Starting /dee2/code/volunteer_pipeline.sh SRR7168833 current disk space = 3093048242176 free memory = 1578393004 SRR7168833 SRAfilesize 64515d7a9e617eb9a76fe7b386f33a38 SRR7168833.sra SRR7168833.sra file validated SRR7168833 is paired end SRR7168833 is conventional basespace SRR7168833 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1045 34.0 33.0 34.0 32.0 34.0 2 33.1635 34.0 33.0 34.0 32.0 34.0 3 33.13575 34.0 33.0 34.0 31.0 34.0 4 33.29275 34.0 33.0 34.0 33.0 34.0 5 33.38275 34.0 33.0 34.0 33.0 34.0 6 37.06125 38.0 37.0 38.0 36.0 38.0 7 37.337 38.0 38.0 38.0 37.0 38.0 8 37.425 38.0 38.0 38.0 37.0 38.0 9 37.491 38.0 38.0 38.0 37.0 38.0 10-14 37.47865 38.0 38.0 38.0 37.0 38.0 15-19 37.489149999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.4073 38.0 38.0 38.0 37.0 38.0 25-29 37.3198 38.0 38.0 38.0 37.0 38.0 30-34 37.41265 38.0 38.0 38.0 37.0 38.0 35-39 37.36165 38.0 38.0 38.0 37.0 38.0 40-44 37.299549999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.287600000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2051 38.0 38.0 38.0 36.4 38.0 55-59 37.13995 38.0 38.0 38.0 36.2 38.0 60-64 37.0877 38.0 38.0 38.0 36.0 38.0 65-69 37.029849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.92795 38.0 38.0 38.0 35.8 38.0 75-79 36.772149999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.65685 38.0 38.0 38.0 34.6 38.0 85-89 36.632850000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.5008 38.0 38.0 38.0 34.2 38.0 95-99 36.336650000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.30055 38.0 37.8 38.0 33.8 38.0 105-109 36.09115 38.0 37.2 38.0 33.2 38.0 110-114 35.90795 38.0 37.0 38.0 32.6 38.0 115-119 35.6964 38.0 36.8 38.0 31.4 38.0 120-124 35.30095 38.0 36.0 38.0 28.8 38.0 125-129 35.20195 38.0 36.0 38.0 29.0 38.0 130-134 34.80675 38.0 35.0 38.0 27.8 38.0 135-139 34.38135 38.0 34.8 38.0 25.4 38.0 140-144 33.57965 38.0 33.6 38.0 21.4 38.0 145-149 32.607749999999996 38.0 33.0 38.0 15.2 38.0 150-151 28.00225 34.5 17.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 8.0 20 5.0 21 7.0 22 5.0 23 6.0 24 7.0 25 11.0 26 26.0 27 26.0 28 22.0 29 42.0 30 55.0 31 61.0 32 75.0 33 114.0 34 167.0 35 304.0 36 779.0 37 2270.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.11528429838289 13.354199269692227 10.928534167970788 38.60198226395409 2 21.4 17.95 35.6 25.05 3 19.375 23.65 26.450000000000003 30.525000000000002 4 22.95 31.474999999999998 22.05 23.525 5 21.496496496496498 34.48448448448448 23.473473473473476 20.545545545545547 6 17.7 37.175000000000004 24.825 20.3 7 13.425 25.174999999999997 43.4 18.0 8 16.35 25.874999999999996 30.65 27.125 9 17.474999999999998 24.325 34.35 23.849999999999998 10-14 19.78 29.099999999999998 26.93 24.19 15-19 19.470000000000002 28.754999999999995 27.87 23.905 20-24 20.19 28.825 27.51 23.474999999999998 25-29 19.59 29.21 27.805000000000003 23.395 30-34 19.145 28.884999999999998 28.025 23.945 35-39 20.044999999999998 28.665000000000003 27.625 23.665 40-44 19.35 29.125 27.950000000000003 23.575 45-49 19.915 28.415000000000003 28.03 23.64 50-54 20.23 27.889999999999997 28.549999999999997 23.330000000000002 55-59 20.085 28.53 28.18 23.205000000000002 60-64 20.355 28.999999999999996 27.08 23.565 65-69 19.439999999999998 28.625 27.92 24.015 70-74 19.919999999999998 29.205 27.405 23.47 75-79 20.345 28.449999999999996 27.495000000000005 23.71 80-84 19.78 28.970000000000002 27.87 23.380000000000003 85-89 20.01 28.845 27.24 23.905 90-94 20.72 27.855 28.105000000000004 