Starting /dee2/code/volunteer_pipeline.sh SRR7168829 current disk space = 3099003654144 free memory = 1582762568 SRR7168829 SRAfilesize 647a6c94bb31c6097414523ab61749f8 SRR7168829.sra SRR7168829.sra file validated SRR7168829 is paired end SRR7168829 is conventional basespace SRR7168829 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.94275 34.0 33.0 34.0 30.0 34.0 2 33.098 34.0 34.0 34.0 30.0 34.0 3 33.2845 34.0 34.0 34.0 32.0 34.0 4 33.50775 34.0 34.0 34.0 33.0 34.0 5 33.545 34.0 34.0 34.0 33.0 34.0 6 37.41275 38.0 38.0 38.0 37.0 38.0 7 37.5675 38.0 38.0 38.0 37.0 38.0 8 37.6145 38.0 38.0 38.0 38.0 38.0 9 37.65925 38.0 38.0 38.0 38.0 38.0 10-14 37.62845 38.0 38.0 38.0 38.0 38.0 15-19 37.63439999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.60825 38.0 38.0 38.0 38.0 38.0 25-29 37.52675000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.577200000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.54175 38.0 38.0 38.0 38.0 38.0 40-44 37.5212 38.0 38.0 38.0 38.0 38.0 45-49 37.5318 38.0 38.0 38.0 38.0 38.0 50-54 37.4757 38.0 38.0 38.0 38.0 38.0 55-59 37.4658 38.0 38.0 38.0 37.6 38.0 60-64 37.41455 38.0 38.0 38.0 37.0 38.0 65-69 37.37075 38.0 38.0 38.0 37.0 38.0 70-74 37.3135 38.0 38.0 38.0 37.0 38.0 75-79 37.155249999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.121050000000004 38.0 38.0 38.0 36.8 38.0 85-89 37.00515 38.0 38.0 38.0 36.2 38.0 90-94 36.95495 38.0 38.0 38.0 36.0 38.0 95-99 36.863099999999996 38.0 38.0 38.0 35.8 38.0 100-104 36.76389999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.6546 38.0 38.0 38.0 34.8 38.0 110-114 36.49325 38.0 38.0 38.0 34.2 38.0 115-119 36.25664999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.12105 38.0 38.0 38.0 33.6 38.0 125-129 35.80459999999999 38.0 37.2 38.0 32.8 38.0 130-134 35.59845 38.0 36.6 38.0 31.6 38.0 135-139 35.179700000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.69315 38.0 35.6 38.0 29.2 38.0 145-149 33.85555 38.0 33.2 38.0 24.4 38.0 150-151 29.569875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 6.0 19 9.0 20 6.0 21 2.0 22 5.0 23 10.0 24 9.0 25 12.0 26 15.0 27 13.0 28 17.0 29 24.0 30 23.0 31 42.0 32 48.0 33 63.0 34 101.0 35 187.0 36 602.0 37 2800.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.454297407912684 12.851296043656207 12.633015006821283 35.06139154160982 2 22.1 18.325 32.574999999999996 27.0 3 20.125 24.875 25.074999999999996 29.925 4 22.425 31.324999999999996 22.475 23.775 5 22.225 34.675 23.75 19.35 6 18.45 35.925000000000004 25.55 20.075000000000003 7 14.274999999999999 24.85 42.15 18.725 8 18.2 24.3 31.6 25.900000000000002 9 18.35 24.349999999999998 32.95 24.349999999999998 10-14 19.935 29.535 27.07 23.46 15-19 19.75 28.34 28.21 23.7 20-24 20.315 28.535 27.525 23.625 25-29 19.39 29.17 27.555000000000003 23.885 30-34 19.575 28.27 28.04 24.115000000000002 35-39 20.135 28.475 27.6 23.79 40-44 19.77 28.895 27.650000000000002 23.685000000000002 45-49 20.24 28.475 27.845 23.44 50-54 20.145 28.26 27.58 24.015 55-59 20.1 28.275 27.72 23.905 60-64 20.05 28.720000000000002 27.33 23.9 65-69 20.135 28.189999999999998 27.800000000000004 23.875 70-74 19.564999999999998 29.285 27.685 23.465 75-79 20.34 28.615000000000002 27.455000000000002 23.59 80-84 20.025000000000002 28.815 27.605 23.555 85-89 19.965 28.915000000000003 27.675 23.445 90-94 20.3 28.58 27.29 23.830000000000002 95-99 20.845 28.845 26.950000000000003 23.36 100-104 20.135 28.315 27.634999999999998 23.915 105-109 21.265 27.900000000000002 27.41 23.425 110-114 20.455000000000002 28.395 27.505000000000003 23.645 115-119 20.43 29.220000000000002 26.345000000000002 24.005000000000003 120-124 20.705000000000002 