Starting /dee2/code/volunteer_pipeline.sh SRR7168830 current disk space = 3102412976128 free memory = 1449536256 SRR7168830 SRAfilesize 57fb0ee6f963900dc6567977367c92a2 SRR7168830.sra SRR7168830.sra file validated SRR7168830 is paired end SRR7168830 is conventional basespace SRR7168830 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.063 34.0 33.0 34.0 32.0 34.0 2 33.11725 34.0 33.0 34.0 32.0 34.0 3 33.25625 34.0 33.0 34.0 32.0 34.0 4 33.24425 34.0 33.0 34.0 32.0 34.0 5 33.33675 34.0 33.0 34.0 33.0 34.0 6 36.9885 38.0 37.0 38.0 36.0 38.0 7 37.20675 38.0 38.0 38.0 36.0 38.0 8 37.41575 38.0 38.0 38.0 37.0 38.0 9 37.42375 38.0 38.0 38.0 37.0 38.0 10-14 37.442750000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.433749999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4367 38.0 38.0 38.0 37.0 38.0 25-29 37.4384 38.0 38.0 38.0 37.0 38.0 30-34 37.4163 38.0 38.0 38.0 37.0 38.0 35-39 37.3613 38.0 38.0 38.0 37.0 38.0 40-44 37.32115 38.0 38.0 38.0 37.0 38.0 45-49 37.30675 38.0 38.0 38.0 37.0 38.0 50-54 37.263099999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.176100000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.17115 38.0 38.0 38.0 36.0 38.0 65-69 37.110350000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.0817 38.0 38.0 38.0 36.0 38.0 75-79 37.02105 38.0 38.0 38.0 36.0 38.0 80-84 36.94345 38.0 38.0 38.0 36.0 38.0 85-89 36.85255 38.0 38.0 38.0 35.4 38.0 90-94 36.7166 38.0 38.0 38.0 34.8 38.0 95-99 36.605900000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.56595 38.0 38.0 38.0 34.0 38.0 105-109 36.287 38.0 38.0 38.0 34.0 38.0 110-114 36.1813 38.0 37.8 38.0 33.6 38.0 115-119 35.8934 38.0 37.0 38.0 32.2 38.0 120-124 35.69195 38.0 36.8 38.0 31.0 38.0 125-129 35.4486 38.0 36.0 38.0 31.0 38.0 130-134 35.004949999999994 38.0 35.8 38.0 29.4 38.0 135-139 34.700900000000004 38.0 35.2 38.0 27.2 38.0 140-144 34.01345 38.0 33.6 38.0 24.4 38.0 145-149 33.052150000000005 38.0 33.0 38.0 17.4 38.0 150-151 28.0005 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 2.0 18 2.0 19 5.0 20 6.0 21 5.0 22 2.0 23 7.0 24 9.0 25 16.0 26 19.0 27 19.0 28 28.0 29 36.0 30 52.0 31 61.0 32 79.0 33 103.0 34 140.0 35 264.0 36 703.0 37 2439.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.87490226739641 13.838936669272869 11.519416210581184 34.76674485274954 2 24.025 17.150000000000002 33.0 25.825 3 19.8 24.325 25.35 30.525000000000002 4 22.475 32.375 22.1 23.05 5 21.4 36.475 22.900000000000002 19.225 6 17.875 37.8 24.775 19.55 7 14.899999999999999 25.05 43.1 16.950000000000003 8 18.65 25.4 28.799999999999997 27.150000000000002 9 18.05 24.474999999999998 34.325 23.150000000000002 10-14 20.015 29.515 27.12 23.35 15-19 19.86 28.525 27.74 23.875 20-24 20.275000000000002 27.765 28.249999999999996 23.71 25-29 20.615 28.89 27.084999999999997 23.41 30-34 20.215 28.134999999999998 27.955000000000002 23.695 35-39 20.39 29.330000000000002 26.86 23.419999999999998 40-44 20.424999999999997 28.799999999999997 27.400000000000002 23.375 45-49 20.775 29.025000000000002 27.165 23.035 50-54 20.455000000000002 28.435 26.634999999999998 24.474999999999998 55-59 20.51 28.455000000000002 27.51 23.525 60-64 20.645 28.110000000000003 27.310000000000002 23.935000000000002 