Starting /dee2/code/volunteer_pipeline.sh SRR7168831 current disk space = 3095129104384 free memory = 1580702936 SRR7168831 SRAfilesize 4ca9b140f73c71b76f31a716eaeeab12 SRR7168831.sra SRR7168831.sra file validated SRR7168831 is paired end SRR7168831 is conventional basespace SRR7168831 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17175 34.0 33.0 34.0 32.0 34.0 2 33.129 34.0 33.0 34.0 32.0 34.0 3 33.21725 34.0 33.0 34.0 32.0 34.0 4 33.255 34.0 33.0 34.0 32.0 34.0 5 33.3355 34.0 33.0 34.0 33.0 34.0 6 37.0885 38.0 38.0 38.0 36.0 38.0 7 37.24225 38.0 38.0 38.0 36.0 38.0 8 37.38925 38.0 38.0 38.0 37.0 38.0 9 37.428 38.0 38.0 38.0 37.0 38.0 10-14 37.44955 38.0 38.0 38.0 37.0 38.0 15-19 37.4443 38.0 38.0 38.0 37.0 38.0 20-24 37.42309999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.3666 38.0 38.0 38.0 37.0 38.0 30-34 37.3803 38.0 38.0 38.0 37.0 38.0 35-39 37.3642 38.0 38.0 38.0 37.0 38.0 40-44 37.350699999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.281850000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.252050000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.19585 38.0 38.0 38.0 37.0 38.0 60-64 37.15045 38.0 38.0 38.0 36.4 38.0 65-69 37.10615 38.0 38.0 38.0 36.0 38.0 70-74 37.10605 38.0 38.0 38.0 36.0 38.0 75-79 37.0064 38.0 38.0 38.0 36.0 38.0 80-84 36.9031 38.0 38.0 38.0 36.0 38.0 85-89 36.8222 38.0 38.0 38.0 35.6 38.0 90-94 36.73405 38.0 38.0 38.0 34.8 38.0 95-99 36.55645 38.0 38.0 38.0 34.0 38.0 100-104 36.5127 38.0 38.0 38.0 34.0 38.0 105-109 36.304649999999995 38.0 37.8 38.0 33.8 38.0 110-114 36.2452 38.0 37.8 38.0 34.0 38.0 115-119 36.00085 38.0 37.0 38.0 33.0 38.0 120-124 35.8661 38.0 37.0 38.0 32.0 38.0 125-129 35.507999999999996 38.0 36.4 38.0 30.2 38.0 130-134 35.1273 38.0 35.8 38.0 29.0 38.0 135-139 34.78405 38.0 34.8 38.0 28.0 38.0 140-144 34.079750000000004 38.0 33.6 38.0 24.6 38.0 145-149 33.108000000000004 38.0 33.0 38.0 17.6 38.0 150-151 27.86725 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 3.0 17 0.0 18 3.0 19 2.0 20 4.0 21 1.0 22 6.0 23 3.0 24 3.0 25 13.0 26 22.0 27 17.0 28 30.0 29 40.0 30 46.0 31 67.0 32 75.0 33 104.0 34 160.0 35 268.0 36 643.0 37 2484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.89085239085239 14.059251559251559 10.836798336798337 35.21309771309771 2 20.875 19.175 33.975 25.974999999999998 3 19.575 25.525 25.7 29.2 4 22.825 32.800000000000004 22.5 21.875 5 21.625 36.0 24.45 17.925 6 17.95 37.15 24.825 20.075000000000003 7 14.025000000000002 22.900000000000002 44.45 18.625 8 17.224999999999998 24.224999999999998 32.125 26.424999999999997 9 18.975 23.65 31.724999999999998 25.650000000000002 10-14 19.84 29.98 27.235 22.945 15-19 19.855 28.465 28.12 23.56 20-24 20.125 29.354999999999997 27.560000000000002 22.96 25-29 19.665 29.299999999999997 27.66 23.375 30-34 19.45 29.535 27.685 23.330000000000002 35-39 20.150000000000002 28.415000000000003 27.894999999999996 23.54 40-44 19.97 28.63 28.08 23.32 45-49 20.200000000000003 28.555000000000003 27.705000000000002 23.54 50-54 19.259999999999998 29.049999999999997 28.4 23.29 55-59 19.395 28.585 28.49 23.53 60-64 19.84 28.645 28.505000000000003 23.01 65-69 20.095 28.599999999999998 28.035 23.27 70-74 20.14 28.83 27.515 23.515 75-79 19.74 28.53 27.905 23.825 80-84 19.6 28.735 28.125 23.54 85-89 