Starting /dee2/code/volunteer_pipeline.sh SRR7168832 current disk space = 3095735382016 free memory = 1580032776 SRR7168832 SRAfilesize 99e96f43cda85033f2dda694daaf0162 SRR7168832.sra SRR7168832.sra file validated SRR7168832 is paired end SRR7168832 is conventional basespace SRR7168832 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.951 34.0 33.0 34.0 32.0 34.0 2 33.16025 34.0 33.0 34.0 32.0 34.0 3 33.29425 34.0 33.0 34.0 32.0 34.0 4 33.415 34.0 33.0 34.0 33.0 34.0 5 33.44575 34.0 34.0 34.0 33.0 34.0 6 37.16075 38.0 38.0 38.0 36.0 38.0 7 37.38575 38.0 38.0 38.0 37.0 38.0 8 37.444 38.0 38.0 38.0 37.0 38.0 9 37.4965 38.0 38.0 38.0 37.0 38.0 10-14 37.5398 38.0 38.0 38.0 38.0 38.0 15-19 37.52015 38.0 38.0 38.0 38.0 38.0 20-24 37.48565000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.4199 38.0 38.0 38.0 37.0 38.0 30-34 37.454299999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.473 38.0 38.0 38.0 37.2 38.0 40-44 37.4409 38.0 38.0 38.0 37.0 38.0 45-49 37.42595 38.0 38.0 38.0 37.0 38.0 50-54 37.43455 38.0 38.0 38.0 37.0 38.0 55-59 37.36005 38.0 38.0 38.0 37.0 38.0 60-64 37.2913 38.0 38.0 38.0 37.0 38.0 65-69 37.240300000000005 38.0 38.0 38.0 36.8 38.0 70-74 37.210249999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.10165 38.0 38.0 38.0 36.0 38.0 80-84 37.01565 38.0 38.0 38.0 36.0 38.0 85-89 37.0198 38.0 38.0 38.0 36.0 38.0 90-94 36.8745 38.0 38.0 38.0 35.6 38.0 95-99 36.7932 38.0 38.0 38.0 35.2 38.0 100-104 36.703050000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.68515 38.0 38.0 38.0 35.0 38.0 110-114 36.4752 38.0 38.0 38.0 34.0 38.0 115-119 36.4002 38.0 38.0 38.0 34.0 38.0 120-124 36.1502 38.0 37.6 38.0 33.6 38.0 125-129 35.88955 38.0 37.0 38.0 32.6 38.0 130-134 35.558949999999996 38.0 36.0 38.0 31.2 38.0 135-139 35.2906 38.0 36.0 38.0 31.0 38.0 140-144 34.83575 38.0 35.8 38.0 28.2 38.0 145-149 33.96885 38.0 33.8 38.0 24.4 38.0 150-151 29.412 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 3.0 21 5.0 22 4.0 23 7.0 24 6.0 25 13.0 26 11.0 27 25.0 28 29.0 29 26.0 30 35.0 31 40.0 32 52.0 33 82.0 34 124.0 35 191.0 36 626.0 37 2712.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.144132318193755 13.783145182462588 10.05513258072985 37.01758991861381 2 22.0 18.275 34.949999999999996 24.775 3 21.625 24.175 23.95 30.25 4 23.05 31.4 22.275 23.275000000000002 5 21.880470117529384 36.48412103025757 23.380845211302827 18.254563640910227 6 18.7 35.625 25.6 20.075000000000003 7 14.025000000000002 24.625 43.625 17.724999999999998 8 18.275 26.0 29.625 26.1 9 18.65 25.324999999999996 30.625000000000004 25.4 10-14 20.46 29.505 26.295 23.74 15-19 20.064999999999998 28.945 27.735 23.255 20-24 20.635 28.79 27.61 22.965 25-29 19.875 28.804999999999996 27.775 23.544999999999998 30-34 20.43 28.965000000000003 27.055 23.549999999999997 35-39 19.71 28.88 27.46 23.95 40-44 20.005 29.74 27.089999999999996 23.165 45-49 20.54 28.610000000000003 27.52 23.330000000000002 50-54 20.599999999999998 28.299999999999997 27.66 23.44 55-59 20.385 28.42 27.415 23.78 60-64 20.43 28.09 27.950000000000003 23.53 65-69 19.765 28.565 27.99 23.68 70-74 