Starting /dee2/code/volunteer_pipeline.sh SRR7168838 current disk space = 3098869026816 free memory = 1446289920 SRR7168838 SRAfilesize fcc2c4e7b98b6f81d462823605e19047 SRR7168838.sra SRR7168838.sra file validated SRR7168838 is paired end SRR7168838 is conventional basespace SRR7168838 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.272 34.0 33.0 34.0 32.0 34.0 2 33.27475 34.0 33.0 34.0 32.0 34.0 3 33.3795 34.0 34.0 34.0 32.0 34.0 4 33.48675 34.0 34.0 34.0 33.0 34.0 5 33.49625 34.0 34.0 34.0 33.0 34.0 6 37.19725 38.0 38.0 38.0 36.0 38.0 7 37.44825 38.0 38.0 38.0 37.0 38.0 8 37.5845 38.0 38.0 38.0 37.0 38.0 9 37.49025 38.0 38.0 38.0 37.0 38.0 10-14 37.5323 38.0 38.0 38.0 37.8 38.0 15-19 37.50905 38.0 38.0 38.0 37.0 38.0 20-24 37.440650000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.42815 38.0 38.0 38.0 37.0 38.0 30-34 37.48235 38.0 38.0 38.0 37.0 38.0 35-39 37.4722 38.0 38.0 38.0 37.0 38.0 40-44 37.40975 38.0 38.0 38.0 37.0 38.0 45-49 37.37565 38.0 38.0 38.0 37.0 38.0 50-54 37.391549999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.3295 38.0 38.0 38.0 37.0 38.0 60-64 37.29255 38.0 38.0 38.0 37.0 38.0 65-69 37.2137 38.0 38.0 38.0 36.6 38.0 70-74 37.15975 38.0 38.0 38.0 36.0 38.0 75-79 37.05165 38.0 38.0 38.0 36.0 38.0 80-84 36.965450000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.916000000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.77975 38.0 38.0 38.0 35.2 38.0 95-99 36.6541 38.0 38.0 38.0 35.0 38.0 100-104 36.58095000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.46825 38.0 38.0 38.0 34.0 38.0 110-114 36.38484999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.193599999999996 38.0 37.6 38.0 33.6 38.0 120-124 35.981300000000005 38.0 37.0 38.0 33.0 38.0 125-129 35.730650000000004 38.0 36.8 38.0 31.8 38.0 130-134 35.33325 38.0 36.0 38.0 30.2 38.0 135-139 35.1124 38.0 36.0 38.0 29.2 38.0 140-144 34.68575 38.0 35.2 38.0 27.8 38.0 145-149 33.943 38.0 33.2 38.0 25.0 38.0 150-151 29.248125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 3.0 17 3.0 18 3.0 19 2.0 20 3.0 21 2.0 22 6.0 23 6.0 24 10.0 25 10.0 26 21.0 27 17.0 28 15.0 29 42.0 30 42.0 31 40.0 32 42.0 33 83.0 34 152.0 35 231.0 36 608.0 37 2655.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.98569570871261 12.431729518855656 10.741222366710012 37.841352405721715 2 22.225 17.45 34.699999999999996 25.624999999999996 3 20.925 20.45 26.450000000000003 32.175 4 22.425 29.575000000000003 23.425 24.575 5 22.486243121560783 34.742371185592795 24.23711855927964 18.534267133566786 6 18.55 34.675 25.874999999999996 20.9 7 14.174999999999999 24.275 43.35 18.2 8 17.65 24.85 31.0 26.5 9 17.7 23.35 35.025 23.925 10-14 20.365 29.294999999999998 26.979999999999997 23.36 15-19 20.580000000000002 28.535 27.49 23.395 20-24 19.785 28.895 28.02 23.3 25-29 20.41 28.43 27.85 23.31 30-34 20.04 28.425 27.900000000000002 23.635 35-39 20.244999999999997 28.54 27.189999999999998 24.025 40-44 19.895 28.67 27.500000000000004 23.935000000000002 45-49 20.294999999999998 28.395 27.445000000000004 23.865 50-54 20.5 28.560000000000002 27.950000000000003 22.99 55-59 20.31 28.035 27.715 23.94 60-64 20.125 28.305000000000003 27.62 23.95 65-69 20.244999999999997 27.900000000000002 28.050000000000004 23.805 70-74 20.119999999999997 28.405 27.644999999999996 23.830000000000002 75-79 19.97 28.560000000000002 27.775 23.695 80-84 20.18 28.435 27.58 23.805 85-89 20.625 28.155 27.49 23.73 90-94 20.580000000000002 28.09 27.529999999999998 23.799999999999997 95-99 20.74 