Starting /dee2/code/volunteer_pipeline.sh SRR7168837 current disk space = 3092030144512 free memory = 1578839664 SRR7168837 SRAfilesize d57786c8f8e161c45ff6331cc279e858 SRR7168837.sra SRR7168837.sra file validated SRR7168837 is paired end SRR7168837 is conventional basespace SRR7168837 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9775 34.0 33.0 34.0 32.0 34.0 2 33.21125 34.0 33.0 34.0 32.0 34.0 3 33.24475 34.0 33.0 34.0 32.0 34.0 4 33.35 34.0 33.0 34.0 33.0 34.0 5 33.33625 34.0 33.0 34.0 33.0 34.0 6 37.12425 38.0 37.0 38.0 36.0 38.0 7 37.41375 38.0 38.0 38.0 37.0 38.0 8 37.43725 38.0 38.0 38.0 37.0 38.0 9 37.5205 38.0 38.0 38.0 38.0 38.0 10-14 37.534299999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5541 38.0 38.0 38.0 38.0 38.0 20-24 37.5451 38.0 38.0 38.0 37.8 38.0 25-29 37.52285 38.0 38.0 38.0 38.0 38.0 30-34 37.4882 38.0 38.0 38.0 37.8 38.0 35-39 37.480599999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.455850000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.43785 38.0 38.0 38.0 37.0 38.0 50-54 37.3798 38.0 38.0 38.0 37.0 38.0 55-59 37.2716 38.0 38.0 38.0 37.0 38.0 60-64 37.2423 38.0 38.0 38.0 36.8 38.0 65-69 37.19655 38.0 38.0 38.0 36.6 38.0 70-74 37.151149999999994 38.0 38.0 38.0 36.2 38.0 75-79 37.061099999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.989850000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.930400000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.79375 38.0 38.0 38.0 35.0 38.0 95-99 36.7006 38.0 38.0 38.0 35.0 38.0 100-104 36.632349999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.5224 38.0 38.0 38.0 34.0 38.0 110-114 36.300799999999995 38.0 37.8 38.0 33.8 38.0 115-119 36.1197 38.0 37.2 38.0 33.4 38.0 120-124 35.9339 38.0 37.0 38.0 32.8 38.0 125-129 35.611650000000004 38.0 36.4 38.0 31.0 38.0 130-134 35.228500000000004 38.0 35.6 38.0 29.2 38.0 135-139 34.74720000000001 38.0 35.2 38.0 27.8 38.0 140-144 34.29765 38.0 33.4 38.0 26.6 38.0 145-149 33.28855 38.0 33.0 38.0 21.2 38.0 150-151 28.423625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.0 19 3.0 20 2.0 21 7.0 22 5.0 23 8.0 24 8.0 25 16.0 26 7.0 27 16.0 28 26.0 29 27.0 30 36.0 31 39.0 32 65.0 33 99.0 34 133.0 35 273.0 36 721.0 37 2500.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.91208791208791 12.611198325484041 12.009419152276294 37.467294610151754 2 22.280570142535634 17.72943235808952 33.10827706926732 26.881720430107524 3 19.900000000000002 21.875 26.0 32.225 4 21.3 31.3 23.45 23.95 5 21.349999999999998 34.775 24.05 19.825 6 17.875 36.0 26.674999999999997 19.45 7 13.675 26.474999999999998 42.225 17.625 8 17.75 25.674999999999997 31.874999999999996 24.7 9 17.575 24.825 32.675 24.925 10-14 20.27 29.64 27.18 22.91 15-19 19.32 28.910000000000004 28.565 23.205000000000002 20-24 19.994999999999997 28.435 28.384999999999998 23.185 25-29 19.685 28.96 27.73 23.625 30-34 19.39 28.84 27.865000000000002 23.905 35-39 20.06 28.325 27.74 23.875 40-44 20.150000000000002 28.205000000000002 27.99 23.655 45-49 20.235 28.265 27.975 23.525 50-54 19.615 28.235 28.000000000000004 24.15 55-59 20.135 28.03 28.09 23.745 60-64 20.625 28.505000000000003 27.52 23.35 65-69 20.45 28.349999999999998 27.87 23.330000000000002 70-74 20.025000000000002 28.165000000000003 28.03 23.78 75-79 20.41 28.555000000000003 28.134999999999998 22.900000000000002 80-84 20.685000000000002 28.499999999999996 27.6 23.215 85-89 20.32 28.194999999999997 27.389999999999997 24.095 90-94 20.485 28.575 27.495000000000005 23.445 95-99 20.080000000000002 28.225 27.889999999999997 23.805 100-104 20.419999999999998 28.084999999999997 27.825 23.669999999999998 105-109 20.905 28.42 27.639999999999997 23.035 110-114 20.59 27.889999999999997 27.939999999999998 23.580000000000002 115-119 21.175 28.205000000000002 27.255000000000003 23.365 120-124 20.75 28.360000000000003 27.060000000000002 