Starting /dee2/code/volunteer_pipeline.sh SRR7168839 current disk space = 3094799073280 free memory = 1464410744 SRR7168839 SRAfilesize 968779cca197a6b78f4148441620452f SRR7168839.sra SRR7168839.sra file validated SRR7168839 is paired end SRR7168839 is conventional basespace SRR7168839 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.378 34.0 33.0 34.0 32.0 34.0 2 33.2155 34.0 33.0 34.0 32.0 34.0 3 33.1485 34.0 33.0 34.0 31.0 34.0 4 33.2685 34.0 33.0 34.0 33.0 34.0 5 33.36325 34.0 33.0 34.0 33.0 34.0 6 36.9635 38.0 37.0 38.0 35.0 38.0 7 37.27425 38.0 38.0 38.0 37.0 38.0 8 37.38975 38.0 38.0 38.0 37.0 38.0 9 37.47675 38.0 38.0 38.0 37.0 38.0 10-14 37.4987 38.0 38.0 38.0 37.6 38.0 15-19 37.50525 38.0 38.0 38.0 37.6 38.0 20-24 37.3977 38.0 38.0 38.0 37.0 38.0 25-29 37.3724 38.0 38.0 38.0 37.0 38.0 30-34 37.39875000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.352850000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.263 38.0 38.0 38.0 37.0 38.0 45-49 37.2548 38.0 38.0 38.0 36.8 38.0 50-54 37.1969 38.0 38.0 38.0 36.6 38.0 55-59 37.132250000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.0438 38.0 38.0 38.0 36.0 38.0 65-69 37.08669999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8898 38.0 38.0 38.0 35.8 38.0 75-79 36.712 38.0 38.0 38.0 35.0 38.0 80-84 36.588800000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.58175 38.0 38.0 38.0 34.6 38.0 90-94 36.43325 38.0 38.0 38.0 34.2 38.0 95-99 36.2506 38.0 38.0 38.0 34.0 38.0 100-104 36.211149999999996 38.0 37.4 38.0 33.8 38.0 105-109 36.0329 38.0 37.0 38.0 33.0 38.0 110-114 35.742599999999996 38.0 37.0 38.0 31.8 38.0 115-119 35.64235 38.0 36.8 38.0 31.4 38.0 120-124 35.3345 38.0 36.0 38.0 30.2 38.0 125-129 35.03855 38.0 35.6 38.0 28.4 38.0 130-134 34.69715 38.0 35.0 38.0 27.2 38.0 135-139 34.30655 38.0 34.6 38.0 24.0 38.0 140-144 33.7487 38.0 33.8 38.0 22.2 38.0 145-149 32.6594 38.0 33.0 38.0 15.2 38.0 150-151 28.076375 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 2.0 17 4.0 18 9.0 19 7.0 20 2.0 21 1.0 22 11.0 23 8.0 24 13.0 25 18.0 26 18.0 27 28.0 28 29.0 29 37.0 30 36.0 31 47.0 32 80.0 33 115.0 34 176.0 35 308.0 36 783.0 37 2262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.30967741935484 12.103225806451613 12.0 35.58709677419355 2 22.45 16.85 32.375 28.325 3 21.3 21.975 25.75 30.975 4 24.575 29.7 21.125 24.6 5 24.175 31.825 23.95 20.05 6 18.625 35.125 25.35 20.9 7 14.774999999999999 25.724999999999998 41.8 17.7 8 18.575 25.674999999999997 30.4 25.35 9 17.9 25.324999999999996 32.725 24.05 10-14 20.53 29.095 26.815 23.56 15-19 20.49 27.73 27.495000000000005 24.285 20-24 19.85 27.625 28.175 24.349999999999998 25-29 20.01 27.800000000000004 28.144999999999996 24.044999999999998 30-34 20.29 27.47 27.58 24.66 35-39 20.835 28.16 27.045 23.96 40-44 20.31 28.74 27.215 23.735 45-49 20.375 27.52 27.785 24.32 50-54 20.375 27.85 27.150000000000002 24.625 55-59 20.49 27.755000000000003 27.525 24.23 60-64 20.765 27.735 27.150000000000002 24.349999999999998 65-69 20.23 27.839999999999996 27.115000000000002 24.815 70-74 20.825 29.060000000000002 26.655 23.46 75-79 20.775 27.57 27.325 24.33 80-84 20.875 27.42 27.655 24.05 85-89 20.845 27.765 27.36 24.03 90-94 20.465 27.675 27.36 24.5 95-99 21.255 27.405 27.325 24.015 100-104 20.855 27.87 27.1 24.175 105-109 20.615 28.04 26.935 24.41 110-114 21.0 27.82 26.529999999999998 24.65 115-119 21.33 27.544999999999998 26.905 24.22 120-124 21.38 28.01 