20.165 28.54 28.044999999999998 23.25 90-94 20.135 28.470000000000002 27.21 24.185000000000002 95-99 20.14 28.689999999999998 28.175 22.994999999999997 100-104 20.01 29.42 27.279999999999998 23.29 105-109 19.830000000000002 28.705000000000002 27.76 23.705000000000002 110-114 20.135 28.78 27.639999999999997 23.445 115-119 20.36 28.67 27.375 23.595 120-124 20.68 28.255000000000003 27.755000000000003 23.31 125-129 20.64 28.275 27.52 23.565 130-134 20.880000000000003 28.555000000000003 27.18 23.385 135-139 21.12 28.799999999999997 26.505000000000003 23.575 140-144 20.64 28.084999999999997 27.46 23.815 145-149 20.77 28.595 27.05 23.585 150-151 20.0125 29.7125 26.150000000000002 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 2.5 26 5.5 27 6.0 28 8.5 29 13.5 30 20.5 31 28.5 32 37.5 33 55.5 34 72.0 35 92.0 36 106.5 37 118.5 38 136.5 39 171.0 40 212.0 41 231.0 42 252.5 43 271.0 44 281.5 45 269.5 46 264.0 47 239.0 48 211.5 49 199.5 50 153.0 51 128.0 52 101.0 53 71.5 54 64.5 55 50.5 56 35.0 57 25.0 58 16.0 59 13.5 60 12.5 61 9.5 62 5.0 63 1.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.225 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.9749999999999996 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 5.05 0.0 0.0 0.0 0.0 124-125 5.675 0.0 0.0 0.0 0.0 126-127 6.1125 0.0 0.0 0.0 0.0 128-129 6.737500000000001 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.1375 0.0 0.0 0.0 0.0 136-137 8.587499999999999 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATTC 10 0.0068343505 144.975 5 ATCCAGA 10 0.0068343505 144.975 6 CGAAGAT 10 0.0068343505 144.975 145 CGTCTGA 45 0.008963385 48.325 145 >>END_MODULE SRR7168831 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74375 33.0 33.0 34.0 32.0 34.0 2 32.9145 33.0 33.0 34.0 32.0 34.0 3 32.892 34.0 33.0 34.0 32.0 34.0 4 32.8905 33.0 33.0 34.0 32.0 34.0 5 32.95325 33.0 33.0 34.0 32.0 34.0 6 37.10825 38.0 38.0 38.0 36.0 38.0 7 37.14575 38.0 38.0 38.0 37.0 38.0 8 37.1785 38.0 38.0 38.0 37.0 38.0 9 37.15725 38.0 38.0 38.0 37.0 38.0 10-14 37.1026 38.0 38.0 38.0 36.8 38.0 15-19 37.1202 38.0 38.0 38.0 37.0 38.0 20-24 37.10395 38.0 38.0 38.0 37.0 38.0 25-29 37.10635 38.0 38.0 38.0 37.0 38.0 30-34 37.101 38.0 38.0 38.0 37.0 38.0 35-39 37.0791 38.0 38.0 38.0 37.0 38.0 40-44 37.036 38.0 38.0 38.0 36.8 38.0 45-49 36.9944 38.0 38.0 38.0 36.2 38.0 50-54 36.974199999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.9646 38.0 38.0 38.0 36.0 38.0 60-64 36.951750000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.89055 38.0 38.0 38.0 36.0 38.0 70-74 36.79979999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.699749999999995 38.0 38.0 38.0 35.4 38.0 80-84 36.6298 38.0 38.0 38.0 35.2 38.0 85-89 36.4447 38.0 38.0 38.0 34.2 38.0 90-94 36.4809 38.0 38.0 38.0 34.4 38.0 95-99 36.4366 38.0 38.0 38.0 34.2 38.0 100-104 36.28635 38.0 38.0 38.0 34.0 38.0 105-109 36.20145 38.0 38.0 38.0 33.8 38.0 110-114 35.931850000000004 38.0 37.6 38.0 33.0 38.0 115-119 35.77035 38.0 37.0 38.0 32.0 38.0 120-124 35.5058 38.0 37.0 38.0 31.0 38.0 125-129 35.37595 38.0 36.6 38.0 30.4 38.0 130-134 34.81855 38.0 35.8 38.0 28.2 38.0 135-139 34.25885000000001 38.0 34.6 38.0 25.4 38.0 140-144 33.67465 38.0 33.4 38.0 22.0 38.0 145-149 32.297 38.0 33.0 38.0 10.6 38.0 150-151 27.13425 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 1.