23.830000000000002 125-129 20.94 27.884999999999998 26.729999999999997 24.445 130-134 20.52 29.104999999999997 26.87 23.505000000000003 135-139 21.005 28.970000000000002 26.35 23.674999999999997 140-144 21.01 28.065 26.790000000000003 24.135 145-149 20.655 29.294999999999998 26.135 23.915 150-151 20.1375 27.275 27.675 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 2.5 25 2.5 26 3.5 27 6.5 28 9.5 29 14.0 30 21.0 31 22.5 32 31.0 33 45.5 34 54.5 35 75.0 36 99.0 37 119.0 38 152.0 39 176.0 40 199.5 41 224.0 42 241.5 43 265.0 44 260.0 45 264.0 46 264.0 47 237.5 48 220.0 49 205.0 50 175.5 51 136.0 52 106.5 53 85.0 54 70.0 55 53.5 56 41.5 57 33.0 58 27.5 59 20.5 60 9.0 61 4.5 62 7.0 63 5.0 64 1.0 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.5999999999999996 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 5.074999999999999 0.0 0.0 0.0 0.0 122-123 5.425 0.0 0.0 0.0 0.0 124-125 5.7625 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.3125 0.0 0.0 0.0 0.0 132-133 8.05 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.425 0.0 0.0 0.0 0.0 138-139 10.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACC 10 0.006841402 144.925 7 GGAGCAC 10 0.006841402 144.925 6 >>END_MODULE SRR7168837 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.907 33.0 33.0 34.0 32.0 34.0 2 33.0715 34.0 33.0 34.0 32.0 34.0 3 33.08 34.0 33.0 34.0 33.0 34.0 4 33.018 34.0 33.0 34.0 33.0 34.0 5 33.02 34.0 33.0 34.0 32.0 34.0 6 37.2545 38.0 38.0 38.0 37.0 38.0 7 37.27825 38.0 38.0 38.0 37.0 38.0 8 37.22625 38.0 38.0 38.0 37.0 38.0 9 37.211 38.0 38.0 38.0 37.0 38.0 10-14 37.22005 38.0 38.0 38.0 37.0 38.0 15-19 37.180600000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.12705 38.0 38.0 38.0 37.0 38.0 25-29 37.17835 38.0 38.0 38.0 37.0 38.0 30-34 37.1751 38.0 38.0 38.0 37.0 38.0 35-39 37.168400000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.1481 38.0 38.0 38.0 37.0 38.0 45-49 37.09245 38.0 38.0 38.0 37.0 38.0 50-54 37.0026 38.0 38.0 38.0 37.0 38.0 55-59 36.9751 38.0 38.0 38.0 36.6 38.0 60-64 36.94155 38.0 38.0 38.0 36.6 38.0 65-69 36.88645 38.0 38.0 38.0 36.4 38.0 70-74 36.824799999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.749900000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.6291 38.0 38.0 38.0 35.6 38.0 85-89 36.52195 38.0 38.0 38.0 35.0 38.0 90-94 36.49575 38.0 38.0 38.0 35.0 38.0 95-99 36.4537 38.0 38.0 38.0 35.0 38.0 100-104 36.26305 38.0 38.0 38.0 34.0 38.0 105-109 36.227650000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.143449999999994 38.0 38.0 38.0 34.0 38.0 115-119 35.88195 38.0 38.0 38.0 33.0 38.0 120-124 35.757349999999995 38.0 37.8 38.0 33.0 38.0 125-129 35.41085 38.0 36.8 38.0 31.0 38.0 130-134 35.12885 38.0 36.0 38.0 30.4 38.0 135-139 34.63095 38.0 35.8 38.0 27.6 38.0 140-144 34.213049999999996 38.0 34.4 38.0 26.2 38.0 145-149 33.2898 38.0 33.0 38.0 18.6 38.0 150-151 28.43575 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 3.0 8 3.0 9 3.0 10 2.0 11 5.0 12 4.0 13 6.0 14 2.0 15 6.0 16 3.0 17 5.0 18 8.0 19 8.0 20 3.0 21 7.0 22 9.0 23 9.0 24 16.0 25 18.0 26 20.0 27 22.0 28 22.0 29 27.0 30 32.0 31 47.0 32 43.0 33 83.0 34 108.0 35 220.0 36 570.0 37 2680.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.25 19.325 17.424999999999997 27.0 2 27.025 26.1 30.975 15.9 3 21.475 28.95 30.0 19.575 4 24.6 33.550000000000004 23.05 18.8 5 24.125 38.125 21.75 16.0 6 19.925 37.475 23.95 18.65 7 19.900000000000002 18.6 40.925 20.575 8 23.1 24.825 26.3 25.775 9 21.075 26.75 28.449999999999996 23.724999999999998 10-14 23.785 28.33 26.735 21.15 15-19 22.335 27.865000000000002 28.58 21.22 20-24 22.955000000000002 28.37 27.534999999999997 21.14 25-29 22.955000000000002 28.299999999999997 27.99 20.755000000000003 30-34 23.064999999999998 27.944999999999997 27.72 21.27 35-39 23.205000000000002 28.1 27.97 20.724999999999998 40-44 23.585 27.894999999999996 