26.345000000000002 24.265 125-129 21.415 28.125 26.405 24.055 130-134 21.37 28.005000000000003 26.325 24.3 135-139 21.605 28.144999999999996 26.090000000000003 24.16 140-144 21.3 27.425 26.369999999999997 24.905 145-149 21.135 28.515 26.06 24.29 150-151 22.428732889614466 28.544518397588845 25.379881954037426 23.64686675875926 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 3.0 25 2.0 26 4.0 27 7.5 28 12.0 29 13.0 30 15.5 31 19.5 32 28.5 33 36.5 34 43.5 35 59.0 36 73.5 37 96.5 38 123.0 39 146.0 40 150.5 41 178.0 42 232.0 43 257.5 44 255.0 45 246.5 46 250.0 47 262.5 48 246.0 49 208.5 50 183.5 51 155.5 52 142.5 53 121.0 54 93.0 55 78.5 56 58.0 57 45.5 58 40.5 59 31.0 60 21.0 61 15.5 62 12.0 63 8.0 64 4.0 65 4.0 66 4.0 67 2.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.46249999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19089759797724 98.075 2 0.7838179519595448 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGC 15 0.375 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.025 0.0 0.0 0.0 0.0 110-111 3.3625 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.225 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.375 0.0 0.0 0.0 0.0 122-123 5.800000000000001 0.0 0.0 0.0 0.0 124-125 6.25 0.0 0.0 0.0 0.0 126-127 6.8 0.0 0.0 0.0 0.0 128-129 7.375 0.0 0.0 0.0 0.0 130-131 7.9875 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 10.025 0.0 0.0 0.0 0.0 138-139 10.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168839 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168839_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1655 33.0 30.0 33.0 18.0 33.0 2 30.4835 33.0 31.0 33.0 18.0 34.0 3 30.56775 33.0 31.0 33.0 18.0 34.0 4 30.213 33.0 31.0 33.0 15.0 34.0 5 30.3295 33.0 31.0 33.0 15.0 34.0 6 34.00975 38.0 34.0 38.0 16.0 38.0 7 34.1235 38.0 34.0 38.0 26.0 38.0 8 34.1385 38.0 34.0 38.0 26.0 38.0 9 34.07225 38.0 34.0 38.0 26.0 38.0 10-14 33.954699999999995 38.0 34.0 38.0 19.8 38.0 15-19 33.75005 38.0 33.8 38.0 16.0 38.0 20-24 33.519 38.0 33.2 38.0 16.0 38.0 25-29 33.4496 38.0 33.4 38.0 16.0 38.0 30-34 32.871649999999995 37.0 31.4 38.0 16.0 38.0 35-39 32.89 37.0 31.4 38.0 16.0 38.0 40-44 32.8511 37.0 31.4 38.0 16.0 38.0 45-49 32.673199999999994 37.0 31.0 38.0 16.0 38.0 50-54 32.4336 37.0 30.2 38.0 16.0 38.0 55-59 32.0089 37.0 29.0 38.0 16.0 38.0 60-64 32.0138 37.0 29.0 38.0 16.0 38.0 65-69 31.821499999999997 37.0 29.0 38.0 16.0 38.0 70-74 31.54095 36.6 29.0 38.0 16.0 38.0 75-79 31.14275 36.0 28.4 38.0 15.4 38.0 80-84 30.5086 36.0 27.2 38.0 15.0 38.0 85-89 30.0968 35.8 26.2 38.0 15.0 38.0 90-94 29.61065 35.0 24.8 38.0 15.0 38.0 95-99 29.05405 34.4 23.4 38.0 14.0 38.0 100-104 28.554750000000002 34.0 19.4 38.0 13.6 38.0 105-109 27.76445 34.0 15.0 37.8 8.6 38.0 110-114 27.0902 34.0 15.0 37.6 2.0 38.0 115-119 26.34315 33.2 15.0 37.0 2.0 38.0 120-124 25.127249999999997 31.4 14.6 37.0 2.0 38.0 125-129 23.56275 28.2 13.4 36.0 2.0 38.0 130-134 22.1457 26.0 6.4 35.4 2.0 38.0 135-139 20.372500000000002 22.8 2.0 34.4 2.0 38.0 140-144 18.182650000000002 15.4 2.0 33.0 2.0 38.0 145-149 15.447049999999999 6.4 2.0 32.2 2.0 38.0 150-151 11.5325 2.0 2.0 26.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 17.0 4 6.0 5 7.0 6 14.0 7 10.0 8 10.0 9 11.0 10 13.0 11 18.0 12 30.0 13 27.0 14 35.0 15 41.0 16 42.0 17 58.0 18 63.0 19 59.0 20 69.0 21 82.0 22 96.0 23 104.0 24 96.0 25 121.0 26 120.0 27 161.0 28 174.0 29 217.0 30 232.0 31 240.0 32 299.0 33 341.0 34 404.0 35 382.0 36 296.0 37 68.