28.815 26.595000000000002 23.885 125-129 20.57 28.78 26.235000000000003 24.415 130-134 20.49 28.605000000000004 26.534999999999997 24.37 135-139 20.86 28.115000000000002 26.575 24.45 140-144 20.445 28.845 26.575 24.135 145-149 20.0 28.835 26.76 24.404999999999998 150-151 19.839377588154097 28.86183962856067 26.803864976785043 24.494917806500187 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 3.5 26 5.5 27 6.5 28 6.5 29 9.5 30 16.0 31 22.0 32 41.5 33 55.0 34 56.5 35 72.5 36 96.0 37 116.0 38 141.0 39 160.5 40 189.5 41 230.0 42 248.0 43 263.5 44 286.5 45 276.5 46 250.5 47 235.0 48 212.5 49 179.5 50 170.5 51 157.5 52 119.0 53 89.5 54 62.5 55 48.0 56 45.0 57 36.5 58 25.0 59 17.5 60 15.0 61 12.5 62 5.5 63 3.0 64 2.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.25113008538422904 0.5 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025113008538422906 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCCTAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 18 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.4249999999999998 0.0 0.0 0.0 0.0 92-93 1.725 0.0 0.0 0.0 0.0 94-95 2.0875 0.0 0.0 0.0 0.0 96-97 2.3499999999999996 0.0 0.0 0.0 0.0 98-99 2.6375 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.275 0.0 0.0 0.0 0.0 104-105 3.925 0.0 0.0 0.0 0.0 106-107 4.4125 0.0 0.0 0.0 0.0 108-109 4.9625 0.0 0.0 0.0 0.0 110-111 5.6 0.0 0.0 0.0 0.0 112-113 6.15 0.0 0.0 0.0 0.0 114-115 6.8125 0.0 0.0 0.0 0.0 116-117 7.4375 0.0 0.0 0.0 0.0 118-119 8.05 0.0 0.0 0.0 0.0 120-121 8.775 0.0 0.0 0.0 0.0 122-123 9.399999999999999 0.0 0.0 0.0 0.0 124-125 10.1625 0.0 0.0 0.0 0.0 126-127 10.774999999999999 0.0 0.0 0.0 0.0 128-129 11.5625 0.0 0.0 0.0 0.0 130-131 12.375 0.0 0.0 0.0 0.0 132-133 12.975 0.0 0.0 0.0 0.0 134-135 13.8125 0.0 0.0 0.0 0.0 136-137 14.6375 0.0 0.0 0.0 0.0 138-139 15.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGGA 10 0.006836113 144.9625 7 TTAGCAT 10 0.006836113 144.9625 7 >>END_MODULE SRR7168829 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06375 33.0 33.0 34.0 32.0 34.0 2 33.22 34.0 33.0 34.0 33.0 34.0 3 33.2435 34.0 33.0 34.0 33.0 34.0 4 33.2235 34.0 33.0 34.0 33.0 34.0 5 33.275 34.0 33.0 34.0 33.0 34.0 6 37.431 38.0 38.0 38.0 38.0 38.0 7 37.42675 38.0 38.0 38.0 38.0 38.0 8 37.406 38.0 38.0 38.0 38.0 38.0 9 37.41 38.0 38.0 38.0 38.0 38.0 10-14 37.38175 38.0 38.0 38.0 38.0 38.0 15-19 37.414249999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.38405 38.0 38.0 38.0 38.0 38.0 25-29 37.3772 38.0 38.0 38.0 38.0 38.0 30-34 37.4041 38.0 38.0 38.0 38.0 38.0 35-39 37.39905 38.0 38.0 38.0 38.0 38.0 40-44 37.396300000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.34205 38.0 38.0 38.0 38.0 38.0 50-54 37.30075 38.0 38.0 38.0 38.0 38.0 55-59 37.3162 38.0 38.0 38.0 38.0 38.0 60-64 37.291700000000006 38.0 38.0 38.0 37.8 38.0 65-69 37.14960000000001 38.0 38.0 38.0 37.4 38.0 70-74 37.097 38.0 38.0 38.0 37.0 38.0 75-79 37.0394 38.0 38.0 38.0 37.0 38.0 80-84 36.88625 38.0 38.0 38.0 37.0 38.0 85-89 36.82765 38.0 38.0 38.0 36.2 38.0 90-94 36.78225 38.0 38.0 38.0 36.0 38.0 95-99 36.7313 38.0 38.0 38.0 36.0 38.0 100-104 36.68195 38.0 38.0 38.0 35.8 38.0 105-109 36.5908 38.0 38.0 38.0 35.0 38.0 110-114 36.42665 38.0 38.0 38.0 34.8 38.0 115-119 36.323249999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.10535 38.0 38.0 38.0 34.0 38.0 125-129 35.870400000000004 38.0 38.0 38.0 33.2 38.0 130-134 35.569399999999995 38.0 37.2 38.0 32.8 38.0 135-139 35.056599999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.46395 38.0 35.8 38.0 27.6 38.0 145-149 33.555600000000005 38.0 33.4 38.0 20.6 38.0 150-151 28.197375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 0.0 5 1.0 6 1.0 7 2.0 8 2.0 9 1.0 10 1.0 11 3.0 12 1.0 13 1.0 14 0.0 15 5.0 16 3.0 17 13.0 18 5.0 19 6.0 20 5.0 21 8.0 22 8.0 23 8.0 24 12.0 25 8.0 26 13.0 27 7.0 28 21.0 29 16.0 30 25.0 31 33.0 32 49.0 33 55.0 34 107.0 35 175.0 36 507.0 37 2890.