Starting /dee2/code/volunteer_pipeline.sh SRR7168835 current disk space = 3099974950912 free memory = 1464415312 SRR7168835 SRAfilesize 2a7092ba28732941ae1c68ca480766ff SRR7168835.sra SRR7168835.sra file validated SRR7168835 is paired end SRR7168835 is conventional basespace SRR7168835 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1385 34.0 33.0 34.0 32.0 34.0 2 33.13025 34.0 33.0 34.0 32.0 34.0 3 33.18875 34.0 33.0 34.0 32.0 34.0 4 33.24125 34.0 33.0 34.0 32.0 34.0 5 33.2745 34.0 33.0 34.0 33.0 34.0 6 36.969 38.0 37.0 38.0 36.0 38.0 7 37.255 38.0 38.0 38.0 37.0 38.0 8 37.337 38.0 38.0 38.0 37.0 38.0 9 37.391 38.0 38.0 38.0 37.0 38.0 10-14 37.42285 38.0 38.0 38.0 37.0 38.0 15-19 37.42829999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.3688 38.0 38.0 38.0 37.0 38.0 25-29 37.373149999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.3385 38.0 38.0 38.0 37.0 38.0 35-39 37.2836 38.0 38.0 38.0 37.0 38.0 40-44 37.2038 38.0 38.0 38.0 37.0 38.0 45-49 37.19904999999999 38.0 38.0 38.0 36.6 38.0 50-54 37.068799999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.065000000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.90175 38.0 38.0 38.0 35.6 38.0 65-69 36.9052 38.0 38.0 38.0 35.8 38.0 70-74 36.9016 38.0 38.0 38.0 35.6 38.0 75-79 36.7844 38.0 38.0 38.0 35.2 38.0 80-84 36.612049999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.4143 38.0 38.0 38.0 34.0 38.0 90-94 36.4183 38.0 38.0 38.0 34.0 38.0 95-99 36.0539 38.0 37.8 38.0 32.6 38.0 100-104 36.04755 38.0 37.2 38.0 33.2 38.0 105-109 35.9675 38.0 37.0 38.0 32.6 38.0 110-114 35.6417 38.0 37.0 38.0 30.2 38.0 115-119 35.38164999999999 38.0 36.2 38.0 29.4 38.0 120-124 35.1365 38.0 36.0 38.0 28.0 38.0 125-129 34.9108 38.0 36.0 38.0 27.4 38.0 130-134 34.365249999999996 38.0 35.0 38.0 24.0 38.0 135-139 33.6904 38.0 33.8 38.0 20.2 38.0 140-144 33.0308 38.0 33.0 38.0 15.8 38.0 145-149 31.54355 38.0 31.0 38.0 10.8 38.0 150-151 27.533875000000002 34.5 17.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 4.0 17 1.0 18 6.0 19 7.0 20 6.0 21 8.0 22 7.0 23 9.0 24 17.0 25 19.0 26 31.0 27 31.0 28 34.0 29 51.0 30 50.0 31 77.0 32 113.0 33 133.0 34 158.0 35 287.0 36 676.0 37 2270.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.16883116883117 15.662337662337663 11.012987012987013 34.15584415584416 2 22.45 19.1 31.924999999999997 26.525 3 19.35 25.674999999999997 25.924999999999997 29.049999999999997 4 21.175 32.95 23.0 22.875 5 22.35 36.875 22.95 17.825 6 16.85 37.525 25.95 19.675 7 13.425 24.675 43.95 17.95 8 18.35 24.275 29.45 27.925 9 18.075 24.775 32.95 24.2 10-14 20.47 29.37 26.435 23.724999999999998 15-19 19.54 29.23 27.215 24.015 20-24 20.335 28.060000000000002 28.305000000000003 23.3 25-29 19.285 29.395 28.02 23.3 30-34 19.735 28.970000000000002 27.765 23.53 35-39 20.21 29.494999999999997 27.215 23.080000000000002 40-44 19.665 28.645 27.93 23.76 45-49 19.805 28.825 27.445000000000004 23.925 50-54 19.975 28.549999999999997 27.16 24.315 55-59 20.21 28.515 27.915 23.36 60-64 20.59 28.215 27.52 23.674999999999997 65-69 20.169999999999998 28.555000000000003 27.785 23.49 70-74 20.125 28.7 27.725 23.45 75-79 20.07 28.67 27.76 23.5 80-84 20.53 28.000000000000004 27.794999999999998 23.674999999999997 85-89 20.65 28.444999999999997 27.51 23.395 90-94 20.19 28.725 27.41 23.674999999999997 95-99 20.66 28.205000000000002 27.384999999999998 23.75 100-104 20.86 28.485 27.185 23.47 105-109 20.75 27.975 27.99 23.285 110-114 20.825 28.735 26.924999999999997 23.515 115-119 21.175 27.85 27.04 23.935000000000002 120-124 20.84 28.12 27.21 23.830000000000002 125-129 20.785 27.92 26.950000000000003 24.345 130-134 21.375 27.894999999999996 26.905 23.825 135-139 20.905 28.48 27.11 23.505000000000003 140-144 20.815 28.075 27.025 24.085 145-149 20.9 27.455000000000002 27.205000000000002 24.44 150-151 21.0 27.5875 27.500000000000004 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 3.0 25 5.5 26 6.5 27 7.0 28 8.5 29 14.0 30 17.5 31 26.0 32 31.0 33 42.0 34 65.0 35 69.0 36 85.0 37 118.5 38 150.5 39 176.5 40 201.5 41 225.5 42 242.5 43 255.5 44 269.5 45 280.0 46 264.0 47 239.0 48 223.5 49 192.5 50 164.0 51 137.5 52 104.0 53 89.0 54 72.0 55 51.5 56 38.0 57 31.5 58 27.0 59 19.0 60 16.0 61 12.0 62 5.0 63 4.0 64 3.0 65 1.0 66 0.