27.51 21.01 45-49 22.96 28.02 28.285 20.735 50-54 23.05 27.689999999999998 28.384999999999998 20.875 55-59 23.445 27.750000000000004 27.935 20.87 60-64 23.59 27.205000000000002 28.285 20.919999999999998 65-69 23.235 28.335 27.589999999999996 20.84 70-74 24.099999999999998 27.92 27.560000000000002 20.419999999999998 75-79 23.47 27.925 28.134999999999998 20.47 80-84 23.665 28.505000000000003 27.24 20.59 85-89 24.154999999999998 28.050000000000004 27.62 20.175 90-94 23.785 28.144999999999996 27.575 20.495 95-99 23.705000000000002 28.21 27.52 20.565 100-104 23.93 28.439999999999998 27.24 20.39 105-109 23.79 28.54 27.305 20.365 110-114 24.135 28.044999999999998 27.74 20.080000000000002 115-119 24.765 28.175 27.35 19.71 120-124 24.05 28.294999999999998 27.255000000000003 20.4 125-129 24.16 28.26 27.744999999999997 19.835 130-134 25.39 27.93 26.865 19.814999999999998 135-139 25.064999999999998 28.155 27.355 19.425 140-144 25.485000000000003 28.065 27.015 19.435 145-149 25.790000000000003 27.525 26.83 19.855 150-151 26.0125 28.4375 26.6125 18.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.0 22 0.0 23 1.0 24 1.5 25 1.5 26 2.5 27 3.5 28 7.0 29 9.5 30 8.5 31 12.0 32 14.5 33 21.0 34 41.0 35 65.0 36 96.0 37 118.5 38 136.5 39 166.5 40 203.5 41 234.0 42 261.5 43 284.5 44 272.5 45 252.5 46 257.0 47 263.0 48 244.0 49 220.0 50 189.0 51 139.0 52 108.0 53 94.0 54 70.5 55 53.0 56 42.0 57 29.5 58 18.5 59 12.0 60 10.5 61 9.0 62 8.5 63 5.5 64 3.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6811301715438951 1.35 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.2874999999999996 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 5.8625 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.387499999999999 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.7625 0.0 0.0 0.0 0.0 136-137 9.5125 0.0 0.0 0.0 0.0 138-139 10.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATTTG 10 0.006830828 145.0 4 >>END_MODULE Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898929 spots for SRR7168837.sra Written 898929 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra Read 898919 spots for SRR7168837.sra Written 898919 spots for SRR7168837.sra SRR ids: ['SRR7168837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1ffw0kn SRR7168837.sra spots: 17978390 blocks: [[1, 898919], [898920, 1797838], [1797839, 2696757], [2696758, 3595676], [3595677, 4494595], [4494596, 5393514], [5393515, 6292433], [6292434, 7191352], [7191353, 8090271], [8090272, 8989190], [8989191, 9888109], [9888110, 10787028], [10787029, 11685947], [11685948, 12584866], [12584867, 13483785], [13483786, 14382704], [14382705, 15281623], [15281624, 16180542], [16180543, 17079461], [17079462, 17978390]] SRR7168837 file size 6070586 SRR7168837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168837 SRR7168837_1.fastq SRR7168837_2.fastq Input file: SRR7168837_1.fastq Paired file: SRR7168837_2.fastq trimmed: SRR7168837-trimmed-pair1.fastq, SRR7168837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:39:02 2025 >> started Sat Feb 15 05:39:24 2025 >> done (22.288s) 17978390 read pairs processed; of these: 24489 ( 0.14%) short read pairs filtered out after trimming by size control 30595 ( 0.17%) empty read pairs filtered out after trimming by size control 17923306 (99.69%) read pairs available; of these: 9174433 (51.19%) trimmed read pairs available after processing 8748873 (48.