65-69 21.33 27.805000000000003 27.315 23.549999999999997 70-74 20.635 27.79 27.445000000000004 24.13 75-79 20.185 28.249999999999996 27.425 24.14 80-84 19.99 28.835 27.08 24.095 85-89 20.565 28.444999999999997 27.485 23.505000000000003 90-94 20.875 27.88 27.32 23.925 95-99 20.115 28.43 27.779999999999998 23.674999999999997 100-104 20.349999999999998 28.1 27.639999999999997 23.91 105-109 20.635 27.93 27.279999999999998 24.154999999999998 110-114 20.990000000000002 27.92 27.445000000000004 23.645 115-119 20.7 27.855 27.265 24.18 120-124 20.585 28.38 27.205000000000002 23.830000000000002 125-129 21.18 28.23 27.105 23.485 130-134 21.105 28.849999999999998 26.47 23.575 135-139 21.115000000000002 28.405 26.795 23.685000000000002 140-144 20.96 28.285 26.255 24.5 145-149 21.3 28.475 26.724999999999998 23.5 150-151 20.95 29.362500000000004 26.8625 22.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 0.0 24 1.5 25 3.0 26 3.0 27 6.5 28 9.0 29 9.5 30 12.5 31 19.0 32 28.0 33 41.5 34 55.5 35 69.5 36 90.5 37 110.0 38 137.5 39 178.0 40 201.5 41 209.5 42 216.0 43 236.5 44 262.0 45 266.0 46 257.5 47 248.5 48 241.0 49 221.5 50 182.5 51 140.5 52 116.0 53 98.5 54 83.0 55 61.5 56 42.5 57 36.5 58 31.0 59 22.5 60 15.0 61 11.5 62 7.0 63 4.0 64 2.5 65 2.0 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.5799293998991427 1.15 3 0.10085728693898136 0.3 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.0999999999999996 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.6625 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.9 0.0 0.0 0.0 0.0 128-129 6.3625 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.9375 0.0 0.0 0.0 0.0 136-137 8.5125 0.0 0.0 0.0 0.0 138-139 9.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGGAC 10 0.006836113 144.9625 4 >>END_MODULE SRR7168830 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168830_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7665 33.0 33.0 34.0 32.0 34.0 2 32.91825 33.0 33.0 34.0 32.0 34.0 3 32.90075 34.0 33.0 34.0 32.0 34.0 4 32.87675 34.0 33.0 34.0 32.0 34.0 5 32.8675 34.0 33.0 34.0 32.0 34.0 6 36.992 38.0 38.0 38.0 36.0 38.0 7 37.026 38.0 38.0 38.0 36.0 38.0 8 37.02525 38.0 38.0 38.0 37.0 38.0 9 37.02075 38.0 38.0 38.0 37.0 38.0 10-14 37.049299999999995 38.0 38.0 38.0 36.2 38.0 15-19 36.993399999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.007999999999996 38.0 38.0 38.0 36.2 38.0 25-29 36.981899999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.9683 38.0 38.0 38.0 36.0 38.0 35-39 36.98785 38.0 38.0 38.0 36.0 38.0 40-44 36.9617 38.0 38.0 38.0 36.0 38.0 45-49 36.90645 38.0 38.0 38.0 36.0 38.0 50-54 36.886 38.0 38.0 38.0 36.0 38.0 55-59 36.76915 38.0 38.0 38.0 36.0 38.0 60-64 36.7703 38.0 38.0 38.0 35.8 38.0 65-69 36.68515 38.0 38.0 38.0 35.4 38.0 70-74 36.5356 38.0 38.0 38.0 34.8 38.0 75-79 36.508050000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.415 38.0 38.0 38.0 34.4 38.0 85-89 36.24235 38.0 38.0 38.0 34.0 38.0 90-94 36.2316 38.0 38.0 38.0 34.0 38.0 95-99 36.14735 38.0 38.0 38.0 33.8 38.0 100-104 36.048899999999996 38.0 38.0 38.0 33.2 38.0 105-109 35.96405 38.0 38.0 38.0 33.2 38.0 110-114 35.7252 38.0 37.2 38.0 31.6 38.0 115-119 35.5305 38.0 37.0 38.0 31.0 38.0 120-124 35.202600000000004 38.0 36.2 38.0 28.8 38.0 125-129 34.960750000000004 38.0 36.0 38.0 28.2 38.0 130-134 34.3999 38.0 35.0 38.0 25.6 38.0 135-139 33.747949999999996 38.0 33.4 38.0 22.0 38.0 140-144 33.22080000000001 38.0 33.0 38.0 18.8 38.0 145-149 31.886300000000006 38.0 33.0 38.0 8.4 38.0 150-151 26.715625 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 4.