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3012804418779814 0.6 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.7249999999999996 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.8875 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.575 0.0 0.0 0.0 0.0 126-127 6.1375 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.2 0.0 0.0 0.0 0.0 132-133 7.7375 0.0 0.0 0.0 0.0 134-135 8.5375 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGTTC 10 0.0068343505 144.975 8 >>END_MODULE SRR7168835 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.765 33.0 33.0 34.0 32.0 34.0 2 32.875 33.0 33.0 34.0 32.0 34.0 3 32.9 34.0 33.0 34.0 32.0 34.0 4 32.83575 34.0 33.0 34.0 32.0 34.0 5 32.80325 34.0 33.0 34.0 32.0 34.0 6 36.96 38.0 38.0 38.0 36.0 38.0 7 36.8705 38.0 38.0 38.0 36.0 38.0 8 36.996 38.0 38.0 38.0 37.0 38.0 9 36.88025 38.0 38.0 38.0 36.0 38.0 10-14 36.8729 38.0 38.0 38.0 36.2 38.0 15-19 36.891349999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.897000000000006 38.0 38.0 38.0 36.2 38.0 25-29 36.86105 38.0 38.0 38.0 36.0 38.0 30-34 36.84755 38.0 38.0 38.0 36.0 38.0 35-39 36.798350000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.733999999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.701649999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.57775 38.0 38.0 38.0 35.2 38.0 55-59 36.581399999999995 38.0 38.0 38.0 35.4 38.0 60-64 36.5939 38.0 38.0 38.0 35.0 38.0 65-69 36.55135 38.0 38.0 38.0 34.8 38.0 70-74 36.38875 38.0 38.0 38.0 34.0 38.0 75-79 36.18325 38.0 38.0 38.0 34.0 38.0 80-84 36.28005 38.0 38.0 38.0 34.0 38.0 85-89 36.12445 38.0 38.0 38.0 33.6 38.0 90-94 36.02675 38.0 38.0 38.0 33.4 38.0 95-99 35.9409 38.0 38.0 38.0 33.4 38.0 100-104 35.7279 38.0 37.8 38.0 32.2 38.0 105-109 35.4381 38.0 37.4 38.0 30.2 38.0 110-114 35.3061 38.0 37.0 38.0 29.6 38.0 115-119 35.2008 38.0 37.0 38.0 28.6 38.0 120-124 34.80985 38.0 36.2 38.0 26.8 38.0 125-129 34.606399999999994 38.0 36.0 38.0 26.0 38.0 130-134 34.0497 38.0 35.0 38.0 21.4 38.0 135-139 33.411699999999996 38.0 33.6 38.0 19.8 38.0 140-144 32.71585 38.0 33.0 38.0 13.4 38.0 145-149 31.46155 38.0 32.6 38.0 4.2 38.0 150-151 26.480375000000002 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 1.0 5 1.0 6 2.0 7 4.0 8 2.0 9 2.0 10 1.0 11 3.0 12 4.0 13 6.0 14 3.0 15 10.0 16 13.0 17 3.0 18 14.0 19 12.0 20 22.0 21 14.0 22 15.0 23 10.0 24 26.0 25 30.0 26 23.0 27 30.0 28 38.0 29 46.0 30 56.0 31 60.0 32 60.0 33 91.0 34 145.0 35 264.0 36 543.0 37 2436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 20.849999999999998 15.125 25.85 2 26.974999999999998 25.924999999999997 30.95 16.150000000000002 3 22.875 28.7 30.275000000000002 18.15 4 23.25 35.8 22.325 18.625 5 25.174999999999997 36.775000000000006 22.3 15.75 6 19.825 38.35 23.674999999999997 18.15 7 19.175 19.725 40.725 20.375 8 22.1 23.525 28.299999999999997 26.075 9 21.95 24.474999999999998 29.875 23.7 10-14 23.25 28.985 26.465 21.3 15-19 23.195 28.255000000000003 27.750000000000004 20.8 20-24 22.62 27.91 28.59 20.880000000000003 25-29 22.965 28.065 28.194999999999997 20.775 30-34 22.884999999999998 28.255000000000003 28.02 20.84 35-39 22.795 28.449999999999996 28.01 20.745 40-44 23.22 27.73 28.084999999999997 20.965 45-49 23.22 27.71 28.139999999999997 20.93 50-54 23.13 27.855 27.735 21.279999999999998 55-59 22.814999999999998 27.925 