20.225 28.355000000000004 27.77 23.65 75-79 20.29 28.799999999999997 27.46 23.45 80-84 20.330000000000002 28.01 27.915 23.745 85-89 20.560000000000002 28.535 27.32 23.585 90-94 20.674999999999997 28.435 26.77 24.12 95-99 20.84 28.955 27.389999999999997 22.814999999999998 100-104 20.82 28.549999999999997 26.865 23.765 105-109 20.575 28.88 27.04 23.505000000000003 110-114 21.185000000000002 29.110000000000003 26.055 23.65 115-119 21.22 28.225 26.229999999999997 24.325 120-124 21.495 28.65 25.91 23.945 125-129 21.205 28.93 25.765 24.099999999999998 130-134 20.84 28.605000000000004 25.685000000000002 24.87 135-139 21.825 28.060000000000002 25.7 24.415 140-144 21.905 27.97 25.395 24.73 145-149 21.255 27.61 26.045 25.09 150-151 21.828428303068254 28.177833437695682 25.42266750156543 24.571070757670633 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 3.5 26 3.5 27 5.0 28 7.5 29 14.0 30 23.5 31 27.5 32 30.5 33 32.0 34 51.5 35 85.5 36 96.5 37 114.0 38 136.0 39 168.5 40 202.5 41 224.0 42 257.5 43 254.5 44 258.5 45 267.0 46 244.5 47 227.5 48 213.5 49 195.0 50 185.0 51 158.5 52 109.0 53 80.0 54 68.5 55 62.5 56 46.5 57 35.0 58 29.0 59 19.0 60 16.0 61 10.0 62 3.5 63 4.5 64 5.5 65 3.5 66 3.0 67 2.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.775 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCCTGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 18 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.0625 0.0 0.0 0.025 0.0 66-67 0.125 0.0 0.0 0.025 0.0 68-69 0.1375 0.0 0.0 0.025 0.0 70-71 0.16249999999999998 0.0 0.0 0.025 0.0 72-73 0.1875 0.0 0.0 0.025 0.0 74-75 0.2875 0.0 0.0 0.025 0.0 76-77 0.4125 0.0 0.0 0.025 0.0 78-79 0.525 0.0 0.0 0.025 0.0 80-81 0.6375 0.0 0.0 0.025 0.0 82-83 0.775 0.0 0.0 0.025 0.0 84-85 0.9125 0.0 0.0 0.025 0.0 86-87 1.1875 0.0 0.0 0.025 0.0 88-89 1.5125 0.0 0.0 0.025 0.0 90-91 1.875 0.0 0.0 0.025 0.0 92-93 2.1375 0.0 0.0 0.025 0.0 94-95 2.6125 0.0 0.0 0.025 0.0 96-97 2.9875 0.0 0.0 0.025 0.0 98-99 3.4375 0.0 0.0 0.025 0.0 100-101 4.1125 0.0 0.0 0.025 0.0 102-103 4.699999999999999 0.0 0.0 0.025 0.0 104-105 5.3125 0.0 0.0 0.025 0.0 106-107 6.15 0.0 0.0 0.025 0.0 108-109 6.7125 0.0 0.0 0.025 0.0 110-111 7.35 0.0 0.0 0.025 0.0 112-113 8.1125 0.0 0.0 0.025 0.0 114-115 8.7875 0.0 0.0 0.025 0.0 116-117 9.7875 0.0 0.0 0.025 0.0 118-119 10.95 0.0 0.0 0.025 0.0 120-121 11.8875 0.0 0.0 0.025 0.0 122-123 12.625 0.0 0.0 0.025 0.0 124-125 13.524999999999999 0.0 0.0 0.025 0.0 126-127 14.3625 0.0 0.0 0.025 0.0 128-129 15.3375 0.0 0.0 0.025 0.0 130-131 16.487499999999997 0.0 0.0 0.025 0.0 132-133 17.6 0.0 0.0 0.025 0.0 134-135 18.5125 0.0 0.0 0.025 0.0 136-137 19.475 0.0 0.0 0.025 0.0 138-139 20.424999999999997 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCGG 10 0.0068378756 144.95 3 GGTTTCG 10 0.0068378756 144.95 2 TTTTTTT 20 0.005945122 28.99 100-104 AGAGCAC 105 0.0068516694 27.609522 145 ATCGGAA 115 1.9744618E-4 11.343913 135-139 AAGAGCA 130 6.141223E-4 10.035 140-144 >>END_MODULE SRR7168832 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8325 33.0 33.0 34.0 32.0 34.0 2 32.96375 34.0 33.0 34.0 32.0 34.0 3 32.9745 34.0 