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 4.0 13 3.0 14 1.0 15 6.0 16 5.0 17 4.0 18 8.0 19 8.0 20 10.0 21 14.0 22 11.0 23 14.0 24 24.0 25 24.0 26 16.0 27 23.0 28 31.0 29 42.0 30 55.0 31 67.0 32 77.0 33 105.0 34 166.0 35 252.0 36 628.0 37 2384.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 20.375 15.725 25.55 2 26.075 26.650000000000002 31.15 16.125 3 21.6 28.15 30.099999999999998 20.150000000000002 4 24.3 35.85 22.325 17.525 5 24.025 36.3 21.725 17.95 6 19.475 38.9 22.275 19.35 7 18.3 21.5 40.375 19.825 8 23.225 24.85 26.35 25.575 9 22.675 25.074999999999996 29.425 22.825 10-14 23.47 29.175 26.265 21.09 15-19 23.494999999999997 27.805000000000003 27.779999999999998 20.919999999999998 20-24 23.369999999999997 28.915000000000003 27.11 20.605 25-29 23.724999999999998 27.975 27.49 20.810000000000002 30-34 22.375 27.675 28.549999999999997 21.4 35-39 23.105 27.85 27.884999999999998 21.16 40-44 23.49 28.035 27.785 20.69 45-49 23.380000000000003 28.21 27.229999999999997 21.18 50-54 23.215 27.51 27.955000000000002 21.32 55-59 23.485 27.485 27.91 21.12 60-64 23.265 27.935 27.750000000000004 21.05 65-69 23.46 27.725 27.555000000000003 21.26 70-74 23.41 27.765 27.650000000000002 21.175 75-79 23.27 27.805000000000003 27.49 21.435000000000002 80-84 23.275000000000002 27.22 27.98 21.525 85-89 23.807142142642792 27.38821646493948 27.57827348204461 21.226367910373114 90-94 23.73237323732373 27.23272327232723 27.767776777677767 21.267126712671267 95-99 22.866860058017405 27.81834550365109 27.978393518055416 21.336400920276084 100-104 23.528529279391908 28.119217882682403 27.44911736760514 20.903135470320546 105-109 23.376168808440422 27.86639331966598 27.94139706985349 20.816040802040103 110-114 24.422326698009403 28.243473041912576 26.89806942082625 20.436130839251774 115-119 24.056202810140505 28.531426571328566 26.826341317065854 20.58602930146507 120-124 24.136206810340514 27.83139156957848 27.376368818440923 20.65603280164008 125-129 24.560000000000002 27.55 27.85 20.04 130-134 25.296383372517635 27.63743684658096 27.082186984142865 19.98399279675854 135-139 25.21504300860172 27.510502100420087 27.435487097419486 19.838967793558712 140-144 25.386269313465675 27.51637581879094 26.781339066953347 20.316015800790037 145-149 25.718857828674302 27.704155623343503 26.523978596789515 20.05300795119268 150-151 25.49387346836709 28.044511127781945 25.78144536134033 20.68017004251063 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.0 25 2.0 26 3.5 27 6.5 28 7.0 29 8.0 30 11.5 31 15.0 32 19.0 33 30.5 34 41.0 35 53.0 36 69.0 37 94.5 38 145.0 39 185.0 40 194.5 41 220.5 42 251.0 43 263.5 44 262.0 45 257.5 46 266.0 47 258.5 48 242.0 49 224.0 50 178.5 51 137.0 52 114.5 53 99.5 54 91.0 55 66.0 56 44.0 57 32.5 58 24.5 59 18.0 60 16.5 61 16.0 62 8.0 63 3.0 64 5.0 65 3.5 66 0.