23.32 95-99 20.415 28.595 26.939999999999998 24.05 100-104 20.39 28.595 27.465 23.549999999999997 105-109 20.419999999999998 28.73 27.445000000000004 23.405 110-114 20.23 27.779999999999998 28.144999999999996 23.845 115-119 20.880000000000003 28.465 27.1 23.555 120-124 21.065 28.715000000000003 26.395000000000003 23.825 125-129 21.04 28.499999999999996 27.0 23.46 130-134 20.560000000000002 28.884999999999998 26.474999999999998 24.08 135-139 20.905 28.625 26.905 23.565 140-144 20.880000000000003 28.410000000000004 27.075 23.635 145-149 20.805 28.83 26.745 23.62 150-151 21.05659430292383 30.04141046555402 25.850169406449997 23.051825825072157 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 2.0 25 3.5 26 4.0 27 6.0 28 11.0 29 13.0 30 24.5 31 30.5 32 32.0 33 54.0 34 72.5 35 77.5 36 93.0 37 117.5 38 139.5 39 168.0 40 202.5 41 229.5 42 243.5 43 255.5 44 260.0 45 253.0 46 241.0 47 254.0 48 245.0 49 195.0 50 161.5 51 139.5 52 101.0 53 74.0 54 69.5 55 55.5 56 46.0 57 41.5 58 25.0 59 19.0 60 19.0 61 8.5 62 3.5 63 1.5 64 1.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.3770739064856712 0.75 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACGGAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1625 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.7625 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 3.0250000000000004 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.5875 0.0 0.0 0.0 0.0 116-117 3.9 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.612500000000001 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.425 0.0 0.0 0.0 0.0 126-127 5.775 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.7625 0.0 0.0 0.0 0.0 132-133 7.199999999999999 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.375 0.0 0.0 0.0 0.0 138-139 9.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168833 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1475 33.0 33.0 34.0 31.0 34.0 2 32.301 33.0 33.0 34.0 31.0 34.0 3 32.3385 33.0 33.0 34.0 31.0 34.0 4 32.2485 33.0 33.0 34.0 31.0 34.0 5 32.2805 33.0 33.0 34.0 31.0 34.0 6 36.31475 38.0 38.0 38.0 34.0 38.0 7 36.48525 38.0 38.0 38.0 34.0 38.0 8 36.34775 38.0 38.0 38.0 34.0 38.0 9 36.352 38.0 38.0 38.0 34.0 38.0 10-14 36.28445 38.0 38.0 38.0 33.6 38.0 15-19 36.2395 38.0 38.0 38.0 33.2 38.0 20-24 36.18085 38.0 38.0 38.0 33.0 38.0 25-29 36.1907 38.0 38.0 38.0 33.2 38.0 30-34 36.04185 38.0 38.0 38.0 33.0 38.0 35-39 36.00635 38.0 38.0 38.0 32.6 38.0 40-44 36.0399 38.0 37.8 38.0 32.6 38.0 45-49 35.89475 38.0 37.2 38.0 31.4 38.0 50-54 35.7383 38.0 37.0 38.0 29.8 38.0 55-59 35.53445 38.0 37.0 38.0 29.0 38.0 60-64 35.520999999999994 38.0 37.0 38.0 29.0 38.0 65-69 35.50675 38.0 37.0 38.0 29.0 38.0 70-74 35.4151 38.0 37.0 38.0 29.0 38.0 75-79 35.18205 38.0 36.4 38.0 28.2 38.0 80-84 34.888549999999995 38.0 36.0 38.0 27.2 38.0 85-89 34.64755 38.0 36.0 38.0 26.2 38.0 90-94 34.322950000000006 38.0 35.4 38.0 24.2 38.0 95-99 34.08705 38.0 35.0 38.0 23.2 38.0 100-104 33.9836 38.0 34.8 38.0 23.0 38.0 105-109 33.66985 38.0 34.2 38.0 16.6 38.0 110-114 33.31335 38.0 34.0 38.0 15.0 38.0 115-119 32.98105 38.0 33.8 38.0 15.0 38.0 120-124 32.45115 37.8 32.8 38.0 15.0 38.0 125-129 31.73735 37.2 31.0 38.0 14.4 38.0 130-134 31.14455 36.8 30.4 38.0 13.6 38.0 135-139 30.16375 36.0 27.4 38.0 10.8 38.0 140-144 28.99975 34.4 24.4 38.0 2.0 38.0 145-149 27.463299999999997 33.4 18.2 38.0 2.0 38.0 150-151 22.771875 29.