33.0 34.0 32.0 34.0 4 32.987 34.0 33.0 34.0 32.0 34.0 5 33.01475 34.0 33.0 34.0 32.0 34.0 6 37.2115 38.0 38.0 38.0 37.0 38.0 7 37.222 38.0 38.0 38.0 37.0 38.0 8 37.171 38.0 38.0 38.0 37.0 38.0 9 37.1075 38.0 38.0 38.0 37.0 38.0 10-14 37.18145 38.0 38.0 38.0 37.0 38.0 15-19 37.17475 38.0 38.0 38.0 37.0 38.0 20-24 37.1047 38.0 38.0 38.0 37.0 38.0 25-29 37.0567 38.0 38.0 38.0 37.0 38.0 30-34 37.0774 38.0 38.0 38.0 37.0 38.0 35-39 37.086349999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.0569 38.0 38.0 38.0 36.8 38.0 45-49 36.95685 38.0 38.0 38.0 36.0 38.0 50-54 36.874199999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.77095 38.0 38.0 38.0 35.6 38.0 60-64 36.6974 38.0 38.0 38.0 35.2 38.0 65-69 36.62595 38.0 38.0 38.0 34.8 38.0 70-74 36.54215000000001 38.0 38.0 38.0 34.6 38.0 75-79 36.45415 38.0 38.0 38.0 34.2 38.0 80-84 36.1923 38.0 38.0 38.0 33.4 38.0 85-89 35.95455 38.0 37.8 38.0 32.2 38.0 90-94 35.78175 38.0 37.0 38.0 31.6 38.0 95-99 35.66865 38.0 37.0 38.0 31.0 38.0 100-104 35.34695000000001 38.0 36.8 38.0 29.2 38.0 105-109 35.3061 38.0 36.8 38.0 28.8 38.0 110-114 34.876599999999996 38.0 36.0 38.0 27.4 38.0 115-119 34.41045 38.0 35.0 38.0 24.8 38.0 120-124 33.83595 38.0 34.2 38.0 22.2 38.0 125-129 33.35925 38.0 34.0 38.0 16.2 38.0 130-134 32.515750000000004 38.0 33.2 38.0 14.2 38.0 135-139 31.451150000000002 37.2 31.0 38.0 13.0 38.0 140-144 30.142500000000002 36.0 29.4 38.0 6.4 38.0 145-149 28.13725 35.8 20.6 38.0 2.0 38.0 150-151 22.514625000000002 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 2.0 11 2.0 12 1.0 13 1.0 14 5.0 15 2.0 16 8.0 17 11.0 18 7.0 19 12.0 20 20.0 21 17.0 22 18.0 23 25.0 24 29.0 25 28.0 26 30.0 27 33.0 28 51.0 29 47.0 30 64.0 31 93.0 32 100.0 33 156.0 34 264.0 35 378.0 36 880.0 37 1704.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.46446446446446 19.36936936936937 14.93993993993994 26.226226226226224 2 27.87787787787788 25.725725725725724 30.28028028028028 16.116116116116117 3 22.62262262262262 28.928928928928926 28.678678678678676 19.76976976976977 4 25.825825825825827 33.933933933933936 22.3973973973974 17.842842842842842 5 24.84984984984985 34.85985985985986 22.02202202202202 18.26826826826827 6 20.095095095095093 37.76276276276276 24.374374374374376 17.76776776776777 7 18.693693693693696 19.994994994994993 40.41541541541542 20.895895895895897 8 23.023023023023022 25.025025025025027 26.326326326326328 25.625625625625624 9 21.996996996996998 24.8998998998999 30.455455455455454 22.64764764764765 10-14 23.0980980980981 28.253253253253252 26.92192192192192 21.726726726726728 15-19 22.822822822822822 28.113113113113116 28.60860860860861 20.455455455455454 20-24 22.992992992992995 27.717717717717715 28.24824824824825 21.04104104104104 25-29 22.87787787787788 28.543543543543542 27.792792792792792 20.785785785785784 30-34 22.68768768768769 28.583583583583582 27.53753753753754 21.19119119119119 35-39 23.0980980980981 27.94794794794795 28.048048048048045 20.905905905905904 40-44 22.722722722722725 27.94794794794795 28.513513513513512 20.815815815815817 45-49 22.67767767767768 28.173173173173172 