Starting /dee2/code/volunteer_pipeline.sh SRR7168834 current disk space = 3095086940160 free memory = 1580076740 SRR7168834 SRAfilesize 60b2e46784572e22a64704fcfcfc6a5e SRR7168834.sra SRR7168834.sra file validated SRR7168834 is paired end SRR7168834 is conventional basespace SRR7168834 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168834_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06275 34.0 33.0 34.0 32.0 34.0 2 33.102 34.0 33.0 34.0 32.0 34.0 3 33.22 34.0 33.0 34.0 32.0 34.0 4 33.2905 34.0 33.0 34.0 32.0 34.0 5 33.34725 34.0 33.0 34.0 33.0 34.0 6 37.0435 38.0 37.0 38.0 36.0 38.0 7 37.304 38.0 38.0 38.0 37.0 38.0 8 37.36925 38.0 38.0 38.0 37.0 38.0 9 37.451 38.0 38.0 38.0 37.0 38.0 10-14 37.42985 38.0 38.0 38.0 37.0 38.0 15-19 37.4443 38.0 38.0 38.0 37.0 38.0 20-24 37.44985 38.0 38.0 38.0 37.2 38.0 25-29 37.378750000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.3667 38.0 38.0 38.0 37.0 38.0 35-39 37.354150000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.3491 38.0 38.0 38.0 37.0 38.0 45-49 37.3096 38.0 38.0 38.0 37.0 38.0 50-54 37.28680000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.20885 38.0 38.0 38.0 36.6 38.0 60-64 37.167249999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.12605 38.0 38.0 38.0 36.0 38.0 70-74 37.1357 38.0 38.0 38.0 36.0 38.0 75-79 37.0359 38.0 38.0 38.0 36.0 38.0 80-84 36.9767 38.0 38.0 38.0 36.0 38.0 85-89 36.886700000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.827799999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.6606 38.0 38.0 38.0 34.6 38.0 100-104 36.602250000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.35755 38.0 38.0 38.0 34.0 38.0 110-114 36.289249999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.00535000000001 38.0 37.0 38.0 32.6 38.0 120-124 35.823899999999995 38.0 37.0 38.0 31.4 38.0 125-129 35.6359 38.0 36.6 38.0 31.0 38.0 130-134 35.2072 38.0 35.8 38.0 30.4 38.0 135-139 34.9501 38.0 36.0 38.0 29.4 38.0 140-144 34.20085 38.0 33.8 38.0 25.8 38.0 145-149 33.1638 38.0 33.0 38.0 17.8 38.0 150-151 28.13075 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 7.0 20 5.0 21 3.0 22 4.0 23 6.0 24 13.0 25 11.0 26 18.0 27 13.0 28 31.0 29 37.0 30 42.0 31 53.0 32 76.0 33 96.0 34 143.0 35 254.0 36 639.0 37 2541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.46755277560594 11.232733906697941 11.780036486838675 38.51967683085744 2 20.275000000000002 16.825000000000003 36.35 26.55 3 20.65 22.45 25.25 31.65 4 22.175 31.025000000000002 23.075000000000003 23.724999999999998 5 21.75 35.175 24.05 19.025 6 17.974999999999998 36.15 25.224999999999998 20.65 7 13.25 23.9 44.625 18.224999999999998 8 16.6 23.775 32.125 27.500000000000004 9 17.599999999999998 23.724999999999998 32.6 26.075 10-14 19.535 29.654999999999998 26.645000000000003 24.165 15-19 19.744999999999997 28.04 28.360000000000003 23.855 20-24 20.39 28.494999999999997 27.615000000000002 23.5 25-29 19.495 29.085 28.050000000000004 23.369999999999997 30-34 19.814999999999998 28.49 27.805000000000003 23.89 35-39 19.275000000000002 28.865000000000002 27.994999999999997 23.865 40-44 19.79 28.15 28.134999999999998 23.925 45-49 20.22 28.42 27.694999999999997 23.665 50-54 19.985 28.455000000000002 27.735 23.825 55-59 19.785 28.915000000000003 