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.925 19.475 16.150000000000002 26.450000000000003 2 25.85 26.375 31.0 16.775000000000002 3 20.825 29.125 30.5 19.55 4 24.7 34.4 23.625 17.275 5 25.25 35.3 22.475 16.975 6 20.77077077077077 36.83683683683684 23.523523523523522 18.86886886886887 7 19.664748561421067 20.240180135101326 40.38028521391043 19.714786089567177 8 23.011505752876438 26.138069034517258 26.43821910955478 24.412206103051524 9 23.986993496748372 24.712356178089045 29.214607303651825 22.086043021510758 10-14 23.12618833183228 29.3705593915741 26.493545481837288 21.00970679475633 15-19 23.512634475856892 27.760820615461597 28.136102076557417 20.590442832124094 20-24 23.459940949807336 28.41915628284041 27.498373617574938 20.62252914977731 25-29 23.300970873786408 28.45561004904414 27.810029026123512 20.43339005104594 30-34 23.602422301186127 27.786397077223363 27.941544467243883 20.66963615434663 35-39 23.757320919056916 27.832006807829003 27.136206637633276 21.2744656354808 40-44 23.202401801351012 27.92594445834376 27.920940705529144 20.950713034776083 45-49 23.485568505827622 27.84252913811215 28.017607923565606 20.65429443249462 50-54 23.091545772886445 28.509254627313656 27.63381690845423 20.765382691345675 55-59 22.84098869208446 27.709396577604323 29.015310717502253 20.434304012808965 60-64 23.467907349041973 27.930361698934412 27.865325929261093 20.73640502276252 65-69 23.817863397548162 28.026019514635976 27.420565424068048 20.735551663747813 70-74 23.800230195666316 28.47920732622729 27.76860331281589 19.951959165290496 75-79 23.37402441464879 28.066840104062436 27.64658795277166 20.912547528517113 80-84 23.504679913909605 27.513889584063268 27.84924170378898 21.13218879823815 85-89 23.537360492467844 28.497072218607677 27.571192633001353 20.394374655923126 90-94 23.690398759193478 28.143293140541353 27.693000450292693 20.473307649972483 95-99 23.78332416345721 27.94478067323563 27.454609113189615 20.81728605011754 100-104 24.06221866559968 28.118435530659198 27.423226968090425 20.396118835650697 105-109 24.250912910809863 27.142213996298338 28.55284878195188 20.054024310939923 110-114 24.31851147901766 28.09983494222978 27.879757915270343 19.70189566348222 115-119 24.887421194836385 28.399879915941156 27.12398679075353 19.58871209846893 120-124 25.01125957063504 28.48921583345844 27.238152429565133 19.26137216634139 125-129 25.472925633069764 27.97517765989391 27.094384946451804 19.457511760584527 130-134 25.91943957968476 28.381285964473356 26.459844883662747 19.239429572179134 135-139 25.808065645952166 28.5349744821375 26.803762633843693 18.853197238066645 140-144 25.84404541589556 27.809733406692345 27.279547841744613 19.066673335667485 145-149 26.46220043027968 28.428478511032175 26.252063841496977 18.857257217191176 150-151 26.575 28.012500000000003 26.474999999999998 18.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 1.5 26 1.5 27 4.0 28 7.5 29 6.0 30 9.0 31 16.0 32 23.0 33 33.5 34 45.5 35 69.0 36 91.0 37 116.0 38 148.5 39 170.5 40 198.0 41 241.0 42 266.0 43 271.5 44 271.0 45 263.0 46 263.0 47 255.5 48 215.0 49 181.0 50 174.5 51 152.5 52 112.0 53 82.0 54 74.5 55 62.5 56 45.0 57 36.0 58 24.0 59 16.0 60 14.5 61 12.5 62 7.0 63 2.5 64 2.0 65 2.