27.66266266266266 21.486486486486488 50-54 22.91791791791792 27.66266266266266 28.263263263263262 21.156156156156154 55-59 22.91791791791792 27.42242242242242 28.91891891891892 20.74074074074074 60-64 23.143143143143146 28.058058058058062 28.343343343343342 20.455455455455454 65-69 23.31831831831832 27.71271271271271 28.02802802802803 20.94094094094094 70-74 23.003003003003002 27.627627627627625 28.348348348348345 21.02102102102102 75-79 23.723723723723726 28.103103103103106 27.782782782782782 20.39039039039039 80-84 23.239401371440014 28.354772511136694 27.774162871014564 20.63166324640873 85-89 23.930126632964612 27.248611041593673 28.07948345763051 20.741778867811203 90-94 24.27927927927928 27.772772772772775 27.197197197197198 20.75075075075075 95-99 24.374374374374376 28.053053053053052 27.072072072072075 20.5005005005005 100-104 24.76976976976977 28.083083083083082 27.03203203203203 20.115115115115113 105-109 24.124124124124123 28.10810810810811 27.72772772772773 20.04004004004004 110-114 24.724724724724727 28.193193193193196 26.811811811811815 20.27027027027027 115-119 25.845845845845844 28.088088088088085 26.29129129129129 19.774774774774777 120-124 25.940940940940944 28.553553553553552 26.246246246246248 19.25925925925926 125-129 26.026026026026027 28.003003003003002 26.391391391391387 19.57957957957958 130-134 26.62162162162162 27.837837837837835 26.441441441441444 19.0990990990991 135-139 26.72172172172172 27.562562562562565 26.526526526526528 19.18918918918919 140-144 26.856856856856858 28.493493493493492 25.955955955955957 18.693693693693696 145-149 26.826826826826828 28.11811811811812 26.306306306306304 18.74874874874875 150-151 26.82011508631474 29.15936952714536 25.73179884913685 18.28871653740305 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 4.0 27 6.0 28 8.0 29 7.5 30 12.0 31 30.0 32 38.0 33 43.0 34 52.5 35 65.5 36 91.5 37 119.5 38 137.5 39 163.5 40 191.0 41 221.0 42 252.0 43 260.0 44 271.5 45 259.5 46 255.5 47 244.5 48 212.0 49 201.0 50 181.5 51 136.0 52 97.5 53 81.5 54 78.5 55 71.5 56 48.0 57 34.0 58 31.0 59 27.5 60 16.5 61 11.0 62 8.0 63 6.0 64 5.5 65 3.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.1 80-84 0.105 85-89 0.105 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.1 145-149 0.1 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52153110047847 98.8 2 0.32737345756736336 0.65 3 0.1007302946361118 0.3 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.2 0.0 0.0 0.0 0.0 88-89 1.525 0.0 0.0 0.0 0.0 90-91 1.9 0.0 0.0 0.0 0.0 92-93 2.125 0.0 0.0 0.0 0.0 94-95 2.6 0.0 0.0 0.0 0.0 96-97 2.9875 0.0 0.0 0.0 0.0 98-99 3.4000000000000004 0.0 0.0 0.0 0.0 100-101 4.0125 0.0 0.0 0.0 0.0 102-103 4.575 0.0 0.0 0.0 0.0 104-105 5.1625 0.0 0.0 0.0 0.0 106-107 5.949999999999999 0.0 0.0 0.0 0.0 108-109 6.45 0.0 0.0 0.0 0.0 110-111 7.0625 0.0 0.0 0.0 0.0 112-113 7.8375 0.0 0.0 0.0 0.0 114-115 8.524999999999999 0.0 0.0 0.0 0.0 116-117 9.4875 0.0 0.0 0.0 0.0 118-119 10.575 0.0 0.0 0.0 0.0 120-121 11.4875 0.0 0.0 0.0 0.0 122-123 12.2375 0.0 0.0 0.0 0.0 124-125 13.05 0.0 0.0 0.0 0.0 126-127 13.8625 0.0 0.0 0.0 0.0 128-129 