.00% 24 2 0.00% 25 7 0.00% 26 13 0.00% 27 13 0.00% 28 3 0.00% 29 8 0.00% 30 13 0.00% 31 12 0.00% 32 11 0.00% 33 14 0.00% 34 11 0.00% 35 17 0.00% 36 12 0.00% 37 23 0.00% 38 27 0.00% 39 21 0.00% 40 24 0.00% 41 39 0.00% 42 31 0.00% 43 43 0.00% 44 37 0.00% 45 64 0.00% 46 67 0.00% 47 71 0.00% 48 69 0.00% 49 94 0.00% 50 86 0.00% 51 94 0.00% 52 140 0.00% 53 134 0.00% 54 146 0.00% 55 177 0.00% 56 191 0.00% 57 201 0.00% 58 246 0.00% 59 245 0.00% 60 327 0.00% 61 373 0.00% 62 409 0.00% 63 456 0.00% 64 468 0.00% 65 618 0.00% 66 657 0.00% 67 708 0.00% 68 890 0.01% 69 1349 0.01% 70 1316 0.01% 71 1263 0.01% 72 1373 0.01% 73 1615 0.01% 74 1740 0.01% 75 1839 0.01% 76 2127 0.01% 77 2397 0.02% 78 2633 0.02% 79 3038 0.02% 80 3384 0.02% 81 3750 0.02% 82 4432 0.03% 83 4892 0.03% 84 6095 0.04% 85 6897 0.05% 86 7559 0.05% 87 8082 0.05% 88 8532 0.06% 89 9033 0.06% 90 10138 0.07% 91 10508 0.07% 92 11476 0.07% 93 12456 0.08% 94 13660 0.09% 95 14465 0.09% 96 15088 0.10% 97 15864 0.10% 98 16304 0.11% 99 17103 0.11% 100 18321 0.12% 101 19405 0.13% 102 20740 0.14% 103 21738 0.14% 104 23605 0.15% 105 24533 0.16% 106 25448 0.17% 107 26512 0.17% 108 27025 0.18% 109 28246 0.18% 110 29350 0.19% 111 30736 0.20% 112 32126 0.21% 113 33390 0.22% 114 34694 0.23% 115 36560 0.24% 116 37532 0.25% 117 38125 0.25% 118 39212 0.26% 119 40463 0.26% 120 41613 0.27% 121 43044 0.28% 122 44298 0.29% 123 46435 0.30% 124 48204 0.31% 125 50344 0.33% 126 52443 0.34% 127 53370 0.35% 128 54475 0.36% 129 56032 0.37% 130 57123 0.37% 131 59384 0.39% 132 62164 0.41% 133 65158 0.43% 134 68042 0.44% 135 71188 0.47% 136 74606 0.49% 137 78646 0.51% 138 82629 0.54% 139 87304 0.57% 140 91960 0.60% 141 99164 0.65% 142 108647 0.71% 143 121052 0.79% 144 139944 0.91% 145 163774 1.07% 146 202457 1.32% 147 269277 1.76% 148 398441 2.60% 149 778648 5.09% 150 3710382 24.24% 151 7213099 47.12% 15308846 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.36 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=328.23 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=43.34 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.3 sequence=ACACAGAGAACACATTCATAC SRR7168828 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:14:34 Started mapping on | Apr 10 15:14:34 Finished on | Apr 10 15:16:16 Mapping speed, Million of reads per hour | 540.31 Number of input reads | 15308846 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14262574 Uniquely mapped reads % | 93.17% Average mapped length | 291.30 Number of splices: Total | 13332427 Number of splices: Annotated (sjdb) | 13013041 Number of splices: GT/AG | 13084883 Number of splices: GC/AG | 198599 Number of splices: AT/AC | 7987 Number of splices: Non-canonical | 40958 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433118 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 53308 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 630371 630371 630371 N_multimapping 433118 433118 433118 N_noFeature 589569 13936304 795925 N_ambiguous 222313 1490 101262 UnstrandedReadsAssigned:13450692 PositiveStrandReadsAssigned:324780 NegativeStrandReadsAssigned:13365387 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168828-trimmed-pair1.fastq SRR7168828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,308,846 reads, 13,390,711 reads pseudoaligned [quant] estimated average fragment length: 231.883 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7168828.ke.tsv 34699 SRR7168828.se.tsv 87100 total ==> SRR7168828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.12 874 36.5147 Potri.005G024800.1.v4.1 1035 804.117 326 30.2696 Potri.004G059700.1.v4.1 961 730.155 4 0.409029 Potri.007G009000.2.v4.1 1416 1185.12 0 0 Potri.003G141000.2.v4.1 2943 2712.12 922.413 25.3937 Potri.016G087400.1.v4.1 270 87.0431 706.333 605.877 Potri.015G069301.1.v4.1 564 337.896 0 0 Potri.010G195200.1.v4.1 1773 1542.12 479 23.1914 Potri.012G127500.1.v4.1 977 746.128 118 11.808 ==> SRR7168828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 801 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 74 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7168828 completed mapping pipeline successfully