Starting /dee2/code/volunteer_pipeline.sh SRR7168836 current disk space = 3097605009408 free memory = 1484686200 SRR7168836 SRAfilesize 584b997526949c982a26a027344f2974 SRR7168836.sra SRR7168836.sra file validated SRR7168836 is paired end SRR7168836 is conventional basespace SRR7168836 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168836_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.79 34.0 33.0 34.0 32.0 34.0 2 33.1535 34.0 33.0 34.0 32.0 34.0 3 33.1885 34.0 33.0 34.0 32.0 34.0 4 33.257 34.0 33.0 34.0 32.0 34.0 5 33.34025 34.0 33.0 34.0 33.0 34.0 6 36.9525 38.0 37.0 38.0 36.0 38.0 7 37.2695 38.0 38.0 38.0 36.0 38.0 8 37.343 38.0 38.0 38.0 37.0 38.0 9 37.4935 38.0 38.0 38.0 37.0 38.0 10-14 37.4679 38.0 38.0 38.0 37.0 38.0 15-19 37.51445 38.0 38.0 38.0 37.8 38.0 20-24 37.45425 38.0 38.0 38.0 37.2 38.0 25-29 37.420849999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.42845 38.0 38.0 38.0 37.0 38.0 35-39 37.365300000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.31315 38.0 38.0 38.0 37.0 38.0 45-49 37.325300000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.18390000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.16685 38.0 38.0 38.0 36.4 38.0 60-64 37.01615 38.0 38.0 38.0 36.0 38.0 65-69 37.0 38.0 38.0 38.0 36.0 38.0 70-74 36.98455 38.0 38.0 38.0 36.0 38.0 75-79 36.8115 38.0 38.0 38.0 35.6 38.0 80-84 36.7278 38.0 38.0 38.0 35.0 38.0 85-89 36.56135 38.0 38.0 38.0 34.4 38.0 90-94 36.47925 38.0 38.0 38.0 34.0 38.0 95-99 36.1734 38.0 38.0 38.0 33.6 38.0 100-104 36.228899999999996 38.0 38.0 38.0 33.6 38.0 105-109 36.16025 38.0 38.0 38.0 33.6 38.0 110-114 35.76395 38.0 37.0 38.0 31.4 38.0 115-119 35.44154999999999 38.0 36.6 38.0 30.2 38.0 120-124 35.1289 38.0 36.0 38.0 28.2 38.0 125-129 34.9634 38.0 35.8 38.0 27.6 38.0 130-134 34.478699999999996 38.0 35.2 38.0 25.0 38.0 135-139 33.8358 38.0 33.8 38.0 22.2 38.0 140-144 33.277499999999996 38.0 33.0 38.0 18.2 38.0 145-149 31.986399999999996 38.0 32.2 38.0 10.8 38.0 150-151 28.076999999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 1.0 17 5.0 18 6.0 19 5.0 20 6.0 21 3.0 22 8.0 23 8.0 24 20.0 25 18.0 26 27.0 27 24.0 28 34.0 29 29.0 30 52.0 31 78.0 32 85.0 33 118.0 34 163.0 35 295.0 36 682.0 37 2327.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.96787783043707 11.400737230121116 10.42654028436019 39.20484465508162 2 21.55 17.8 35.375 25.275 3 21.675 22.25 24.275 31.8 4 23.5 30.325000000000003 20.775 25.4 5 22.475 35.25 23.5 18.775 6 20.580145036259065 35.183795948987246 24.60615153788447 19.629907476869217 7 14.575 23.674999999999997 43.15 18.6 8 18.4 25.15 31.225 25.224999999999998 9 18.475 24.125 31.775 25.624999999999996 10-14 20.44 29.099999999999998 26.950000000000003 23.51 15-19 20.185 27.73 28.13 23.955000000000002 20-24 20.419999999999998 28.110000000000003 28.03 23.44 25-29 20.405 28.76 27.41 23.425 30-34 20.44 28.335 27.639999999999997 23.585 35-39 19.98 28.845 27.860000000000003 23.315 40-44 20.419999999999998 28.28 27.625 23.674999999999997 45-49 19.805 28.595 27.779999999999998 23.82 50-54 19.67 28.499999999999996 28.025 23.805 55-59 20.06 27.985 28.185 23.77 60-64 