27.689999999999998 23.61 60-64 19.82 28.765 27.915 23.5 65-69 19.595000000000002 28.389999999999997 28.794999999999998 23.22 70-74 20.565 28.18 27.810000000000002 23.445 75-79 20.599999999999998 28.945 27.41 23.044999999999998 80-84 19.825 28.389999999999997 28.13 23.655 85-89 20.105 28.68 27.589999999999996 23.625 90-94 20.51 28.515 27.765 23.21 95-99 20.845 28.425 27.49 23.24 100-104 20.765 28.945 27.224999999999998 23.064999999999998 105-109 20.525 28.575 27.439999999999998 23.46 110-114 20.75 28.675 27.405 23.169999999999998 115-119 20.985 28.470000000000002 26.765 23.78 120-124 20.74 28.549999999999997 27.275 23.435 125-129 20.89 28.365000000000002 26.77 23.974999999999998 130-134 21.0 28.73 26.99 23.28 135-139 20.575 28.835 27.029999999999998 23.56 140-144 21.115000000000002 29.21 26.340000000000003 23.335 145-149 20.71 28.98 26.314999999999998 23.995 150-151 20.8625 28.787499999999998 26.2125 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.5 24 3.0 25 6.0 26 8.5 27 6.0 28 4.5 29 11.0 30 15.5 31 22.5 32 32.0 33 35.5 34 51.0 35 79.5 36 102.5 37 124.5 38 146.0 39 170.0 40 199.0 41 230.5 42 249.5 43 264.0 44 288.5 45 276.0 46 254.0 47 237.5 48 207.5 49 192.0 50 168.5 51 139.0 52 108.5 53 87.5 54 72.5 55 51.5 56 37.5 57 29.0 58 23.0 59 19.0 60 13.0 61 7.0 62 6.5 63 3.5 64 1.5 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.0875000000000004 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.675 0.0 0.0 0.0 0.0 128-129 6.074999999999999 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.175000000000001 0.0 0.0 0.0 0.0 134-135 7.637499999999999 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168834 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168834_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87375 33.0 33.0 34.0 32.0 34.0 2 32.9765 33.0 33.0 34.0 32.0 34.0 3 32.98825 34.0 33.0 34.0 32.0 34.0 4 32.90425 34.0 33.0 34.0 32.0 34.0 5 32.967 34.0 33.0 34.0 32.0 34.0 6 37.17525 38.0 38.0 38.0 37.0 38.0 7 37.1865 38.0 38.0 38.0 37.0 38.0 8 37.1565 38.0 38.0 38.0 37.0 38.0 9 37.2255 38.0 38.0 38.0 37.0 38.0 10-14 37.161199999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.1034 38.0 38.0 38.0 37.0 38.0 20-24 37.10805 38.0 38.0 38.0 37.0 38.0 25-29 37.09115 38.0 38.0 38.0 37.0 38.0 30-34 37.1146 38.0 38.0 38.0 37.0 38.0 35-39 37.09705 38.0 38.0 38.0 37.0 38.0 40-44 37.09994999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.03605 38.0 38.0 38.0 36.8 38.0 50-54 37.017399999999995 38.0 38.0 38.0 36.2 38.0 55-59 36.96725 38.0 38.0 38.0 36.0 38.0 60-64 36.9738 38.0 38.0 38.0 36.0 38.0 65-69 36.9443 38.0 38.0 38.0 36.0 38.0 70-74 36.8247 38.0 38.0 38.0 36.0 38.0 75-79 36.72185 38.0 38.0 38.0 35.8 38.0 80-84 36.65215 38.0 38.0 38.0 35.4 38.0 85-89 36.50765 38.0 38.0 38.0 34.8 38.0 90-94 36.4827 38.0 38.0 38.0 34.6 38.0 95-99 36.43385000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.2885 38.0 38.0 38.0 34.0 38.0 105-109 36.20715 38.0 38.0 38.0 34.0 38.0 110-114 35.89385 38.0 37.8 38.0 33.4 38.0 115-119 35.8165 38.0 37.2 38.0 32.8 38.0 120-124 35.55285000000001 38.0 37.0 38.0 31.2 38.0 125-129 35.34405 38.0 36.8 38.0 30.6 38.0 130-134 34.8913 38.0 36.0 38.0 28.0 38.0 135-139 34.40815 38.0 35.6 38.0 26.4 38.0 140-144 33.782450000000004 38.0 34.0 38.0 22.6 38.0 145-149 32.35315 38.0 33.0 38.0 10.6 38.0 150-151 27.124 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 4.0 11 3.0 12 5.0 13 1.0 14 3.0 15 5.0 16 5.0 17 7.0 18 4.0 19 7.0 20 5.0 21 3.0 22 11.0 23 7.0 24 18.0 25 18.0 26 28.0 27 27.0 28 22.0 29 46.0 30 44.0 31 51.0 32 70.0 33 93.0 34 125.0 35 204.0 36 609.0 37 2565.