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.975 19.3 17.474999999999998 24.25 2 26.845133850387793 25.869402051538653 28.821616212159118 18.463847885914436 3 23.103879849812266 28.1351689612015 29.386733416770966 19.374217772215268 4 25.63845768652979 33.37506259389084 21.28192288432649 19.70455683525288 5 24.380475594493117 35.66958698372966 21.97747183979975 17.972465581977474 6 21.1408556417313 35.30147610708031 23.592694520890667 19.96497373029772 7 21.446446446446448 21.32132132132132 37.33733733733734 19.894894894894897 8 21.727158948685858 24.53066332916145 27.584480600750936 26.157697121401753 9 22.266700025018764 24.718538904178132 29.697272954716038 23.317488116087066 10-14 23.925121377446317 28.394814555283048 25.621902998148055 22.05816106912258 15-19 23.734921667751138 27.939336303118274 26.953300966014314 21.37244106311627 20-24 24.170046567522906 27.910470181763557 26.593560662961295 21.325922587752242 25-29 23.6469233465178 28.453412106343563 26.29049216442197 21.609172382716668 30-34 23.925888833249875 28.177265898848276 26.885327991987985 21.01151727591387 35-39 24.2663995993991 28.462694041061592 26.10916374561843 21.161742613920882 40-44 23.973562988183456 28.219507310234327 26.937712797917087 20.86921690366513 45-49 24.010012515644554 27.739674593241553 27.128911138923655 21.121401752190238 50-54 23.739674593241553 28.315394242803503 26.423028785982478 21.521902377972467 55-59 24.062672072883817 27.837012564449115 27.06112028833158 21.03919507433549 60-64 23.852660027025674 27.82643511335769 27.20584555327561 21.115059306341024 65-69 24.103745243340676 27.8840376527138 27.193070298417787 20.819146805527737 70-74 24.044865054328778 28.461268839817738 26.54348805768364 20.950378048169846 75-79 23.851006308200663 28.03144087313508 27.055171723240214 21.06238109542405 80-84 24.068509615384613 27.819511217948715 26.111778846153843 22.000200320512818 85-89 23.990986479719577 28.337506259389084 26.14922383575363 21.522283425137704 90-94 24.197666850247835 28.698743303459672 26.48575577028989 20.6178340760026 95-99 24.278064160952905 28.0416395575797 26.820479455482708 20.859816825984687 100-104 24.526884950435566 28.06147992390107 26.82987884249524 20.58175628316812 105-109 24.24803563385216 28.0416395575797 27.035683899704722 20.67464090886342 110-114 24.338121215154395 28.376958110204693 26.47515139382413 20.809769280816777 115-119 25.00500700981374 28.33967554576407 26.226717404366113 20.42860004005608 120-124 24.717075613420132 28.567851777666498 25.933900851276913 20.781171757636454 125-129 25.425595834167837 29.17584618465852 25.160224314039652 20.238333667133986 130-134 25.48076923076923 29.00641025641026 25.545873397435898 19.966947115384613 135-139 25.648472709063597 29.063595393089635 25.087631447170754 20.200300450676014 140-144 25.903312981683513 29.191272144930437 24.977479731758585 19.927935141627465 145-149 26.20907179333133 29.46830880144187 24.451787323520577 19.87083208170622 150-151 25.924999999999997 29.95 24.9125 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 0.5 24 2.5 25 4.0 26 4.0 27 4.0 28 2.5 29 3.0 30 9.0 31 12.5 32 12.5 33 25.5 34 37.5 35 48.0 36 65.5 37 82.5 38 112.5 39 148.0 40 176.0 41 207.0 42 235.5 43 255.5 44 252.0 45 252.0 46 260.0 47 273.5 48 255.0 49 206.0 50 194.5 51 175.0 52 133.5 53 109.5 54 103.0 55 86.0 56 61.0 57 43.0 58 38.0 59 30.5 60 18.0 61 13.0 62 9.5 63 7.5 64 7.5 65 5.0 66 2.