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 1.0 5 2.0 6 5.0 7 3.0 8 3.0 9 5.0 10 6.0 11 3.0 12 11.0 13 14.0 14 11.0 15 11.0 16 16.0 17 20.0 18 22.0 19 26.0 20 24.0 21 29.0 22 30.0 23 24.0 24 36.0 25 41.0 26 42.0 27 57.0 28 56.0 29 84.0 30 89.0 31 107.0 32 145.0 33 175.0 34 267.0 35 447.0 36 878.0 37 1298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.493246623311656 19.18459229614807 15.35767883941971 28.96448224112056 2 24.780976220275345 26.608260325406757 32.76595744680851 15.844806007509387 3 21.907861792689033 28.01702553830746 30.42063094641963 19.654481722583874 4 23.935903855783675 35.30295443164747 23.13470205307962 17.626439659489236 5 24.2864296444667 36.12919379068603 22.30846269404106 17.27591387080621 6 20.200250312891114 38.1476846057572 23.60450563204005 18.04755944931164 7 19.379068602904358 19.729594391587383 40.26039058587882 20.630946419629446 8 21.85778668002003 25.38808212318478 27.240861291937907 25.51326990485729 9 21.401752190237797 24.63078848560701 29.662077596996244 24.30538172715895 10-14 22.902062888043258 29.010614860805127 26.89264970959343 21.194672541558184 15-19 23.061132528914033 27.882641566114252 28.18805387272818 20.86817203224353 20-24 22.754131196795193 27.756634952428644 28.24236354531798 21.246870305458188 25-29 22.929394091136704 27.956935403104655 27.96695042563846 21.14672008012018 30-34 23.244867300951427 27.856785177766653 27.94191286930396 20.95643465197797 35-39 22.99949924887331 28.197295943915872 28.39759639459189 20.40560841261893 40-44 23.10465698547822 27.88683024536805 28.13219829744617 20.87631447170756 45-49 22.984476715072606 28.15222834251377 28.427641462193293 20.43565348022033 50-54 22.754131196795193 28.012018027040558 28.532799198798198 20.70105157736605 55-59 23.10735029040657 28.569997997196072 27.598638093330663 20.724013619066696 60-64 22.34015921494017 28.89901366845241 28.57357432533921 20.18725279126821 65-69 23.11467200801202 27.511266900350527 27.96194291437156 21.4121181772659 70-74 23.034551827741613 28.087130696044067 28.337506259389084 20.54081121682524 75-79 23.1335436382755 27.444794952681388 28.391167192429023 21.03049421661409 80-84 23.43014521782674 28.352528793189784 27.43615423134702 20.781171757636454 85-89 23.039559339008512 27.811717576364547 28.327491236855284 20.821231847771656 90-94 23.475212819228844 27.721582373560338 28.217325988983475 20.58587881822734 95-99 23.56799519327058 28.2795914279992 27.86901662327258 20.28339675545764 100-104 23.815723585378066 27.325988983475213 28.182273410115172 20.67601402103155 105-109 23.897261302758725 27.90767536173835 28.198067390977823 19.99699594452511 110-114 24.090112640801 27.774718397997493 27.60450563204005 20.530663329161452 115-119 24.47170756134201 27.95192789183776 27.40610916374562 20.17025538307461 120-124 23.970956434651978 28.43264897346019 27.601402103154733 19.9949924887331 125-129 24.395373291272346 27.90045566070803 27.55996194481999 20.14420910319964 130-134 24.40160240360541 28.5778668002003 27.100650976464696 19.919879819729594 135-139 24.70706059088633 28.16725087631447 27.145718577866802 19.979969954932397 140-144 24.426869556512163 28.035839423365704 27.55531084192612 19.981980178196014 145-149 25.097646469704554 28.392588883324986 26.845267901852782 19.664496745117678 150-151 25.112499999999997 28.299999999999997 26.924999999999997 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 1.5 23 2.0 24 2.0 25 1.5 26 2.5 27 9.0 28 15.5 29 17.0 30 20.5 31 26.0 32 33.5 33 43.5 34 61.0 35 75.0 36 84.0 37 104.5 38 137.0 39 169.5 40 194.5 41 215.5 42 230.0 43 257.0 44 282.5 45 278.0 46 259.5 47 245.5 48 231.5 49 189.0 50 155.0 51 136.0 52 120.0 53 99.5 54 77.0 55 59.0 56 41.5 57 36.5 58 24.5 59 12.5 60 11.0 61 9.0 62 4.5 63 6.0 64 4.