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.225 17.4 15.725 29.65 2 26.224999999999998 25.8 31.775 16.2 3 21.325 29.225 29.675 19.775000000000002 4 23.525 35.9 21.6 18.975 5 23.35 37.075 22.35 17.224999999999998 6 19.925 38.7 23.549999999999997 17.825 7 20.025000000000002 20.25 38.45 21.275 8 20.724999999999998 26.224999999999998 28.349999999999998 24.7 9 21.65 25.45 29.925 22.975 10-14 22.665 29.145 26.695 21.495 15-19 22.125 28.310000000000002 28.705000000000002 20.86 20-24 23.128469270390557 27.954193128969347 28.144221633244985 20.77311596739511 25-29 22.759551910382076 27.860572114422883 28.280656131226245 21.099219843968793 30-34 22.992299229922992 27.702770277027707 28.622862286228624 20.68206820682068 35-39 22.190547636909226 28.032008002000502 28.647161790447612 21.13028257064266 40-44 23.001900570171053 27.953386015804742 28.148444533360006 20.8962688806642 45-49 23.075000000000003 27.83 28.345 20.75 50-54 23.29 27.3 28.345 21.065 55-59 22.609521904380873 27.30546109221844 29.100820164032807 20.984196839367875 60-64 22.99 28.084999999999997 28.225 20.7 65-69 23.033455018252738 28.029204380657095 28.15422313347002 20.783117467620144 70-74 23.25465093018604 27.620524104820966 27.695539107821567 21.429285857171436 75-79 23.222772524888686 27.585171844514484 28.39061483816099 20.80144079243584 80-84 23.540885221305327 28.16704176044011 28.08202050512628 20.210052513128282 85-89 23.5623842650518 27.861468394975226 27.796406586256943 20.77974075371603 90-94 23.864318591154692 27.591554932959777 27.881729037422453 20.662397438463078 95-99 23.623899119295437 28.18755004003203 27.987389911929544 20.201160928742993 100-104 23.110021513984087 27.958172812328012 28.078250863060987 20.853554810626907 105-109 23.315154850652924 28.408465502576675 28.318406964526943 19.957972682243458 110-114 23.915545104317808 27.968179316555762 27.19767849101916 20.91859708810727 115-119 23.688028415628594 28.550702886587626 27.53514432938116 20.22612436840262 120-124 24.034420652391436 28.497098258955372 27.671602961777065 19.796878126876123 125-129 24.157078539269637 28.29414707353677 27.773886943471737 19.774887443721862 130-134 24.471919111022125 27.805586144759236 27.695465011512667 20.027029732705977 135-139 24.56333516840999 27.956558730794256 27.576197387518143 19.903908713277612 140-144 24.803642003101707 27.58016909300115 27.895342438341086 19.720846465556054 145-149 25.55044035228183 28.31765412329864 27.12169735788631 19.010208166533225 150-151 25.47842401500938 29.168230143839903 26.37898686679174 18.974358974358974 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.5 23 1.0 24 2.5 25 4.0 26 4.5 27 6.5 28 7.5 29 12.5 30 20.5 31 25.5 32 35.5 33 47.0 34 52.5 35 62.5 36 83.5 37 112.5 38 128.0 39 151.5 40 198.0 41 229.0 42 253.0 43 264.0 44 271.5 45 286.5 46 266.5 47 252.5 48 248.0 49 214.5 50 171.0 51 127.0 52 110.5 53 92.0 54 69.5 55 56.0 56 35.5 57 23.0 58 18.5 59 14.0 60 9.0 61 7.0 62 6.5 63 6.5 64 3.0 65 1.