14.774999999999999 0.0 0.0 0.0 0.0 130-131 15.899999999999999 0.0 0.0 0.0 0.0 132-133 17.0375 0.0 0.0 0.0 0.0 134-135 17.9375 0.0 0.0 0.0 0.0 136-137 18.8375 0.0 0.0 0.0 0.0 138-139 19.762500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTTC 10 0.006830828 145.0 5 AGAGCGT 110 0.008585102 26.363638 145 AAGAGCG 115 1.9681378E-4 11.347827 140-144 ATCGGAA 115 1.9681378E-4 11.347827 135-139 GAGCGTC 90 0.0048656333 11.277777 140-144 >>END_MODULE Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra Read 830852 spots for SRR7168832.sra Written 830852 spots for SRR7168832.sra SRR ids: ['SRR7168832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_535bekgf SRR7168832.sra spots: 16617040 blocks: [[1, 830852], [830853, 1661704], [1661705, 2492556], [2492557, 3323408], [3323409, 4154260], [4154261, 4985112], [4985113, 5815964], [5815965, 6646816], [6646817, 7477668], [7477669, 8308520], [8308521, 9139372], [9139373, 9970224], [9970225, 10801076], [10801077, 11631928], [11631929, 12462780], [12462781, 13293632], [13293633, 14124484], [14124485, 14955336], [14955337, 15786188], [15786189, 16617040]] SRR7168832 file size 5609269 SRR7168832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168832 SRR7168832_1.fastq SRR7168832_2.fastq Input file: SRR7168832_1.fastq Paired file: SRR7168832_2.fastq trimmed: SRR7168832-trimmed-pair1.fastq, SRR7168832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:50:31 2025 >> started Sat Feb 15 04:50:48 2025 >> done (17.191s) 16617040 read pairs processed; of these: 18159 ( 0.11%) short read pairs filtered out after trimming by size control 43938 ( 0.26%) empty read pairs filtered out after trimming by size control 16554943 (99.63%) read pairs available; of these: 10528117 (63.60%) trimmed read pairs available after processing 6026826 (36.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 7 0.00% 22 5 0.00% 23 5 0.00% 24 9 0.00% 25 5 0.00% 26 8 0.00% 27 8 0.00% 28 15 0.00% 29 8 0.00% 30 18 0.00% 31 10 0.00% 32 13 0.00% 33 18 0.00% 34 18 0.00% 35 19 0.00% 36 26 0.00% 37 33 0.00% 38 41 0.00% 39 45 0.00% 40 42 0.00% 41 68 0.00% 42 63 0.00% 43 86 0.00% 44 79 0.00% 45 119 0.00% 46 124 0.00% 47 140 0.00% 48 171 0.00% 49 212 0.00% 50 263 0.00% 51 269 0.00% 52 335 0.00% 53 373 0.00% 54 408 0.00% 55 512 0.00% 56 513 0.00% 57 628 0.00% 58 756 0.00% 59 811 0.00% 60 1022 0.01% 61 1088 0.01% 62 1267 0.01% 63 1512 0.01% 64 1755 0.01% 65 1827 0.01% 66 2123 0.01% 67 2557 0.02% 68 2851 0.02% 69 4365 0.03% 70 4413 0.03% 71 4267 0.03% 72 4708 0.03% 73 5387 0.03% 74 5978 0.04% 75 6683 0.04% 76 7288 0.04% 77 8160 0.05% 78 8990 0.05% 79 10286 0.06% 80 11426 0.07% 81 12953 0.08% 82 14685 0.09% 83 16440 0.10% 84 18747 0.11% 85 20495 0.12% 86 21653 0.13% 87 23215 0.14% 88 24881 0.15% 89 26884 0.16% 90 28605 0.17% 91 31339 0.19% 92 33666 0.20% 93 36564 0.22% 94 39173 0.24% 95 41722 0.25% 96 43266 0.26% 97 45155 0.27% 98 46414 0.28% 99 47841 0.29% 100 50677 0.31% 101 52579 0.32% 102 55428 0.33% 103 58013 0.35% 104 60705 0.37% 105 62361 0.38% 106 64894 0.39% 107 65616 0.40% 108 66695 0.40% 109 68312 0.41% 110 69319 0.42% 111 71643 0.43% 112 