20.419999999999998 28.48 27.775 23.325000000000003 65-69 20.990000000000002 28.035 27.500000000000004 23.474999999999998 70-74 19.650000000000002 28.775000000000002 27.47 24.104999999999997 75-79 20.369999999999997 27.985 27.515 24.13 80-84 20.71 27.91 27.639999999999997 23.74 85-89 20.51 27.925 27.665 23.9 90-94 20.349999999999998 28.185 27.565 23.9 95-99 20.349999999999998 27.650000000000002 27.47 24.529999999999998 100-104 20.47 29.049999999999997 27.245 23.235 105-109 20.53 28.03 27.73 23.71 110-114 20.785 28.645 27.265 23.305 115-119 21.725 28.54 26.21 23.525 120-124 21.205 28.32 26.82 23.655 125-129 21.02 28.384999999999998 27.125 23.47 130-134 21.11 27.72 27.005000000000003 24.165 135-139 21.21 28.194999999999997 26.505000000000003 24.09 140-144 21.505 28.155 26.615 23.724999999999998 145-149 21.5 27.445000000000004 26.939999999999998 24.115000000000002 150-151 22.5 26.775 26.337500000000002 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.5 26 4.0 27 7.0 28 5.5 29 9.5 30 16.0 31 22.0 32 35.0 33 44.5 34 59.0 35 74.0 36 88.0 37 111.0 38 128.0 39 159.0 40 192.5 41 216.0 42 230.5 43 246.0 44 268.0 45 274.0 46 262.5 47 231.5 48 218.0 49 209.0 50 176.5 51 139.0 52 113.5 53 102.5 54 82.0 55 63.0 56 52.5 57 43.5 58 34.5 59 23.5 60 14.5 61 9.0 62 7.0 63 7.0 64 5.0 65 2.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.050000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.22596033140848606 0.44999999999999996 3 0.10042681395932714 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0750000000000002 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.9125 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.375 0.0 0.0 0.0 0.0 116-117 5.0 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 8.025 0.0 0.0 0.0 0.0 128-129 8.825 0.0 0.0 0.0 0.0 130-131 9.462499999999999 0.0 0.0 0.0 0.0 132-133 10.1625 0.0 0.0 0.0 0.0 134-135 10.912500000000001 0.0 0.0 0.0 0.0 136-137 11.5625 0.0 0.0 0.0 0.0 138-139 12.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168836 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168836_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.922 33.0 33.0 34.0 32.0 34.0 2 33.0025 34.0 33.0 34.0 32.0 34.0 3 33.05725 34.0 33.0 34.0 32.0 34.0 4 32.92475 34.0 33.0 34.0 32.0 34.0 5 33.01025 34.0 33.0 34.0 32.0 34.0 6 37.16725 38.0 38.0 38.0 37.0 38.0 7 37.16025 38.0 38.0 38.0 37.0 38.0 8 37.22525 38.0 38.0 38.0 37.0 38.0 9 37.1675 38.0 38.0 38.0 37.0 38.0 10-14 37.19075 38.0 38.0 38.0 37.0 38.0 15-19 37.15645 38.0 38.0 38.0 37.0 38.0 20-24 37.1591 38.0 38.0 38.0 37.0 38.0 25-29 37.1554 38.0 38.0 38.0 37.0 38.0 30-34 37.1262 38.0 38.0 38.0 37.0 38.0 35-39 37.1212 38.0 38.0 38.0 37.0 38.0 40-44 37.0527 38.0 38.0 38.0 36.8 38.0 45-49 36.991550000000004 38.0 38.0 38.0 36.6 38.0 50-54 36.87615 38.0 38.0 38.0 36.0 38.0 55-59 36.86905 38.0 38.0 38.0 36.2 38.0 60-64 36.90245 38.0 38.0 38.0 36.0 38.0 65-69 36.8221 38.0 38.0 38.0 36.0 38.0 70-74 36.70524999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.61750000000001 38.0 38.0 38.0 35.2 38.0 80-84 36.5948 38.0 38.0 38.0 35.2 38.0 85-89 36.396699999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.4149 