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.02 30-34 0.01 35-39 0.025 40-44 0.03 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.015 70-74 0.02 75-79 0.055 80-84 0.025 85-89 0.095 90-94 0.06 95-99 0.08 100-104 0.065 105-109 0.065 110-114 0.065 115-119 0.055 120-124 0.06 125-129 0.05 130-134 0.11 135-139 0.095 140-144 0.055 145-149 0.08 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7125000000000004 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.825 0.0 0.0 0.0 0.0 128-129 6.237500000000001 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 7.887499999999999 0.0 0.0 0.0 0.0 136-137 8.3 0.0 0.0 0.0 0.0 138-139 8.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867539 spots for SRR7168834.sra Written 867539 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra Read 867527 spots for SRR7168834.sra Written 867527 spots for SRR7168834.sra SRR ids: ['SRR7168834.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yh8i_wak SRR7168834.sra spots: 17350552 blocks: [[1, 867527], [867528, 1735054], [1735055, 2602581], [2602582, 3470108], [3470109, 4337635], [4337636, 5205162], [5205163, 6072689], [6072690, 6940216], [6940217, 7807743], [7807744, 8675270], [8675271, 9542797], [9542798, 10410324], [10410325, 11277851], [11277852, 12145378], [12145379, 13012905], [13012906, 13880432], [13880433, 14747959], [14747960, 15615486], [15615487, 16483013], [16483014, 17350552]] SRR7168834 file size 5857832 SRR7168834 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168834 SRR7168834_1.fastq SRR7168834_2.fastq Input file: SRR7168834_1.fastq Paired file: SRR7168834_2.fastq trimmed: SRR7168834-trimmed-pair1.fastq, SRR7168834-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:00:22 2025 >> started Sat Feb 15 05:00:50 2025 >> done (27.694s) 17350552 read pairs processed; of these: 22769 ( 0.13%) short read pairs filtered out after trimming by size control 21256 ( 0.12%) empty read pairs filtered out after trimming by size control 17306527 (99.75%) read pairs available; of these: 9443320 (54.57%) trimmed read pairs available after processing 7863207 (45.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 10 0.00% 27 6 0.00% 28 10 0.00% 29 7 0.00% 30 14 0.00% 31 14 0.00% 32 13 0.00% 33 19 0.00% 34 7 0.00% 35 19 0.00% 36 20 0.00% 37 14 0.00% 38 20 0.00% 39 33 0.00% 40 30 0.00% 41 37 0.00% 42 42 0.00% 43 42 0.00% 44 52 0.00% 45 59 0.00% 46 56 0.00% 47 69 0.00% 48 68 0.00% 49 78 0.00% 50 95 0.00% 51 116 0.00% 52 102 0.00% 53 137 0.00% 54 143 0.00% 55 149 0.00% 56 173 0.00% 57 223 0.00% 58 215 0.00% 59 259 0.00% 60 263 0.00% 61 361 0.00% 62 390 0.00% 63 446 0.00% 64 540 0.00% 65 636 0.00% 66 608 0.00% 67 700 0.00% 68 919 0.01% 69 1441 0.01% 70 1395 0.01% 71 1225 0.01% 72 1396 0.01% 73 1568 0.01% 74 1766 0.01% 75 1977 0.01% 76 2216 0.01% 77 2468 0.01% 78 2668 0.02% 79 3022 0.02% 80 3361 0.02% 81 3871 0.02% 82 4439 0.03% 83 5034 0.03% 84 5952 0.03% 85 6861 0.04% 86 7341 0.04% 87 7848 0.05% 88 8772 0.05% 89 8933 0.05% 90 9542 0.06% 91 10438 0.06% 92 11207 0.06% 93 12375 0.07% 94 13563 0.08% 95 14410 0.08% 96 15162 0.09% 97 16051 0.09% 98 17027 0.10% 99 17842 0.10% 100 19309 0.11% 101 19983 0.12% 102 21402 0.12% 103 22580 