28.199999999999996 27.46 23.599999999999998 100-104 20.785 28.7 26.96 23.555 105-109 20.485 28.705000000000002 26.995 23.815 110-114 21.36 27.894999999999996 27.21 23.535 115-119 21.465 27.900000000000002 27.589999999999996 23.044999999999998 120-124 21.245 28.79 26.39 23.575 125-129 21.495 27.92 26.655 23.93 130-134 21.17 27.815 27.29 23.724999999999998 135-139 21.19 28.055000000000003 26.840000000000003 23.915 140-144 20.84 28.335 27.084999999999997 23.74 145-149 20.8 28.465 26.57 24.165 150-151 21.060549078600978 29.12122351761314 26.26300614266015 23.555221261125737 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 2.5 26 6.0 27 7.5 28 8.0 29 12.5 30 17.0 31 26.5 32 35.0 33 40.0 34 55.0 35 73.5 36 93.0 37 113.5 38 139.0 39 153.0 40 181.0 41 216.0 42 239.5 43 265.5 44 277.5 45 264.5 46 247.0 47 250.5 48 225.0 49 203.5 50 176.5 51 138.0 52 117.0 53 89.0 54 75.0 55 59.5 56 43.0 57 40.0 58 36.5 59 28.0 60 18.5 61 8.0 62 7.0 63 5.5 64 1.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4249999999999998 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.65 0.0 0.0 0.0 0.0 110-111 2.9625000000000004 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 4.1 0.0 0.0 0.0 0.0 118-119 4.675 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.625 0.0 0.0 0.0125 0.0 124-125 5.9125 0.0 0.0 0.025 0.0 126-127 6.325 0.0 0.0 0.025 0.0 128-129 6.85 0.0 0.0 0.025 0.0 130-131 7.3 0.0 0.0 0.025 0.0 132-133 7.875 0.0 0.0 0.025 0.0 134-135 8.45 0.0 0.0 0.025 0.0 136-137 9.025 0.0 0.0 0.025 0.0 138-139 9.787500000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGAT 10 0.006841402 144.925 9 CACCAGT 20 3.595097E-4 108.693756 9 >>END_MODULE SRR7168838 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.748 33.0 33.0 34.0 32.0 34.0 2 32.88725 34.0 33.0 34.0 32.0 34.0 3 32.91925 34.0 33.0 34.0 32.0 34.0 4 32.91325 34.0 33.0 34.0 32.0 34.0 5 32.91775 34.0 33.0 34.0 32.0 34.0 6 37.0815 38.0 38.0 38.0 37.0 38.0 7 37.148 38.0 38.0 38.0 37.0 38.0 8 37.11325 38.0 38.0 38.0 37.0 38.0 9 37.04075 38.0 38.0 38.0 37.0 38.0 10-14 37.08565 38.0 38.0 38.0 36.8 38.0 15-19 37.036500000000004 38.0 38.0 38.0 36.4 38.0 20-24 36.977549999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.90794999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.9342 38.0 38.0 38.0 36.0 38.0 35-39 36.92895 38.0 38.0 38.0 36.0 38.0 40-44 36.8684 38.0 38.0 38.0 36.0 38.0 45-49 36.822700000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.695499999999996 38.0 38.0 38.0 35.4 38.0 55-59 36.5598 38.0 38.0 38.0 34.6 38.0 60-64 36.43065 38.0 38.0 38.0 34.0 38.0 65-69 36.4573 38.0 38.0 38.0 34.2 38.0 70-74 36.3803 38.0 38.0 38.0 34.0 38.0 75-79 36.24400000000001 38.0 38.0 38.0 33.8 38.0 80-84 36.01004999999999 38.0 37.6 38.0 33.4 38.0 85-89 35.6999 38.0 37.2 38.0 31.0 38.0 90-94 35.45335 38.0 37.0 38.0 29.4 38.0 95-99 35.3228 38.0 37.0 38.0 29.0 38.0 100-104 35.14190000000001 38.0 36.4 38.0 28.2 38.0 105-109 34.95455 38.0 36.0 38.0 27.6 38.0 110-114 34.66244999999999 38.0 35.6 38.0 25.8 38.0 115-119 34.199400000000004 38.0 35.0 38.0 23.0 38.0 120-124 33.69395 38.0 34.2 38.0 20.2 38.0 125-129 33.400099999999995 38.0 34.0 38.0 15.0 38.0 130-134 32.5859 38.0 33.0 38.0 14.8 38.0 135-139 31.46015 37.4 31.0 38.0 13.0 38.0 140-144 30.38855 36.2 30.0 38.0 8.6 38.0 145-149 28.64795 36.0 24.4 38.0 2.0 38.0 150-151 22.8385 30.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 5.