38.0 38.0 38.0 34.4 38.0 95-99 36.274950000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.0951 38.0 38.0 38.0 33.6 38.0 105-109 35.9274 38.0 38.0 38.0 33.4 38.0 110-114 35.80515 38.0 37.8 38.0 32.6 38.0 115-119 35.74515 38.0 37.6 38.0 32.4 38.0 120-124 35.4145 38.0 37.0 38.0 31.0 38.0 125-129 35.29495000000001 38.0 36.6 38.0 31.0 38.0 130-134 34.71925 38.0 36.0 38.0 26.8 38.0 135-139 34.13395 38.0 34.4 38.0 23.6 38.0 140-144 33.5909 38.0 33.0 38.0 21.0 38.0 145-149 32.357549999999996 38.0 33.0 38.0 8.6 38.0 150-151 27.144 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 2.0 6 1.0 7 1.0 8 3.0 9 0.0 10 0.0 11 0.0 12 2.0 13 6.0 14 2.0 15 2.0 16 6.0 17 9.0 18 3.0 19 6.0 20 9.0 21 8.0 22 15.0 23 27.0 24 14.0 25 17.0 26 19.0 27 19.0 28 40.0 29 40.0 30 33.0 31 52.0 32 74.0 33 90.0 34 148.0 35 239.0 36 548.0 37 2557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.425000000000004 17.775 16.175 28.625 2 27.1 25.074999999999996 32.1 15.725 3 22.05 27.875 29.225 20.849999999999998 4 24.65 34.849999999999994 21.7 18.8 5 24.825 36.75 21.925 16.5 6 19.825 38.6 23.275000000000002 18.3 7 20.1 19.45 40.675 19.775000000000002 8 23.3 23.799999999999997 26.875 26.025 9 22.5 25.074999999999996 29.25 23.175 10-14 23.78 28.689999999999998 26.5 21.029999999999998 15-19 23.54 27.889999999999997 27.744999999999997 20.825 20-24 23.54 28.549999999999997 26.979999999999997 20.93 25-29 23.580000000000002 28.68 27.279999999999998 20.46 30-34 23.125 29.189999999999998 27.529999999999998 20.155 35-39 23.56 27.779999999999998 27.85 20.810000000000002 40-44 23.985 27.939999999999998 27.55 20.525 45-49 23.275000000000002 28.68 27.58 20.465 50-54 22.875 28.625 27.834999999999997 20.665 55-59 23.46 28.22 27.48 20.84 60-64 23.355 28.155 27.439999999999998 21.05 65-69 23.119999999999997 27.51 28.060000000000002 21.310000000000002 70-74 23.494999999999997 27.96 27.439999999999998 21.105 75-79 23.5 27.73 28.494999999999997 20.275000000000002 80-84 23.995 27.805000000000003 27.145000000000003 21.055 85-89 23.895 27.725 27.894999999999996 20.485 90-94 23.815 28.27 27.265 20.65 95-99 23.87 28.025 27.41 20.695 100-104 23.585 27.99 27.534999999999997 20.89 105-109 23.810000000000002 27.860000000000003 28.110000000000003 20.22 110-114 24.39 27.584999999999997 27.85 20.175 115-119 24.565 27.98 27.26 20.195 120-124 24.8 27.42 27.515 20.265 125-129 24.84 28.13 26.61 20.419999999999998 130-134 25.490000000000002 28.01 26.875 19.625 135-139 25.71 27.625 26.834999999999997 19.830000000000002 140-144 25.77 28.215 26.705000000000002 19.31 145-149 26.55 27.99 26.14 19.32 150-151 26.637499999999996 28.4 25.9625 19.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.5 24 1.0 25 2.5 26 3.5 27 4.0 28 4.5 29 9.5 30 12.5 31 17.0 32 31.5 33 39.5 34 50.5 35 61.0 36 78.5 37 106.5 38 134.5 39 162.5 40 198.0 41 224.5 42 233.0 43 259.5 44 276.0 45 267.5 46 264.0 47 239.5 48 227.0 49 216.5 50 165.0 51 138.0 52 129.5 53 109.5 54 89.5 55 62.5 56 40.0 57 37.0 58 29.5 59 20.0 60 14.5 61 8.0 62 9.0 63 7.5 64 2.5 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.2 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3625 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.425 0.0 0.0 0.0 0.0 116-117 5.05 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.725 0.0 0.0 0.0 0.0 124-125 7.449999999999999 0.0 0.0 0.0 0.0 126-127 8.15 0.0 0.0 0.0 0.0 128-129 8.962499999999999 0.0 0.0 0.0 0.0 130-131 9.6 0.0 0.0 0.0 0.0 132-133 10.2875 0.0 0.0 0.0 0.0 134-135 11.0375 0.0 0.0 0.0 0.0 136-137 11.787500000000001 0.0 0.0 0.0 0.0 138-139 12.