0.13% 104 23786 0.14% 105 25584 0.15% 106 26827 0.16% 107 27921 0.16% 108 28763 0.17% 109 30032 0.17% 110 30963 0.18% 111 32325 0.19% 112 33579 0.19% 113 35522 0.21% 114 37330 0.22% 115 38691 0.22% 116 40244 0.23% 117 41731 0.24% 118 42775 0.25% 119 44012 0.25% 120 45108 0.26% 121 46758 0.27% 122 48927 0.28% 123 50985 0.29% 124 53792 0.31% 125 55243 0.32% 126 58048 0.34% 127 59334 0.34% 128 61705 0.36% 129 64120 0.37% 130 65888 0.38% 131 68444 0.40% 132 71489 0.41% 133 75147 0.43% 134 78603 0.45% 135 82117 0.47% 136 87350 0.50% 137 92547 0.53% 138 97793 0.57% 139 104417 0.60% 140 110985 0.64% 141 120618 0.70% 142 132298 0.76% 143 148212 0.86% 144 170730 0.99% 145 201122 1.16% 146 252105 1.46% 147 331210 1.91% 148 493685 2.85% 149 953062 5.51% 150 4309699 24.90% 151 7863207 45.43% 17306527 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=21 prefix-density=0.32 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=396.10 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=18 prefix-density=0.41 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=16.74 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.5 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7168834 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:01:47 Started mapping on | Feb 15 05:01:47 Finished on | Feb 15 05:03:51 Mapping speed, Million of reads per hour | 502.45 Number of input reads | 17306527 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16149690 Uniquely mapped reads % | 93.32% Average mapped length | 291.62 Number of splices: Total | 15247499 Number of splices: Annotated (sjdb) | 14858676 Number of splices: GT/AG | 14947439 Number of splices: GC/AG | 240514 Number of splices: AT/AC | 9080 Number of splices: Non-canonical | 50466 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 517075 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 104854 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654459 654459 654459 N_multimapping 517075 517075 517075 N_noFeature 688811 15789732 912249 N_ambiguous 272616 1963 134578 UnstrandedReadsAssigned:15188263 PositiveStrandReadsAssigned:357995 NegativeStrandReadsAssigned:15102863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168834 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168834-trimmed-pair1.fastq SRR7168834-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,306,527 reads, 15,144,075 reads pseudoaligned [quant] estimated average fragment length: 228.785 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7168834.ke.tsv 34699 SRR7168834.se.tsv 87100 total ==> SRR7168834.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.21 1301 49.3779 Potri.005G024800.1.v4.1 1035 807.215 211 17.7604 Potri.004G059700.1.v4.1 961 733.252 10 0.926632 Potri.007G009000.2.v4.1 1416 1188.21 0 0 Potri.003G141000.2.v4.1 2943 2715.21 1018 25.4744 Potri.016G087400.1.v4.1 270 85.915 664 525.121 Potri.015G069301.1.v4.1 564 339.868 0 0 Potri.010G195200.1.v4.1 1773 1545.21 285 12.5319 Potri.012G127500.1.v4.1 977 749.236 186 16.8676 ==> SRR7168834.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 715 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 151 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7168834 completed mapping pipeline successfully