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 3.0 11 0.0 12 3.0 13 3.0 14 3.0 15 4.0 16 4.0 17 3.0 18 6.0 19 4.0 20 9.0 21 9.0 22 12.0 23 13.0 24 18.0 25 9.0 26 11.0 27 18.0 28 29.0 29 34.0 30 55.0 31 55.0 32 81.0 33 99.0 34 139.0 35 254.0 36 659.0 37 2449.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 18.4 15.75 26.75 2 26.650000000000002 26.0 32.0 15.35 3 21.5 28.875 30.599999999999998 19.025 4 24.775 35.199999999999996 21.975 18.05 5 23.875 36.925000000000004 21.8 17.4 6 20.255063765941486 38.45961490372593 24.056014003500874 17.22930732683171 7 20.525 18.95 40.35 20.175 8 22.25 24.325 28.499999999999996 24.925 9 21.475 26.1 29.4 23.025000000000002 10-14 23.549999999999997 28.384999999999998 27.21 20.855 15-19 23.141157057852894 27.611380569028455 28.521426071303562 20.72603630181509 20-24 22.318347752162822 28.084212631894783 28.71430714607191 20.883132469870482 25-29 22.819563912782556 28.695739147829563 28.225645129025807 20.259051810362074 30-34 22.882288228822883 28.822882288228826 28.247824782478247 20.047004700470048 35-39 23.201960588176455 28.193458037411222 27.563268980694204 21.041312393718115 40-44 23.63090772693173 27.886971742935735 28.06201550387597 20.420105026256564 45-49 22.72113605680284 28.086404320216012 28.281414070703537 20.911045552277614 50-54 22.54 28.325 28.77 20.365 55-59 22.914582916583317 28.020604120824167 28.705741148229645 20.35907181436287 60-64 23.385 28.17 28.065 20.380000000000003 65-69 23.482044613384016 27.548264479343803 28.518555566670003 20.451135340602182 70-74 23.138098334417045 28.219876956934925 28.14485069774421 20.497174010903816 75-79 23.219287715086033 27.936174469787918 28.056222488995598 20.78831532613045 80-84 22.766830049014704 28.183455036510953 28.47854356306892 20.57117135140542 85-89 23.861703192234565 27.88451916341439 28.234764335034523 20.01901330931652 90-94 23.298979387632578 28.201921152691618 28.587152291374824 19.91194716830098 95-99 23.8116681677174 28.234764335034523 28.204743320324226 19.748824176923847 100-104 23.36401841104663 28.48208925355213 28.126876125675405 20.027016209725833 105-109 23.52794036720196 28.19550752914103 27.945369953474408 20.3311821501826 110-114 24.185883647641436 29.02806262818268 27.18223200440198 19.603821719773897 115-119 24.212106053026513 27.603801900950476 28.099049524762382 20.08504252126063 120-124 24.303366851768473 28.370603832107662 27.450097553654512 19.87593176246936 125-129 24.25712856428214 28.204102051025515 27.71885942971486 19.81990995497749 130-134 24.610997148146296 27.327763045979886 27.93815980387252 20.123080002001302 135-139 24.532172520764536 28.45491844291004 27.579305513859705 19.433603522465724 140-144 25.13256628314157 28.534267133566782 27.32366183091546 19.009504752376188 145-149 25.0250150090054 28.367020212127276 27.28637182309386 19.321592955773465 150-151 26.125562781390695 27.501250625312657 27.151075537768882 19.222111055527762 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 0.5 25 2.5 26 4.5 27 5.5 28 7.5 29 10.0 30 16.0 31 27.5 32 39.5 33 43.5 34 47.5 35 74.0 36 105.0 37 128.5 38 139.0 39 162.0 40 199.5 41 218.0 42 255.0 43 295.5 44 311.5 45 295.5 46 267.5 47 240.5 48 215.0 49 181.0 50 143.0 51 130.5 52 111.5 53 87.0 54 62.5 55 