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.03 90-94 0.01 95-99 0.03 100-104 0.015 105-109 0.005 110-114 0.03 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.045 135-139 0.02 140-144 0.005 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.6054490413723511 1.2 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.0250000000000004 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.7375 0.0 0.0 0.0 0.0 128-129 6.175 0.0 0.0 0.0 0.0 130-131 6.7 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.675 0.0 0.0 0.0 0.0 136-137 8.3 0.0 0.0 0.0 0.0 138-139 9.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920417 spots for SRR7168830.sra Written 920417 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra Read 920403 spots for SRR7168830.sra Written 920403 spots for SRR7168830.sra SRR ids: ['SRR7168830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3cx6m9eq SRR7168830.sra spots: 18408074 blocks: [[1, 920403], [920404, 1840806], [1840807, 2761209], [2761210, 3681612], [3681613, 4602015], [4602016, 5522418], [5522419, 6442821], [6442822, 7363224], [7363225, 8283627], [8283628, 9204030], [9204031, 10124433], [10124434, 11044836], [11044837, 11965239], [11965240, 12885642], [12885643, 13806045], [13806046, 14726448], [14726449, 15646851], [15646852, 16567254], [16567255, 17487657], [17487658, 18408074]] SRR7168830 file size 6216191 SRR7168830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168830 SRR7168830_1.fastq SRR7168830_2.fastq Input file: SRR7168830_1.fastq Paired file: SRR7168830_2.fastq trimmed: SRR7168830-trimmed-pair1.fastq, SRR7168830-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 03:35:01 2025 >> started Sat Feb 15 03:35:31 2025 >> done (29.695s) 18408074 read pairs processed; of these: 31696 ( 0.17%) short read pairs filtered out after trimming by size control 40878 ( 0.22%) empty read pairs filtered out after trimming by size control 18335500 (99.61%) read pairs available; of these: 10172460 (55.48%) trimmed read pairs available after processing 8163040 (44.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 10 0.00% 25 5 0.00% 26 8 0.00% 27 8 0.00% 28 13 0.00% 29 9 0.00% 30 11 0.00% 31 19 0.00% 32 19 0.00% 33 9 0.00% 34 11 0.00% 35 61 0.00% 36 33 0.00% 37 27 0.00% 38 42 0.00% 39 33 0.00% 40 43 0.00% 41 70 0.00% 42 47 0.00% 43 72 0.00% 44 67 0.00% 45 89 0.00% 46 80 0.00% 47 93 0.00% 48 118 0.00% 49 98 0.00% 50 130 0.00% 51 135 0.00% 52 152 0.00% 53 209 0.00% 54 189 0.00% 55 211 0.00% 56 272 0.00% 57 300 0.00% 58 311 0.00% 59 350 0.00% 60 419 0.00% 61 483 0.00% 62 554 0.00% 63 639 0.00% 64 696 0.00% 65 863 0.00% 66 859 0.00% 67 1009 0.01% 68 1212 0.01% 69 2080 0.01% 70 1845 0.01% 71 1651 0.01% 72 1832 0.01% 73 2140 0.01% 74 2446 0.01% 75 2672 0.01% 76 2894 0.02% 77 3211 0.02% 78 3572 0.02% 79 3982 0.02% 80 4532 0.02% 81 5265 0.03% 82 5827 0.03% 83 6603 0.04% 84 7991 0.04% 85 9088 0.05% 86 9751 0.05% 87 10647 0.06% 88 11474 0.06% 89 11825 0.06% 90 12521 0.07% 91 13869 0.08% 92 14710 0.08% 93 16096 0.09% 94 17307 0.09% 95 18336 0.10% 96 19383 0.11% 97 20236 0.11% 98 21108 0.12% 99 21940 0.12% 100 23476 0.13% 101 24345 0.13% 102 26054 0.14% 103 27988 0.15% 104 29429 0.16% 105 31003 0.17% 106 32261 0.18% 107 33209 0.18% 108 34245 0.19% 109 35767 0.20% 