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGAAA 10 0.006830828 145.0 4 >>END_MODULE Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra Read 1004849 spots for SRR7168836.sra Written 1004849 spots for SRR7168836.sra Read 1004841 spots for SRR7168836.sra Written 1004841 spots for SRR7168836.sra SRR ids: ['SRR7168836.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yakvk0h6 SRR7168836.sra spots: 20096828 blocks: [[1, 1004841], [1004842, 2009682], [2009683, 3014523], [3014524, 4019364], [4019365, 5024205], [5024206, 6029046], [6029047, 7033887], [7033888, 8038728], [8038729, 9043569], [9043570, 10048410], [10048411, 11053251], [11053252, 12058092], [12058093, 13062933], [13062934, 14067774], [14067775, 15072615], [15072616, 16077456], [16077457, 17082297], [17082298, 18087138], [18087139, 19091979], [19091980, 20096828]] SRR7168836 file size 6788455 SRR7168836 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168836 SRR7168836_1.fastq SRR7168836_2.fastq Input file: SRR7168836_1.fastq Paired file: SRR7168836_2.fastq trimmed: SRR7168836-trimmed-pair1.fastq, SRR7168836-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:32:41 2025 >> started Sat Feb 15 04:33:03 2025 >> done (22.303s) 20096828 read pairs processed; of these: 17502 ( 0.09%) short read pairs filtered out after trimming by size control 24717 ( 0.12%) empty read pairs filtered out after trimming by size control 20054609 (99.79%) read pairs available; of these: 11167413 (55.69%) trimmed read pairs available after processing 8887196 (44.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 1 0.00% 21 5 0.00% 22 4 0.00% 23 10 0.00% 24 4 0.00% 25 5 0.00% 26 9 0.00% 27 11 0.00% 28 3 0.00% 29 8 0.00% 30 16 0.00% 31 13 0.00% 32 8 0.00% 33 12 0.00% 34 15 0.00% 35 19 0.00% 36 21 0.00% 37 29 0.00% 38 26 0.00% 39 43 0.00% 40 39 0.00% 41 47 0.00% 42 50 0.00% 43 67 0.00% 44 53 0.00% 45 95 0.00% 46 93 0.00% 47 97 0.00% 48 115 0.00% 49 135 0.00% 50 150 0.00% 51 195 0.00% 52 193 0.00% 53 239 0.00% 54 246 0.00% 55 298 0.00% 56 298 0.00% 57 354 0.00% 58 416 0.00% 59 474 0.00% 60 528 0.00% 61 598 0.00% 62 711 0.00% 63 842 0.00% 64 933 0.00% 65 1061 0.01% 66 1216 0.01% 67 1350 0.01% 68 1513 0.01% 69 2295 0.01% 70 2288 0.01% 71 2233 0.01% 72 2480 0.01% 73 2778 0.01% 74 3133 0.02% 75 3458 0.02% 76 3851 0.02% 77 4282 0.02% 78 4735 0.02% 79 5465 0.03% 80 5890 0.03% 81 6694 0.03% 82 7569 0.04% 83 8495 0.04% 84 10163 0.05% 85 11314 0.06% 86 12101 0.06% 87 13219 0.07% 88 14269 0.07% 89 15386 0.08% 90 16644 0.08% 91 17677 0.09% 92 19162 0.10% 93 21160 0.11% 94 22650 0.11% 95 24286 0.12% 96 25985 0.13% 97 27112 0.14% 98 28331 0.14% 99 29717 0.15% 100 31389 0.16% 101 32754 0.16% 102 34948 0.17% 103 36737 0.18% 104 