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.125 4 0.15 5 0.125 6 0.075 7 0.1 8 0.125 9 0.075 10-14 0.105 15-19 0.105 20-24 0.145 25-29 0.135 30-34 0.15 35-39 0.15 40-44 0.13999999999999999 45-49 0.125 50-54 0.125 55-59 0.11499999999999999 60-64 0.095 65-69 0.13999999999999999 70-74 0.145 75-79 0.13 80-84 0.16 85-89 0.15 90-94 0.135 95-99 0.095 100-104 0.13 105-109 0.095 110-114 0.095 115-119 0.13999999999999999 120-124 0.15 125-129 0.13999999999999999 130-134 0.16 135-139 0.15 140-144 0.09 145-149 0.13 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.7325082091437232 1.4500000000000002 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 2.9749999999999996 0.0 0.0 0.0 0.0 112-113 3.3375 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.4625 0.0 0.0 0.0 0.0 120-121 4.8375 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.075 0.0 0.0 0.0 0.0 136-137 8.65 0.0 0.0 0.0 0.0 138-139 9.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAAA 10 0.006830828 145.0 1 ATTAAAA 10 0.006830828 145.0 6 TACTTCA 10 0.006830828 145.0 3 >>END_MODULE Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725046 spots for SRR7168839.sra Written 725046 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra Read 725044 spots for SRR7168839.sra Written 725044 spots for SRR7168839.sra SRR ids: ['SRR7168839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hriuey8g SRR7168839.sra spots: 14500882 blocks: [[1, 725044], [725045, 1450088], [1450089, 2175132], [2175133, 2900176], [2900177, 3625220], [3625221, 4350264], [4350265, 5075308], [5075309, 5800352], [5800353, 6525396], [6525397, 7250440], [7250441, 7975484], [7975485, 8700528], [8700529, 9425572], [9425573, 10150616], [10150617, 10875660], [10875661, 11600704], [11600705, 12325748], [12325749, 13050792], [13050793, 13775836], [13775837, 14500882]] SRR7168839 file size 4892172 SRR7168839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168839 SRR7168839_1.fastq SRR7168839_2.fastq Input file: SRR7168839_1.fastq Paired file: SRR7168839_2.fastq trimmed: SRR7168839-trimmed-pair1.fastq, SRR7168839-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:05:51 2025 >> started Sat Feb 15 05:06:09 2025 >> done (18.508s) 14500882 read pairs processed; of these: 61641 ( 0.43%) short read pairs filtered out after trimming by size control 118420 ( 0.82%) empty read pairs filtered out after trimming by size control 14320821 (98.76%) read pairs available; of these: 10991243 (76.75%) trimmed read pairs available after processing 3329578 (23.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 9 0.00% 21 5 0.00% 22 8 0.00% 23 5 0.00% 24 13 0.00% 25 13 0.00% 26 8 0.00% 27 15 0.00% 28 21 0.00% 29 14 0.00% 30 22 0.00% 31 22 0.00% 32 22 0.00% 33 42 0.00% 34 39 0.00% 35 41 0.00% 36 41 0.00% 37 46 0.00% 38 48 0.00% 39 56 0.00% 40 61 0.00% 41 83 0.00% 42 86 0.00% 43 107 0.00% 44 84 0.00% 45 144 0.00% 46 165 0.00% 47 217 0.00% 48 331 0.00% 49 348 0.00% 50 269 0.00% 51 294 0.00% 52 331 0.00% 53 338 0.00% 54 347 0.00% 55 375 0.00% 56 452 0.00% 57 449 0.00% 58 459 0.00% 59 523 0.00% 60 603 0.00% 61 672 0.00% 62 721 0.01% 63 820 0.01% 64 955 0.01% 65 1081 0.01% 66 1156 0.01% 67 1325 0.01% 68 1815 0.01% 69 3111 0.02% 70 2973 0.02% 71 2489 0.02% 72 2419 0.02% 73 2741 0.02% 74 2927 0.02% 75 3296 0.02% 76 3596 0.03% 77 3972 0.03% 78 4456 0.03% 79 4778 0.03% 80 5390 0.04% 81 6223 0.04% 82 6884 0.05% 83 8235 0.06% 84 11026 0.08% 85 12872 0.09% 