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.125 3 0.15 4 0.15 5 0.15 6 0.125 7 0.15 8 0.15 9 0.125 10-14 0.13999999999999999 15-19 0.135 20-24 0.15 25-29 0.15 30-34 0.15 35-39 0.15 40-44 0.15 45-49 0.15 50-54 0.15 55-59 0.13999999999999999 60-64 0.135 65-69 0.15 70-74 0.15 75-79 0.145 80-84 0.15 85-89 0.15 90-94 0.15 95-99 0.13999999999999999 100-104 0.15 105-109 0.135 110-114 0.125 115-119 0.15 120-124 0.15 125-129 0.145 130-134 0.15 135-139 0.15 140-144 0.11 145-149 0.15 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.4784688995215311 0.95 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02518257365902795 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1625 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.7375 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.725 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.675 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.550000000000001 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTTG 10 0.006830828 145.0 4 CAATCTT 10 0.006830828 145.0 4 TGAACTG 10 0.006830828 145.0 3 >>END_MODULE Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801160 spots for SRR7168833.sra Written 801160 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra Read 801151 spots for SRR7168833.sra Written 801151 spots for SRR7168833.sra SRR ids: ['SRR7168833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y6er9oaa SRR7168833.sra spots: 16023029 blocks: [[1, 801151], [801152, 1602302], [1602303, 2403453], [2403454, 3204604], [3204605, 4005755], [4005756, 4806906], [4806907, 5608057], [5608058, 6409208], [6409209, 7210359], [7210360, 8011510], [8011511, 8812661], [8812662, 9613812], [9613813, 10414963], [10414964, 11216114], [11216115, 12017265], [12017266, 12818416], [12818417, 13619567], [13619568, 14420718], [14420719, 15221869], [15221870, 16023029]] SRR7168833 file size 5407978 SRR7168833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168833 SRR7168833_1.fastq SRR7168833_2.fastq Input file: SRR7168833_1.fastq Paired file: SRR7168833_2.fastq trimmed: SRR7168833-trimmed-pair1.fastq, SRR7168833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:24:40 2025 >> started Sat Feb 15 05:24:58 2025 >> done (17.089s) 16023029 read pairs processed; of these: 48596 ( 0.30%) short read pairs filtered out after trimming by size control 123146 ( 0.77%) empty read pairs filtered out after trimming by size control 15851287 (98.93%) read pairs available; of these: 9180522 (57.92%) trimmed read pairs available after processing 6670765 (42.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 6 0.00% 21 12 0.00% 22 9 0.00% 23 6 0.00% 24 9 0.00% 25 7 0.00% 26 11 0.00% 27 14 0.00% 28 10 0.00% 29 15 0.00% 30 23 0.00% 31 21 0.00% 32 23 0.00% 33 28 0.00% 34 29 0.00% 35 41 0.00% 36 27 0.00% 37 56 0.00% 38 48 0.00% 39 59 0.00% 40 67 0.00% 41 85 0.00% 42 115 0.00% 43 111 0.00% 44 128 0.00% 45 134 0.00% 46 150 0.00% 47 190 0.00% 48 195 0.00% 49 217 0.00% 50 257 0.00% 51 306 0.00% 52 352 0.00% 53 396 0.00% 54 445 0.00% 55 435 0.00% 56 535 0.00% 57 553 0.00% 58 624 0.00% 59 690 0.00% 60 820 0.01% 61 905 0.01% 62 1088 0.01% 63 1137 0.01% 64 1291 0.01% 65 1328 0.01% 66 1508 0.01% 67 1678 0.01% 68 1788 0.01% 69 2268 0.01% 70 2352 0.01% 71 2643 