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.05 9 0.05 10-14 0.06999999999999999 15-19 0.075 20-24 0.08499999999999999 25-29 0.09 30-34 0.095 35-39 0.11499999999999999 40-44 0.075 45-49 0.045 50-54 0.05 55-59 0.06999999999999999 60-64 0.055 65-69 0.075 70-74 0.08499999999999999 75-79 0.06 80-84 0.105 85-89 0.095 90-94 0.065 95-99 0.034999999999999996 100-104 0.03 105-109 0.045 110-114 0.034999999999999996 115-119 0.06999999999999999 120-124 0.08499999999999999 125-129 0.09 130-134 0.075 135-139 0.06999999999999999 140-144 0.034999999999999996 145-149 0.065 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.4278882456581928 0.8500000000000001 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025169896803423106 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 90-91 1.4500000000000002 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.4000000000000004 0.0 0.0 0.0 0.0 98-99 2.6875 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.3125 0.0 0.0 0.0 0.0 104-105 4.050000000000001 0.0 0.0 0.0 0.0 106-107 4.5375 0.0 0.0 0.0 0.0 108-109 5.0875 0.0 0.0 0.0 0.0 110-111 5.725 0.0 0.0 0.0 0.0 112-113 6.275 0.0 0.0 0.0 0.0 114-115 6.925 0.0 0.0 0.0 0.0 116-117 7.6 0.0 0.0 0.0 0.0 118-119 8.149999999999999 0.0 0.0 0.0 0.0 120-121 8.8 0.0 0.0 0.0 0.0 122-123 9.425 0.0 0.0 0.0 0.0 124-125 10.2375 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 11.6375 0.0 0.0 0.0 0.0 130-131 12.462499999999999 0.0 0.0 0.0 0.0 132-133 13.0 0.0 0.0 0.0 0.0 134-135 13.85 0.0 0.0 0.0 0.0 136-137 14.662500000000001 0.0 0.0 0.0 0.0 138-139 15.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACCT 10 0.006830828 145.0 8 GTTCTCT 10 0.006830828 145.0 1 GGATCGA 10 0.006830828 145.0 4 >>END_MODULE Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078987 spots for SRR7168829.sra Written 1078987 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra Read 1078969 spots for SRR7168829.sra Written 1078969 spots for SRR7168829.sra SRR ids: ['SRR7168829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pcxpsh4k SRR7168829.sra spots: 21579398 blocks: [[1, 1078969], [1078970, 2157938], [2157939, 3236907], [3236908, 4315876], [4315877, 5394845], [5394846, 6473814], [6473815, 7552783], [7552784, 8631752], [8631753, 9710721], [9710722, 10789690], [10789691, 11868659], [11868660, 12947628], [12947629, 14026597], [14026598, 15105566], [15105567, 16184535], [16184536, 17263504], [17263505, 18342473], [18342474, 19421442], [19421443, 20500411], [20500412, 21579398]] SRR7168829 file size 7290849 SRR7168829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168829 SRR7168829_1.fastq SRR7168829_2.fastq Input file: SRR7168829_1.fastq Paired file: SRR7168829_2.fastq trimmed: SRR7168829-trimmed-pair1.fastq, SRR7168829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:20:40 2025 >> started Sat Feb 15 04:21:04 2025 >> done (23.875s) 21579398 read pairs processed; of these: 29682 ( 0.14%) short read pairs filtered out after trimming by size control 94557 ( 0.44%) empty read pairs filtered out after trimming by size control 21455159 (99.42%) read pairs available; of these: 12077745 (56.29%) trimmed read pairs available after processing 9377414 (43.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 12 0.00% 21 9 0.00% 22 9 0.00% 23 13 0.00% 24 27 0.00% 25 16 0.00% 26 20 0.00% 27 28 0.00% 28 33 0.00% 29 20 0.00% 30 39 0.00% 31 34 0.00% 32 26 0.00% 33 30 0.00% 34 34 0.00% 35 50 0.00% 36 61 0.00% 37 53 0.00% 38 69 0.00% 39 101 0.00% 40 98 0.00% 41 122 0.00% 42 120 0.00% 43 138 0.00% 44 163 0.00% 45 195 0.00% 46 182 0.00% 47 226 0.00% 48 233 0.00% 49 323 0.00% 50 345 0.00% 51 408 0.00% 52 444 0.00% 53 484 0.00% 54 520 0.00% 55 612 0.00% 56 616 0.00% 57 693 0.00% 58 864 0.00% 59 960 0.00% 60 1114 0.01% 61 1307 0.01% 62 1467 0.01% 63 