86 13265 0.09% 87 13908 0.10% 88 14333 0.10% 89 15465 0.11% 90 16297 0.11% 91 17056 0.12% 92 18136 0.13% 93 19836 0.14% 94 21114 0.15% 95 22231 0.16% 96 23238 0.16% 97 24531 0.17% 98 25540 0.18% 99 26576 0.19% 100 28204 0.20% 101 29308 0.20% 102 31481 0.22% 103 33329 0.23% 104 35106 0.25% 105 37305 0.26% 106 38758 0.27% 107 39613 0.28% 108 41644 0.29% 109 43910 0.31% 110 45811 0.32% 111 47462 0.33% 112 49911 0.35% 113 52934 0.37% 114 55003 0.38% 115 58433 0.41% 116 61532 0.43% 117 63352 0.44% 118 65518 0.46% 119 68654 0.48% 120 71580 0.50% 121 74580 0.52% 122 78716 0.55% 123 83402 0.58% 124 87858 0.61% 125 92289 0.64% 126 97064 0.68% 127 103038 0.72% 128 108400 0.76% 129 114026 0.80% 130 120280 0.84% 131 126761 0.89% 132 133908 0.94% 133 143420 1.00% 134 153298 1.07% 135 163767 1.14% 136 174347 1.22% 137 186238 1.30% 138 198788 1.39% 139 211359 1.48% 140 225913 1.58% 141 242548 1.69% 142 261937 1.83% 143 289775 2.02% 144 328173 2.29% 145 371856 2.60% 146 440584 3.08% 147 549626 3.84% 148 721170 5.04% 149 1111615 7.76% 150 2623636 18.32% 151 3329578 23.25% 14320821 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=17 prefix-density=0.70 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=163.35 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.55 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=38.95 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7168839 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:06:59 Started mapping on | Feb 15 05:06:59 Finished on | Feb 15 05:08:57 Mapping speed, Million of reads per hour | 436.91 Number of input reads | 14320821 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 13090397 Uniquely mapped reads % | 91.41% Average mapped length | 282.73 Number of splices: Total | 12061482 Number of splices: Annotated (sjdb) | 11822567 Number of splices: GT/AG | 11819339 Number of splices: GC/AG | 203251 Number of splices: AT/AC | 6499 Number of splices: Non-canonical | 32393 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364867 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 135828 % of reads mapped to too many loci | 0.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 915136 915136 915136 N_multimapping 364867 364867 364867 N_noFeature 367238 12835220 481730 N_ambiguous 229777 1033 88465 UnstrandedReadsAssigned:12493382 PositiveStrandReadsAssigned:254144 NegativeStrandReadsAssigned:12520202 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168839 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168839-trimmed-pair1.fastq SRR7168839-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,320,821 reads, 12,701,596 reads pseudoaligned [quant] estimated average fragment length: 217.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7168839.ke.tsv 34699 SRR7168839.se.tsv 87100 total ==> SRR7168839.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.63 716 28.2274 Potri.005G024800.1.v4.1 1035 818.63 344 29.8466 Potri.004G059700.1.v4.1 961 744.652 30 2.86149 Potri.007G009000.2.v4.1 1416 1199.63 0 0 Potri.003G141000.2.v4.1 2943 2726.63 759.496 19.7844 Potri.016G087400.1.v4.1 270 90.9499 737 575.558 Potri.015G069301.1.v4.1 564 349.861 0 0 Potri.010G195200.1.v4.1 1773 1556.63 62 2.82898 Potri.012G127500.1.v4.1 977 760.636 93 8.6842 ==> SRR7168839.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 614 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7168839 completed mapping pipeline successfully