40.0 56 31.0 57 25.5 58 22.0 59 18.0 60 11.0 61 6.0 62 5.0 63 3.0 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.015 25-29 0.02 30-34 0.01 35-39 0.03 40-44 0.025 45-49 0.005 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.03 70-74 0.034999999999999996 75-79 0.04 80-84 0.03 85-89 0.06999999999999999 90-94 0.06 95-99 0.06999999999999999 100-104 0.06 105-109 0.055 110-114 0.045 115-119 0.05 120-124 0.055 125-129 0.05 130-134 0.065 135-139 0.06999999999999999 140-144 0.05 145-149 0.06 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.575 0.0 0.0 0.0 0.0 122-123 5.1125 0.0 0.0 0.0 0.0 124-125 5.7625 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.824999999999999 0.0 0.0 0.0 0.0 130-131 7.262499999999999 0.0 0.0 0.0 0.0 132-133 7.7 0.0 0.0 0.0 0.0 134-135 8.212499999999999 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGG 10 0.006830828 145.0 145 >>END_MODULE Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra Read 880370 spots for SRR7168831.sra Written 880370 spots for SRR7168831.sra Read 880369 spots for SRR7168831.sra Written 880369 spots for SRR7168831.sra SRR ids: ['SRR7168831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xqmj0toc SRR7168831.sra spots: 17607381 blocks: [[1, 880369], [880370, 1760738], [1760739, 2641107], [2641108, 3521476], [3521477, 4401845], [4401846, 5282214], [5282215, 6162583], [6162584, 7042952], [7042953, 7923321], [7923322, 8803690], [8803691, 9684059], [9684060, 10564428], [10564429, 11444797], [11444798, 12325166], [12325167, 13205535], [13205536, 14085904], [14085905, 14966273], [14966274, 15846642], [15846643, 16727011], [16727012, 17607381]] SRR7168831 file size 5944863 SRR7168831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168831 SRR7168831_1.fastq SRR7168831_2.fastq Input file: SRR7168831_1.fastq Paired file: SRR7168831_2.fastq trimmed: SRR7168831-trimmed-pair1.fastq, SRR7168831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:59:49 2025 >> started Sat Feb 15 05:00:11 2025 >> done (21.798s) 17607381 read pairs processed; of these: 21984 ( 0.12%) short read pairs filtered out after trimming by size control 18179 ( 0.10%) empty read pairs filtered out after trimming by size control 17567218 (99.77%) read pairs available; of these: 9635782 (54.85%) trimmed read pairs available after processing 7931436 (45.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 6 0.00% 24 7 0.00% 25 2 0.00% 26 5 0.00% 27 9 0.00% 28 12 0.00% 29 8 0.00% 30 15 0.00% 31 12 0.00% 32 14 0.00% 33 20 0.00% 34 11 0.00% 35 26 0.00% 36 20 0.00% 37 17 0.00% 38 21 0.00% 39 32 0.00% 40 45 0.00% 41 42 0.00% 42 45 0.00% 43 60 0.00% 44 48 0.00% 45 54 0.00% 46 68 0.00% 47 74 0.00% 48 88 0.00% 49 116 0.00% 50 134 0.00% 51 142 0.00% 52 175 0.00% 53 159 0.00% 54 204 0.00% 55 223 0.00% 56 231 0.00% 57 293 0.00% 58 348 0.00% 59 373 0.00% 60 416 0.00% 61 512 0.00% 62 557 0.00% 63 694 0.00% 64 721 0.00% 65 841 0.00% 66 924 0.01% 67 1034 0.01% 68 1215 0.01% 69 1613 0.01% 70 1606 0.01% 71 1741 0.01% 72 1945 0.01% 73 2294 0.01% 74 2525 0.01% 75 2806 0.02% 76 3204 0.02% 77 3507 0.02% 78 3779 0.02% 79 4226 0.02% 80 4713 0.03% 81 5343 0.03% 82 5987 0.03% 83 6851 0.04% 84 7765 0.04% 85 8734 0.05% 86 9388 0.05% 87 10072 0.06% 88 10632 0.06% 89 11376 0.06% 90 12340 0.07% 91 13200 0.08% 92 14324 