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 5.0 11 4.0 12 2.0 13 3.0 14 3.0 15 5.0 16 11.0 17 6.0 18 16.0 19 14.0 20 12.0 21 11.0 22 18.0 23 25.0 24 25.0 25 28.0 26 38.0 27 30.0 28 61.0 29 51.0 30 66.0 31 78.0 32 117.0 33 188.0 34 225.0 35 379.0 36 901.0 37 1662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.06106106106106 19.894894894894897 15.89089089089089 28.153153153153156 2 26.57150012521913 26.3961933383421 30.202854996243428 16.829451540195343 3 21.68795391935888 26.947157525669923 30.02754820936639 21.337340345604808 4 23.202204961162614 36.05612628413931 22.174893510398398 18.566775244299674 5 25.269221136989735 35.96293513648885 22.088655146506387 16.679188580015026 6 21.346346346346344 37.03703703703704 22.74774774774775 18.86886886886887 7 19.66966966966967 19.76976976976977 40.61561561561561 19.944944944944947 8 21.22122122122122 25.475475475475474 28.253253253253252 25.05005005005005 9 22.922922922922922 23.323323323323322 29.754754754754753 23.998998998999 10-14 23.242891469763716 29.490388466159388 26.221465758910696 21.0452543051662 15-19 23.16511464904376 28.16161009312106 27.62090717933313 21.052368078502052 20-24 22.509890330011515 28.494165957233715 27.91326556162051 21.082678151134257 25-29 23.144345387158168 28.798958228989278 27.196233597115093 20.860462786737454 30-34 22.766426282051285 28.235176282051285 27.804487179487182 21.193910256410255 35-39 22.985971943887776 27.870741482965933 27.925851703406813 21.217434869739478 40-44 23.525878466312943 28.180999099008908 27.17489238161978 21.118230053058365 45-49 22.532038446135363 28.183820584701643 27.89347216659992 21.390668802563077 50-54 23.10234328059283 28.00420588824354 27.528539955938314 21.364910875225316 55-59 23.594211606829905 27.084272194682292 28.15081868709629 21.170697511391516 60-64 23.11389236545682 27.2090112640801 28.085106382978726 21.591989987484357 65-69 23.034551827741613 28.15723585378067 27.56134201301953 21.246870305458188 70-74 23.64519683461885 27.506761494540722 28.0777321446459 20.77030952619453 75-79 23.443682075424448 27.305053338007713 27.68568137426754 21.565583212300297 80-84 23.51850924209788 28.09197014476782 27.61108049892301 20.778440114211293 85-89 23.75751503006012 28.026052104208414 26.908817635270545 21.30761523046092 90-94 23.94732889400691 27.38697241275722 27.892655084363895 20.773043608871976 95-99 23.60979027979378 27.824215426197508 27.819210170679217 20.746784123329494 100-104 24.421864050455504 27.355090599659626 27.905696265892484 20.317349083992394 105-109 24.296726399038942 27.169886875563122 28.060866953649015 20.472519771748924 110-114 24.097531667751465 27.99279026686026 27.56721574125069 20.342462324137585 115-119 24.212529420601932 27.748009414592616 27.667885222094245 20.371575942711203 120-124 23.96694214876033 27.95391935887804 27.59328825444528 20.485850237916353 125-129 24.188539370867563 28.125626127028653 27.61971548787818 20.066119014225606 130-134 25.31068350370816 27.335137302064545 27.275005011024255 20.079174183203047 135-139 24.603055346857 27.92887553218132 27.24267468069121 20.22539444027047 140-144 24.919887842980174 28.019226917684758 27.1179651512117 19.942920088123373 145-149 25.13890974620814 27.947139210091603 27.15622966411373 19.757721379586524 150-151 26.02825353169146 27.3284160520065 27.903487935992 18.73984248031004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 1.5 25 1.5 26 2.0 27 4.5 28 6.0 29 9.0 30 13.0 31 19.5 32 25.5 33 31.5 34 43.5 35 64.0 36 92.5 37 111.5 38 135.5 39 155.0 40 181.0 41 212.5 42 235.0 43 257.0 44 269.5 45 268.0 46 265.5 47 263.5 48 236.0 49 205.5 50 181.5 51 149.0 52 