38831 0.19% 105 40932 0.20% 106 42969 0.21% 107 43930 0.22% 108 45426 0.23% 109 47017 0.23% 110 48486 0.24% 111 50270 0.25% 112 52134 0.26% 113 54305 0.27% 114 57151 0.28% 115 58886 0.29% 116 60680 0.30% 117 62346 0.31% 118 63915 0.32% 119 64674 0.32% 120 66762 0.33% 121 68345 0.34% 122 69405 0.35% 123 72886 0.36% 124 75635 0.38% 125 77715 0.39% 126 81032 0.40% 127 82279 0.41% 128 84549 0.42% 129 86208 0.43% 130 88229 0.44% 131 91533 0.46% 132 93649 0.47% 133 98021 0.49% 134 100505 0.50% 135 105627 0.53% 136 110103 0.55% 137 114006 0.57% 138 119700 0.60% 139 126238 0.63% 140 132899 0.66% 141 142585 0.71% 142 153552 0.77% 143 169753 0.85% 144 192569 0.96% 145 225942 1.13% 146 274907 1.37% 147 362981 1.81% 148 541423 2.70% 149 1040692 5.19% 150 4762403 23.75% 151 8887196 44.31% 20054609 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=0.38 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=233.64 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=20.37 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168836 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:33:56 Started mapping on | Feb 15 04:33:56 Finished on | Feb 15 04:36:07 Mapping speed, Million of reads per hour | 551.12 Number of input reads | 20054609 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18552096 Uniquely mapped reads % | 92.51% Average mapped length | 289.51 Number of splices: Total | 17144015 Number of splices: Annotated (sjdb) | 16722990 Number of splices: GT/AG | 16806308 Number of splices: GC/AG | 266252 Number of splices: AT/AC | 10472 Number of splices: Non-canonical | 60983 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621504 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 260688 % of reads mapped to too many loci | 1.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897807 897807 897807 N_multimapping 621504 621504 621504 N_noFeature 807008 17997746 1189251 N_ambiguous 319348 3353 144385 UnstrandedReadsAssigned:17425740 PositiveStrandReadsAssigned:550997 NegativeStrandReadsAssigned:17218460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168836 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168836-trimmed-pair1.fastq SRR7168836-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,054,609 reads, 17,274,176 reads pseudoaligned [quant] estimated average fragment length: 222.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7168836.ke.tsv 34699 SRR7168836.se.tsv 87100 total ==> SRR7168836.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.91 1305 41.4064 Potri.005G024800.1.v4.1 1035 813.909 878 61.5038 Potri.004G059700.1.v4.1 961 739.951 5 0.385257 Potri.007G009000.2.v4.1 1416 1194.91 0 0 Potri.003G141000.2.v4.1 2943 2721.91 992.37 20.7866 Potri.016G087400.1.v4.1 270 92.3806 1558 961.546 Potri.015G069301.1.v4.1 564 347.371 0 0 Potri.010G195200.1.v4.1 1773 1551.91 453 16.6424 Potri.012G127500.1.v4.1 977 755.93 184 13.8778 ==> SRR7168836.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 702 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 98 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7168836 completed mapping pipeline successfully