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 2 0.00% 23 6 0.00% 24 6 0.00% 25 7 0.00% 26 6 0.00% 27 15 0.00% 28 7 0.00% 29 17 0.00% 30 12 0.00% 31 11 0.00% 32 10 0.00% 33 14 0.00% 34 15 0.00% 35 20 0.00% 36 19 0.00% 37 16 0.00% 38 19 0.00% 39 21 0.00% 40 36 0.00% 41 38 0.00% 42 43 0.00% 43 52 0.00% 44 59 0.00% 45 56 0.00% 46 75 0.00% 47 80 0.00% 48 79 0.00% 49 99 0.00% 50 116 0.00% 51 120 0.00% 52 138 0.00% 53 170 0.00% 54 169 0.00% 55 195 0.00% 56 243 0.00% 57 270 0.00% 58 303 0.00% 59 346 0.00% 60 391 0.00% 61 444 0.00% 62 488 0.00% 63 530 0.00% 64 602 0.00% 65 763 0.00% 66 820 0.00% 67 927 0.01% 68 1294 0.01% 69 3167 0.02% 70 2986 0.02% 71 1835 0.01% 72 1892 0.01% 73 2023 0.01% 74 2297 0.01% 75 2585 0.01% 76 2773 0.02% 77 3094 0.02% 78 3512 0.02% 79 3897 0.02% 80 4408 0.02% 81 4823 0.03% 82 5664 0.03% 83 6295 0.04% 84 7930 0.04% 85 8980 0.05% 86 9502 0.05% 87 10238 0.06% 88 11267 0.06% 89 11967 0.07% 90 12776 0.07% 91 13845 0.08% 92 14831 0.08% 93 16064 0.09% 94 17457 0.10% 95 18577 0.10% 96 19936 0.11% 97 20418 0.11% 98 21430 0.12% 99 22535 0.13% 100 24072 0.13% 101 25465 0.14% 102 26737 0.15% 103 28518 0.16% 104 30486 0.17% 105 31864 0.18% 106 33238 0.19% 107 33997 0.19% 108 35586 0.20% 109 36823 0.21% 110 37669 0.21% 111 39155 0.22% 112 40657 0.23% 113 42606 0.24% 114 44690 0.25% 115 46454 0.26% 116 47862 0.27% 117 49268 0.27% 118 50026 0.28% 119 50966 0.28% 120 52161 0.29% 121 53813 0.30% 122 55516 0.31% 123 58018 0.32% 124 59997 0.33% 125 61768 0.34% 126 64414 0.36% 127 66182 0.37% 128 67071 0.37% 129 69340 0.39% 130 70903 0.40% 131 73091 0.41% 132 75348 0.42% 133 79257 0.44% 134 81518 0.45% 135 85557 0.48% 136 88943 0.50% 137 92256 0.51% 138 97226 0.54% 139 102264 0.57% 140 106627 0.59% 141 114333 0.64% 142 123335 0.69% 143 134837 0.75% 144 152843 0.85% 145 178354 1.00% 146 215889 1.20% 147 281554 1.57% 148 419964 2.34% 149 802495 4.48% 150 4135231 23.07% 151 8748873 48.81% 17923306 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=35.76 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.3 sequence=TCTCATCAAACAT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.8 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=37.66 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168837 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:40:09 Started mapping on | Feb 15 05:40:09 Finished on | Feb 15 05:42:19 Mapping speed, Million of reads per hour | 496.34 Number of input reads | 17923306 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16471790 Uniquely mapped reads % | 91.90% Average mapped length | 290.85 Number of splices: Total | 15049945 Number of splices: Annotated (sjdb) | 14672718 Number of splices: GT/AG | 14745791 Number of splices: GC/AG | 241571 Number of splices: AT/AC | 9026 Number of splices: Non-canonical | 53557 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621144 % of reads mapped to multiple loci | 3.47% Number of reads mapped to too many loci | 72435 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 851588 851588 851588 N_multimapping 621144 621144 621144 N_noFeature 530381 16157167 695796 N_ambiguous 280813 1404 130704 UnstrandedReadsAssigned:15660596 PositiveStrandReadsAssigned:313219 NegativeStrandReadsAssigned:15645290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168837-trimmed-pair1.fastq SRR7168837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,923,306 reads, 15,736,728 reads pseudoaligned [quant] estimated average fragment length: 227.006 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7168837.ke.tsv 34699 SRR7168837.se.tsv 87100 total ==> SRR7168837.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.99 1310 44.7208 Potri.005G024800.1.v4.1 1035 808.994 905 68.4349 Potri.004G059700.1.v4.1 961 735.017 16 1.33167 Potri.007G009000.2.v4.1 1416 1189.99 0 0 Potri.003G141000.2.v4.1 2943 2716.99 744.36 16.7598 Potri.016G087400.1.v4.1 270 89.1358 1231.77 845.382 Potri.015G069301.1.v4.1 564 342.013 0 0 Potri.010G195200.1.v4.1 1773 1546.99 1983.96 78.4546 Potri.012G127500.1.v4.1 977 751.012 119 9.69337 ==> SRR7168837.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 552 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 246 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 8 SRR7168837 completed mapping pipeline successfully