121.0 53 94.5 54 78.0 55 66.0 56 49.0 57 41.5 58 32.5 59 21.5 60 15.5 61 11.0 62 5.5 63 3.0 64 2.5 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.17500000000000002 4 0.22499999999999998 5 0.17500000000000002 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.12 15-19 0.13 20-24 0.155 25-29 0.16999999999999998 30-34 0.16 35-39 0.2 40-44 0.11 45-49 0.12 50-54 0.13999999999999999 55-59 0.145 60-64 0.125 65-69 0.15 70-74 0.16999999999999998 75-79 0.165 80-84 0.185 85-89 0.2 90-94 0.135 95-99 0.105 100-104 0.11 105-109 0.11 110-114 0.135 115-119 0.155 120-124 0.17500000000000002 125-129 0.18 130-134 0.22 135-139 0.17500000000000002 140-144 0.13999999999999999 145-149 0.11499999999999999 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29328621908127 98.35000000000001 2 0.5300353356890459 1.05 3 0.10095911155981827 0.3 4 0.0757193336698637 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.8624999999999998 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.6375 0.0 0.0 0.0 0.0 120-121 5.074999999999999 0.0 0.0 0.0 0.0 122-123 5.425000000000001 0.0 0.0 0.0 0.0 124-125 5.7 0.0 0.0 0.0 0.0 126-127 6.112500000000001 0.0 0.0 0.0 0.0 128-129 6.65 0.0 0.0 0.0 0.0 130-131 7.1125 0.0 0.0 0.0 0.0 132-133 7.675 0.0 0.0 0.0 0.0 134-135 8.274999999999999 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATCAT 10 0.006830828 145.0 145 >>END_MODULE Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800367 spots for SRR7168838.sra Written 800367 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra Read 800351 spots for SRR7168838.sra Written 800351 spots for SRR7168838.sra SRR ids: ['SRR7168838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8pfjcqio SRR7168838.sra spots: 16007036 blocks: [[1, 800351], [800352, 1600702], [1600703, 2401053], [2401054, 3201404], [3201405, 4001755], [4001756, 4802106], [4802107, 5602457], [5602458, 6402808], [6402809, 7203159], [7203160, 8003510], [8003511, 8803861], [8803862, 9604212], [9604213, 10404563], [10404564, 11204914], [11204915, 12005265], [12005266, 12805616], [12805617, 13605967], [13605968, 14406318], [14406319, 15206669], [15206670, 16007036]] SRR7168838 file size 5402558 SRR7168838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168838 SRR7168838_1.fastq SRR7168838_2.fastq Input file: SRR7168838_1.fastq Paired file: SRR7168838_2.fastq trimmed: SRR7168838-trimmed-pair1.fastq, SRR7168838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 04:24:28 2025 >> started Sat Feb 15 04:24:52 2025 >> done (24.584s) 16007036 read pairs processed; of these: 16770 ( 0.10%) short read pairs filtered out after trimming by size control 36837 ( 0.23%) empty read pairs filtered out after trimming by size control 15953429 (99.67%) read pairs available; of these: 9136056 (57.27%) trimmed read pairs available after processing 6817373 (42.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 9 0.00% 22 1 0.00% 23 9 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 8 0.00% 29 6 0.00% 30 9 0.00% 31 11 0.00% 32 6 0.00% 33 10 0.00% 34 24 0.00% 35 14 0.00% 36 20 0.00% 37 18 0.00% 38 20 0.00% 39 15 0.00% 40 25 0.00% 41 21 0.00% 42 33 0.00% 43 31 0.00% 44 45 0.00% 45 60 0.00% 46 57 0.00% 47 71 0.00% 48 77 0.00% 49 85 0.00% 50 93 0.00% 51 135 0.00% 52 163 0.00% 53 150 0.00% 54 163 0.00% 55 194 0.00% 56 250 0.00% 57 231 0.00% 58 294 0.00% 59 324 0.00% 60 442 0.00% 61 436 0.00% 62 506 0.00% 63 598 0.00% 64 603 0.00% 65 810 0.01% 66 886 0.01% 67 981 0.01% 68 1119 0.01% 69 1572 0.01% 70 1621 0.01% 71 1626 0.01% 72 