1677 0.01% 64 1972 0.01% 65 2173 0.01% 66 2356 0.01% 67 2570 0.01% 68 3123 0.01% 69 6083 0.03% 70 6704 0.03% 71 5264 0.02% 72 5227 0.02% 73 5905 0.03% 74 6672 0.03% 75 7266 0.03% 76 7822 0.04% 77 8371 0.04% 78 9300 0.04% 79 9975 0.05% 80 11466 0.05% 81 12917 0.06% 82 14976 0.07% 83 16465 0.08% 84 18847 0.09% 85 21008 0.10% 86 22412 0.10% 87 23460 0.11% 88 24812 0.12% 89 26664 0.12% 90 28619 0.13% 91 31188 0.15% 92 33926 0.16% 93 37418 0.17% 94 40207 0.19% 95 42673 0.20% 96 44016 0.21% 97 45297 0.21% 98 46535 0.22% 99 48476 0.23% 100 49941 0.23% 101 52569 0.25% 102 56148 0.26% 103 59632 0.28% 104 61539 0.29% 105 64317 0.30% 106 65777 0.31% 107 67423 0.31% 108 68025 0.32% 109 69330 0.32% 110 70436 0.33% 111 71669 0.33% 112 74622 0.35% 113 77908 0.36% 114 79626 0.37% 115 83283 0.39% 116 84103 0.39% 117 85115 0.40% 118 85854 0.40% 119 85597 0.40% 120 85957 0.40% 121 86959 0.41% 122 89534 0.42% 123 92969 0.43% 124 95350 0.44% 125 97668 0.46% 126 100031 0.47% 127 101186 0.47% 128 101780 0.47% 129 103151 0.48% 130 103724 0.48% 131 104604 0.49% 132 107089 0.50% 133 110428 0.51% 134 113288 0.53% 135 117458 0.55% 136 120993 0.56% 137 124997 0.58% 138 127528 0.59% 139 132797 0.62% 140 136118 0.63% 141 143302 0.67% 142 153130 0.71% 143 165128 0.77% 144 184283 0.86% 145 208728 0.97% 146 251263 1.17% 147 324395 1.51% 148 482653 2.25% 149 944522 4.40% 150 4857636 22.64% 151 9377414 43.71% 21455159 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.50 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=52.44 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=40.28 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7168829 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:21:50 Started mapping on | Feb 15 04:21:50 Finished on | Feb 15 04:24:31 Mapping speed, Million of reads per hour | 479.74 Number of input reads | 21455159 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 19827227 Uniquely mapped reads % | 92.41% Average mapped length | 286.24 Number of splices: Total | 17987620 Number of splices: Annotated (sjdb) | 17565488 Number of splices: GT/AG | 17623970 Number of splices: GC/AG | 294990 Number of splices: AT/AC | 10120 Number of splices: Non-canonical | 58540 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 659179 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 70764 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 986303 986303 986303 N_multimapping 659179 659179 659179 N_noFeature 695046 19387186 965938 N_ambiguous 323756 2083 153033 UnstrandedReadsAssigned:18808425 PositiveStrandReadsAssigned:437958 NegativeStrandReadsAssigned:18708256 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7168829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168829-trimmed-pair1.fastq SRR7168829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,455,159 reads, 18,783,253 reads pseudoaligned [quant] estimated average fragment length: 212.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR7168829.ke.tsv 34699 SRR7168829.se.tsv 87100 total ==> SRR7168829.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.76 749 23.0627 Potri.005G024800.1.v4.1 1035 823.764 459 30.9984 Potri.004G059700.1.v4.1 961 749.791 21 1.55815 Potri.007G009000.2.v4.1 1416 1204.76 0 0 Potri.003G141000.2.v4.1 2943 2731.76 1321.83 26.9191 Potri.016G087400.1.v4.1 270 98.913 933 524.756 Potri.015G069301.1.v4.1 564 356.03 0 0 Potri.010G195200.1.v4.1 1773 1561.76 76 2.70725 Potri.012G127500.1.v4.1 977 765.786 309 22.4482 ==> SRR7168829.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 249 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR7168829 completed mapping pipeline successfully