0.02% 72 2989 0.02% 73 3492 0.02% 74 3626 0.02% 75 4012 0.03% 76 4241 0.03% 77 4534 0.03% 78 4961 0.03% 79 5556 0.04% 80 6025 0.04% 81 6959 0.04% 82 7792 0.05% 83 8837 0.06% 84 11260 0.07% 85 13168 0.08% 86 13374 0.08% 87 13926 0.09% 88 14347 0.09% 89 14780 0.09% 90 15686 0.10% 91 16813 0.11% 92 17770 0.11% 93 19055 0.12% 94 20336 0.13% 95 20974 0.13% 96 21883 0.14% 97 22097 0.14% 98 22910 0.14% 99 23493 0.15% 100 24872 0.16% 101 25801 0.16% 102 27457 0.17% 103 28618 0.18% 104 30346 0.19% 105 30758 0.19% 106 32124 0.20% 107 32604 0.21% 108 33561 0.21% 109 34446 0.22% 110 35204 0.22% 111 36592 0.23% 112 38303 0.24% 113 39604 0.25% 114 41540 0.26% 115 43193 0.27% 116 44454 0.28% 117 45418 0.29% 118 46296 0.29% 119 47022 0.30% 120 49038 0.31% 121 50014 0.32% 122 51755 0.33% 123 54342 0.34% 124 56577 0.36% 125 59139 0.37% 126 61639 0.39% 127 62603 0.39% 128 64850 0.41% 129 67424 0.43% 130 69243 0.44% 131 71407 0.45% 132 74900 0.47% 133 78727 0.50% 134 82596 0.52% 135 86765 0.55% 136 91646 0.58% 137 96400 0.61% 138 101744 0.64% 139 107328 0.68% 140 114330 0.72% 141 123344 0.78% 142 134100 0.85% 143 149917 0.95% 144 172510 1.09% 145 200843 1.27% 146 247383 1.56% 147 330671 2.09% 148 486080 3.07% 149 920749 5.81% 150 3774088 23.81% 151 6670765 42.08% 15851287 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=238.21 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=18 prefix-density=0.51 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=34.55 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCA SRR7168833 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:25:50 Started mapping on | Feb 15 05:25:50 Finished on | Feb 15 05:27:23 Mapping speed, Million of reads per hour | 613.60 Number of input reads | 15851287 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14817078 Uniquely mapped reads % | 93.48% Average mapped length | 288.78 Number of splices: Total | 14338054 Number of splices: Annotated (sjdb) | 14041798 Number of splices: GT/AG | 14054376 Number of splices: GC/AG | 240027 Number of splices: AT/AC | 7639 Number of splices: Non-canonical | 36012 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383603 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 53445 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690707 690707 690707 N_multimapping 383603 383603 383603 N_noFeature 583866 14433462 844655 N_ambiguous 205463 1530 81515 UnstrandedReadsAssigned:14027749 PositiveStrandReadsAssigned:382086 NegativeStrandReadsAssigned:13890908 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168833-trimmed-pair1.fastq SRR7168833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,851,287 reads, 13,915,879 reads pseudoaligned [quant] estimated average fragment length: 232.051 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7168833.ke.tsv 34699 SRR7168833.se.tsv 87100 total ==> SRR7168833.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.95 486 20.7568 Potri.005G024800.1.v4.1 1035 803.949 122 11.5816 Potri.004G059700.1.v4.1 961 729.995 1 0.104548 Potri.007G009000.2.v4.1 1416 1184.95 0 0 Potri.003G141000.2.v4.1 2943 2711.95 957.574 26.948 Potri.016G087400.1.v4.1 270 88.6295 550 473.609 Potri.015G069301.1.v4.1 564 337.223 0 0 Potri.010G195200.1.v4.1 1773 1541.95 15 0.742432 Potri.012G127500.1.v4.1 977 745.954 52 5.32018 ==> SRR7168833.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 396 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168833 completed mapping pipeline successfully