1851 0.01% 73 1927 0.01% 74 2390 0.01% 75 2570 0.02% 76 2893 0.02% 77 3137 0.02% 78 3493 0.02% 79 3980 0.02% 80 4409 0.03% 81 5085 0.03% 82 5555 0.03% 83 6442 0.04% 84 7586 0.05% 85 8408 0.05% 86 8938 0.06% 87 9516 0.06% 88 10475 0.07% 89 11320 0.07% 90 12123 0.08% 91 13105 0.08% 92 13808 0.09% 93 15261 0.10% 94 16479 0.10% 95 17524 0.11% 96 18387 0.12% 97 19357 0.12% 98 19909 0.12% 99 20731 0.13% 100 22513 0.14% 101 23299 0.15% 102 25016 0.16% 103 26260 0.16% 104 27532 0.17% 105 29056 0.18% 106 30297 0.19% 107 31029 0.19% 108 31847 0.20% 109 33469 0.21% 110 34339 0.22% 111 35643 0.22% 112 37118 0.23% 113 38710 0.24% 114 40209 0.25% 115 42340 0.27% 116 43158 0.27% 117 44609 0.28% 118 45871 0.29% 119 46713 0.29% 120 48316 0.30% 121 50110 0.31% 122 51357 0.32% 123 54423 0.34% 124 56278 0.35% 125 58103 0.36% 126 60467 0.38% 127 62577 0.39% 128 64751 0.41% 129 67229 0.42% 130 69503 0.44% 131 71734 0.45% 132 75314 0.47% 133 77977 0.49% 134 82663 0.52% 135 87541 0.55% 136 92909 0.58% 137 97140 0.61% 138 103312 0.65% 139 110348 0.69% 140 117692 0.74% 141 126899 0.80% 142 140132 0.88% 143 156909 0.98% 144 178429 1.12% 145 209655 1.31% 146 257235 1.61% 147 336880 2.11% 148 489755 3.07% 149 905754 5.68% 150 3805057 23.85% 151 6817373 42.73% 15953429 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=21 prefix-density=0.56 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=425.58 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=53.79 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7168838 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 04:26:12 Started mapping on | Feb 15 04:26:12 Finished on | Feb 15 04:27:53 Mapping speed, Million of reads per hour | 568.64 Number of input reads | 15953429 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14967694 Uniquely mapped reads % | 93.82% Average mapped length | 289.97 Number of splices: Total | 13843167 Number of splices: Annotated (sjdb) | 13555124 Number of splices: GT/AG | 13574222 Number of splices: GC/AG | 224315 Number of splices: AT/AC | 7036 Number of splices: Non-canonical | 37594 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409642 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 40174 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 589590 589590 589590 N_multimapping 409642 409642 409642 N_noFeature 515692 14676905 687714 N_ambiguous 219213 1321 99475 UnstrandedReadsAssigned:14232789 PositiveStrandReadsAssigned:289468 NegativeStrandReadsAssigned:14180505 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168838-trimmed-pair1.fastq SRR7168838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,953,429 reads, 14,202,774 reads pseudoaligned [quant] estimated average fragment length: 229.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7168838.ke.tsv 34699 SRR7168838.se.tsv 87100 total ==> SRR7168838.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.08 671 27.9497 Potri.005G024800.1.v4.1 1035 806.08 118 10.9091 Potri.004G059700.1.v4.1 961 732.131 32 3.2572 Potri.007G009000.2.v4.1 1416 1187.08 0 0 Potri.003G141000.2.v4.1 2943 2714.08 640.31 17.5813 Potri.016G087400.1.v4.1 270 89.3943 818 681.91 Potri.015G069301.1.v4.1 564 340.062 0 0 Potri.010G195200.1.v4.1 1773 1544.08 67 3.23362 Potri.012G127500.1.v4.1 977 748.121 232 23.11 ==> SRR7168838.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 529 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 61 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168838 completed mapping pipeline successfully