110 36780 0.20% 111 37993 0.21% 112 39764 0.22% 113 41320 0.23% 114 43477 0.24% 115 45540 0.25% 116 46351 0.25% 117 47946 0.26% 118 48771 0.27% 119 49905 0.27% 120 51121 0.28% 121 53231 0.29% 122 54555 0.30% 123 57695 0.31% 124 59636 0.33% 125 62508 0.34% 126 64582 0.35% 127 67004 0.37% 128 68377 0.37% 129 69863 0.38% 130 72315 0.39% 131 75015 0.41% 132 78374 0.43% 133 82798 0.45% 134 86692 0.47% 135 91227 0.50% 136 96144 0.52% 137 101226 0.55% 138 107116 0.58% 139 113132 0.62% 140 120116 0.66% 141 130053 0.71% 142 142553 0.78% 143 159827 0.87% 144 184855 1.01% 145 218579 1.19% 146 272031 1.48% 147 358240 1.95% 148 532708 2.91% 149 1019049 5.56% 150 4489263 24.48% 151 8163040 44.52% 18335500 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=38 prefix-density=0.54 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=260.41 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=32 prefix-density=0.45 prefix-fanout=2.2 sequence=AATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=104.96 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.1 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGTACCTAAAACACCAAGAGGTTGCCCAA SRR7168830 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 03:36:37 Started mapping on | Feb 15 03:36:38 Finished on | Feb 15 03:38:46 Mapping speed, Million of reads per hour | 515.69 Number of input reads | 18335500 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17023026 Uniquely mapped reads % | 92.84% Average mapped length | 290.84 Number of splices: Total | 16072624 Number of splices: Annotated (sjdb) | 15700548 Number of splices: GT/AG | 15760287 Number of splices: GC/AG | 258817 Number of splices: AT/AC | 9030 Number of splices: Non-canonical | 44490 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505746 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 83302 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 828239 828239 828239 N_multimapping 505746 505746 505746 N_noFeature 568733 16727377 714750 N_ambiguous 267434 1465 116773 UnstrandedReadsAssigned:16186859 PositiveStrandReadsAssigned:294184 NegativeStrandReadsAssigned:16191503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168830 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168830-trimmed-pair1.fastq SRR7168830-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,335,500 reads, 16,231,341 reads pseudoaligned [quant] estimated average fragment length: 230.272 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7168830.ke.tsv 34699 SRR7168830.se.tsv 87100 total ==> SRR7168830.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.73 598 20.7482 Potri.005G024800.1.v4.1 1035 805.728 175 13.4795 Potri.004G059700.1.v4.1 961 731.75 23 1.95069 Potri.007G009000.2.v4.1 1416 1186.73 0 0 Potri.003G141000.2.v4.1 2943 2713.73 863.044 19.7374 Potri.016G087400.1.v4.1 270 87.5459 1035 733.715 Potri.015G069301.1.v4.1 564 338.966 0 0 Potri.010G195200.1.v4.1 1773 1543.73 18 0.723644 Potri.012G127500.1.v4.1 977 747.728 227 18.8411 ==> SRR7168830.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 513 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 228 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168830 completed mapping pipeline successfully