27.750000000000004 21.51 60-64 23.39 27.584999999999997 27.845 21.18 65-69 23.49 28.044999999999998 27.775 20.69 70-74 23.72 27.52 27.715 21.044999999999998 75-79 22.770000000000003 27.779999999999998 28.470000000000002 20.979999999999997 80-84 23.575 27.644999999999996 28.335 20.445 85-89 23.54 27.96 27.834999999999997 20.665 90-94 23.549999999999997 27.63 28.07 20.75 95-99 24.11 27.445000000000004 27.779999999999998 20.665 100-104 23.665 28.185 27.43 20.72 105-109 23.34 28.04 27.845 20.775 110-114 24.04 28.189999999999998 27.345000000000002 20.424999999999997 115-119 24.5 27.834999999999997 27.49 20.175 120-124 24.145 27.750000000000004 27.384999999999998 20.72 125-129 24.355 28.395 27.384999999999998 19.865 130-134 24.805 27.615000000000002 27.22 20.36 135-139 25.045 28.494999999999997 27.13 19.33 140-144 25.380000000000003 27.875 26.87 19.875 145-149 25.919999999999998 27.785 26.790000000000003 19.505 150-151 26.1625 27.800000000000004 26.35 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 2.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.5 23 2.0 24 1.0 25 4.5 26 5.5 27 3.5 28 6.5 29 10.5 30 14.5 31 19.0 32 30.5 33 40.5 34 51.0 35 62.5 36 86.5 37 115.5 38 133.0 39 162.5 40 190.0 41 209.0 42 247.0 43 271.5 44 271.0 45 282.0 46 265.5 47 239.5 48 230.0 49 209.0 50 183.5 51 145.5 52 106.0 53 88.0 54 72.0 55 57.0 56 41.0 57 30.5 58 30.5 59 25.0 60 14.5 61 8.5 62 7.5 63 7.0 64 4.0 65 2.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.5035246727089627 1.0 3 0.0 0.0 4 0.0 0.0 5 0.050352467270896276 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.1 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.55 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 6.925 0.0 0.0 0.0 0.0 132-133 7.475 0.0 0.0 0.0 0.0 134-135 8.2875 0.0 0.0 0.0 0.0 136-137 8.9375 0.0 0.0 0.0 0.0 138-139 9.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAAT 10 0.006830828 145.0 6 >>END_MODULE Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797411 spots for SRR7168835.sra Written 797411 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra Read 797394 spots for SRR7168835.sra Written 797394 spots for SRR7168835.sra SRR ids: ['SRR7168835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k2o93rxr SRR7168835.sra spots: 15947897 blocks: [[1, 797394], [797395, 1594788], [1594789, 2392182], [2392183, 3189576], [3189577, 3986970], [3986971, 4784364], [4784365, 5581758], [5581759, 6379152], [6379153, 7176546], [7176547, 7973940], [7973941, 8771334], [8771335, 9568728], [9568729, 10366122], [10366123, 11163516], [11163517, 11960910], [11960911, 12758304], [12758305, 13555698], [13555699, 14353092], [14353093, 15150486], [15150487, 15947897]] SRR7168835 file size 5382518 SRR7168835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168835 SRR7168835_1.fastq SRR7168835_2.fastq Input file: SRR7168835_1.fastq Paired file: SRR7168835_2.fastq trimmed: SRR7168835-trimmed-pair1.fastq, SRR7168835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:08:02 2025 >> started Sat Feb 15 04:08:21 2025 >> done (19.015s) 15947897 read pairs processed; of these: 22775 ( 0.14%) short read pairs filtered out after trimming by size control 27616 ( 0.17%) empty read pairs filtered out after trimming by size control 15897506 (99.68%) read pairs available; of these: 8376732 (52.69%) trimmed read pairs available after processing 7520774 (47.