74526 0.45% 113 76014 0.46% 114 77347 0.47% 115 81047 0.49% 116 82095 0.50% 117 82738 0.50% 118 83269 0.50% 119 83789 0.51% 120 85697 0.52% 121 86707 0.52% 122 88677 0.54% 123 90487 0.55% 124 93867 0.57% 125 94543 0.57% 126 97315 0.59% 127 98345 0.59% 128 99441 0.60% 129 101157 0.61% 130 102613 0.62% 131 103667 0.63% 132 105749 0.64% 133 109066 0.66% 134 112001 0.68% 135 117354 0.71% 136 120230 0.73% 137 124661 0.75% 138 128468 0.78% 139 133511 0.81% 140 139309 0.84% 141 146703 0.89% 142 158171 0.96% 143 171694 1.04% 144 191109 1.15% 145 218454 1.32% 146 260462 1.57% 147 331006 2.00% 148 467451 2.82% 149 842617 5.09% 150 3442568 20.79% 151 6026826 36.40% 16554943 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.36 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=34.83 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.50 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=59.95 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.5 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAACAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7168832 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:51:35 Started mapping on | Feb 15 04:51:36 Finished on | Feb 15 04:53:14 Mapping speed, Million of reads per hour | 608.14 Number of input reads | 16554943 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 15396460 Uniquely mapped reads % | 93.00% Average mapped length | 282.18 Number of splices: Total | 13972732 Number of splices: Annotated (sjdb) | 13641004 Number of splices: GT/AG | 13704211 Number of splices: GC/AG | 216052 Number of splices: AT/AC | 8917 Number of splices: Non-canonical | 43552 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429136 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 220924 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742303 742303 742303 N_multimapping 429136 429136 429136 N_noFeature 711382 14963441 1012781 N_ambiguous 227224 2161 93863 UnstrandedReadsAssigned:14457854 PositiveStrandReadsAssigned:430858 NegativeStrandReadsAssigned:14289816 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=135 echo kmer=131 SRR7168832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168832-trimmed-pair1.fastq SRR7168832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,554,943 reads, 14,414,210 reads pseudoaligned [quant] estimated average fragment length: 204.721 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7168832.ke.tsv 34699 SRR7168832.se.tsv 87100 total ==> SRR7168832.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.28 635 25.3617 Potri.005G024800.1.v4.1 1035 831.279 271 23.6228 Potri.004G059700.1.v4.1 961 757.318 9 0.861137 Potri.007G009000.2.v4.1 1416 1212.28 0 0 Potri.003G141000.2.v4.1 2943 2739.28 1170.95 30.975 Potri.016G087400.1.v4.1 270 105.716 856 586.732 Potri.015G069301.1.v4.1 564 364.556 0 0 Potri.010G195200.1.v4.1 1773 1569.28 135 6.23364 Potri.012G127500.1.v4.1 977 773.303 89 8.33965 ==> SRR7168832.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 653 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR7168832 completed mapping pipeline successfully