0.08% 93 15268 0.09% 94 16758 0.10% 95 17624 0.10% 96 18493 0.11% 97 19370 0.11% 98 19677 0.11% 99 21255 0.12% 100 22017 0.13% 101 23179 0.13% 102 24773 0.14% 103 26114 0.15% 104 27447 0.16% 105 28864 0.16% 106 29942 0.17% 107 30877 0.18% 108 31754 0.18% 109 32622 0.19% 110 33551 0.19% 111 35109 0.20% 112 36420 0.21% 113 37965 0.22% 114 39819 0.23% 115 41412 0.24% 116 42710 0.24% 117 43670 0.25% 118 44378 0.25% 119 45342 0.26% 120 47187 0.27% 121 48106 0.27% 122 50094 0.29% 123 52165 0.30% 124 54461 0.31% 125 56034 0.32% 126 58681 0.33% 127 60334 0.34% 128 61753 0.35% 129 64157 0.37% 130 66445 0.38% 131 68301 0.39% 132 72078 0.41% 133 74622 0.42% 134 78668 0.45% 135 82785 0.47% 136 87695 0.50% 137 91918 0.52% 138 97912 0.56% 139 103303 0.59% 140 111526 0.63% 141 121029 0.69% 142 133059 0.76% 143 148634 0.85% 144 172408 0.98% 145 205625 1.17% 146 256805 1.46% 147 338733 1.93% 148 503930 2.87% 149 973516 5.54% 150 4327352 24.63% 151 7931436 45.15% 17567218 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.0 sequence=TAGGTACGCAATATCG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=29.71 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.5 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=35.34 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7168831 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:01:13 Started mapping on | Feb 15 05:01:14 Finished on | Feb 15 05:03:15 Mapping speed, Million of reads per hour | 522.66 Number of input reads | 17567218 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16318252 Uniquely mapped reads % | 92.89% Average mapped length | 290.87 Number of splices: Total | 15432891 Number of splices: Annotated (sjdb) | 15070605 Number of splices: GT/AG | 15143580 Number of splices: GC/AG | 226198 Number of splices: AT/AC | 9163 Number of splices: Non-canonical | 53950 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 538837 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 84330 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724622 724622 724622 N_multimapping 538837 538837 538837 N_noFeature 633060 15980386 863770 N_ambiguous 232685 1649 124274 UnstrandedReadsAssigned:15452507 PositiveStrandReadsAssigned:336217 NegativeStrandReadsAssigned:15330208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168831-trimmed-pair1.fastq SRR7168831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,567,218 reads, 15,346,716 reads pseudoaligned [quant] estimated average fragment length: 232.699 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7168831.ke.tsv 34699 SRR7168831.se.tsv 87100 total ==> SRR7168831.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.3 1942 79.4201 Potri.005G024800.1.v4.1 1035 803.301 547 49.7445 Potri.004G059700.1.v4.1 961 729.361 15 1.5024 Potri.007G009000.2.v4.1 1416 1184.3 0 0 Potri.003G141000.2.v4.1 2943 2711.3 919 24.7613 Potri.016G087400.1.v4.1 270 86.7462 1202 1012.25 Potri.015G069301.1.v4.1 564 336.502 0 0 Potri.010G195200.1.v4.1 1773 1541.3 1448.87 68.6717 Potri.012G127500.1.v4.1 977 745.345 87 8.52702 ==> SRR7168831.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 536 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 253 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7168831 completed mapping pipeline successfully