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 5 0.00% 23 9 0.00% 24 5 0.00% 25 10 0.00% 26 9 0.00% 27 11 0.00% 28 7 0.00% 29 4 0.00% 30 13 0.00% 31 16 0.00% 32 18 0.00% 33 10 0.00% 34 14 0.00% 35 19 0.00% 36 21 0.00% 37 21 0.00% 38 23 0.00% 39 32 0.00% 40 39 0.00% 41 41 0.00% 42 36 0.00% 43 44 0.00% 44 57 0.00% 45 60 0.00% 46 58 0.00% 47 81 0.00% 48 84 0.00% 49 96 0.00% 50 100 0.00% 51 139 0.00% 52 128 0.00% 53 172 0.00% 54 157 0.00% 55 193 0.00% 56 217 0.00% 57 256 0.00% 58 319 0.00% 59 316 0.00% 60 363 0.00% 61 408 0.00% 62 528 0.00% 63 568 0.00% 64 619 0.00% 65 686 0.00% 66 754 0.00% 67 923 0.01% 68 1061 0.01% 69 2447 0.02% 70 2052 0.01% 71 1599 0.01% 72 1866 0.01% 73 1976 0.01% 74 2159 0.01% 75 2460 0.02% 76 2577 0.02% 77 2945 0.02% 78 3251 0.02% 79 3567 0.02% 80 4157 0.03% 81 4635 0.03% 82 5256 0.03% 83 6006 0.04% 84 7607 0.05% 85 8519 0.05% 86 8803 0.06% 87 9623 0.06% 88 10259 0.06% 89 10654 0.07% 90 11661 0.07% 91 12834 0.08% 92 13663 0.09% 93 15184 0.10% 94 16025 0.10% 95 16791 0.11% 96 17786 0.11% 97 18363 0.12% 98 18945 0.12% 99 19446 0.12% 100 21282 0.13% 101 22078 0.14% 102 23709 0.15% 103 25360 0.16% 104 26467 0.17% 105 28047 0.18% 106 28760 0.18% 107 29548 0.19% 108 30137 0.19% 109 30981 0.19% 110 32339 0.20% 111 33841 0.21% 112 35798 0.23% 113 37117 0.23% 114 38813 0.24% 115 39982 0.25% 116 41672 0.26% 117 42305 0.27% 118 43207 0.27% 119 43568 0.27% 120 44620 0.28% 121 46166 0.29% 122 48427 0.30% 123 50074 0.31% 124 52663 0.33% 125 54449 0.34% 126 56867 0.36% 127 57680 0.36% 128 58678 0.37% 129 60008 0.38% 130 61549 0.39% 131 63524 0.40% 132 66285 0.42% 133 69358 0.44% 134 72280 0.45% 135 76690 0.48% 136 79769 0.50% 137 83331 0.52% 138 87341 0.55% 139 91992 0.58% 140 97212 0.61% 141 104677 0.66% 142 113731 0.72% 143 127233 0.80% 144 143940 0.91% 145 170252 1.07% 146 207385 1.30% 147 273553 1.72% 148 406803 2.56% 149 780462 4.91% 150 3742838 23.54% 151 7520774 47.31% 15897506 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=85.26 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.43 prefix-fanout=2.1 sequence=TTCTCTTAGCTACCATCGTCTTCTCTCCCCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=26.67 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7168835 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:09:36 Started mapping on | Feb 15 04:09:37 Finished on | Feb 15 04:11:54 Mapping speed, Million of reads per hour | 417.74 Number of input reads | 15897506 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14577360 Uniquely mapped reads % | 91.70% Average mapped length | 290.63 Number of splices: Total | 13468198 Number of splices: Annotated (sjdb) | 13120133 Number of splices: GT/AG | 13210645 Number of splices: GC/AG | 196510 Number of splices: AT/AC | 8279 Number of splices: Non-canonical | 52764 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484675 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 132287 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858244 858244 858244 N_multimapping 484675 484675 484675 N_noFeature 563210 14202766 805090 N_ambiguous 269408 2086 135211 UnstrandedReadsAssigned:13744742 PositiveStrandReadsAssigned:372508 NegativeStrandReadsAssigned:13637059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168835-trimmed-pair1.fastq SRR7168835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,897,506 reads, 13,721,659 reads pseudoaligned [quant] estimated average fragment length: 234.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7168835.ke.tsv 34699 SRR7168835.se.tsv 87100 total ==> SRR7168835.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.43 1492 58.7072 Potri.005G024800.1.v4.1 1035 801.428 309 27.0717 Potri.004G059700.1.v4.1 961 727.513 0 0 Potri.007G009000.2.v4.1 1416 1182.43 0 0 Potri.003G141000.2.v4.1 2943 2709.43 916.455 23.7495 Potri.016G087400.1.v4.1 270 88.9821 789 622.58 Potri.015G069301.1.v4.1 564 336.229 0 0 Potri.010G195200.1.v4.1 1773 1539.43 685.912 31.2846 Potri.012G127500.1.v4.1 977 743.471 138 13.0328 ==> SRR7168835.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 855 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 49 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7168835 completed mapping pipeline successfully