Starting /dee2/code/volunteer_pipeline.sh SRR7168840 current disk space = 3092692041728 free memory = 1581824976 SRR7168840 SRAfilesize 6db0c19488c49831506b29ef12537b4d SRR7168840.sra SRR7168840.sra file validated SRR7168840 is paired end SRR7168840 is conventional basespace SRR7168840 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4325 34.0 34.0 34.0 33.0 34.0 2 33.39475 34.0 34.0 34.0 33.0 34.0 3 33.493 34.0 34.0 34.0 33.0 34.0 4 33.56775 34.0 34.0 34.0 33.0 34.0 5 33.58375 34.0 34.0 34.0 33.0 34.0 6 37.39 38.0 38.0 38.0 37.0 38.0 7 37.56775 38.0 38.0 38.0 37.0 38.0 8 37.6175 38.0 38.0 38.0 38.0 38.0 9 37.595 38.0 38.0 38.0 38.0 38.0 10-14 37.679950000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.648849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.60074999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.58885 38.0 38.0 38.0 38.0 38.0 30-34 37.5789 38.0 38.0 38.0 38.0 38.0 35-39 37.5762 38.0 38.0 38.0 38.0 38.0 40-44 37.58375 38.0 38.0 38.0 38.0 38.0 45-49 37.5218 38.0 38.0 38.0 37.8 38.0 50-54 37.4914 38.0 38.0 38.0 37.8 38.0 55-59 37.3962 38.0 38.0 38.0 37.0 38.0 60-64 37.407 38.0 38.0 38.0 37.0 38.0 65-69 37.3706 38.0 38.0 38.0 37.0 38.0 70-74 37.31145 38.0 38.0 38.0 37.0 38.0 75-79 37.2179 38.0 38.0 38.0 36.6 38.0 80-84 37.13635000000001 38.0 38.0 38.0 36.2 38.0 85-89 37.072599999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.9545 38.0 38.0 38.0 36.0 38.0 95-99 36.833600000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.77505 38.0 38.0 38.0 35.0 38.0 105-109 36.652100000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.5267 38.0 38.0 38.0 34.0 38.0 115-119 36.33325000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.09305 38.0 37.6 38.0 33.6 38.0 125-129 35.73530000000001 38.0 37.0 38.0 31.8 38.0 130-134 35.446299999999994 38.0 36.0 38.0 30.6 38.0 135-139 35.06765 38.0 36.0 38.0 29.4 38.0 140-144 34.6273 38.0 35.0 38.0 28.2 38.0 145-149 33.87175 38.0 33.0 38.0 24.4 38.0 150-151 29.460875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 4.0 20 3.0 21 5.0 22 4.0 23 5.0 24 3.0 25 11.0 26 18.0 27 13.0 28 24.0 29 24.0 30 33.0 31 44.0 32 57.0 33 85.0 34 109.0 35 200.0 36 575.0 37 2777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.3868537282411 13.977656534164717 11.665367627955312 34.970122109638865 2 23.825 18.0 33.5 24.675 3 19.875 24.925 27.025 28.175 4 21.875 32.625 22.225 23.275000000000002 5 20.730182545636406 35.43385846461615 24.63115778944736 19.204801200300075 6 18.25 35.775 26.125 19.85 7 15.725 22.650000000000002 43.6 18.025 8 17.849999999999998 24.65 30.425 27.075 9 17.525 25.2 33.300000000000004 23.974999999999998 10-14 20.345 29.520000000000003 26.465 23.669999999999998 15-19 19.919999999999998 27.794999999999998 28.455000000000002 23.830000000000002 20-24 19.71 28.9 28.275 23.115 25-29 19.72 28.83 27.939999999999998 23.51 30-34 19.613922784556912 28.74574914982996 28.14062812562512 23.499699939987998 35-39 19.505975298764938 28.626431321566077 28.346417320866042 23.52117605880294 40-44 19.84 28.92 28.035 23.205000000000002 45-49 20.11 28.439999999999998 27.985 23.465 50-54 19.89 29.18 27.72 23.21 55-59 20.265 28.62 27.735 23.380000000000003 60-64 19.98 28.665000000000003 28.215 23.14 65-69 20.355 28.439999999999998 28.084999999999997 23.119999999999997 70-74 20.23 28.845 27.525 23.400000000000002 75-79 20.055 28.83 27.49 23.625 80-84 20.05 28.73 27.615000000000002 23.605 85-89 20.155 28.610000000000003 27.98 23.255 90-94 19.785 29.025000000000002 27.595 23.595 95-99 20.005 28.754999999999995 27.529999999999998 23.71 100-104 20.22 28.849999999999998 28.01 22.919999999999998 105-109 20.14 28.660000000000004 27.495000000000005 23.705000000000002 110-114 20.555 28.28 27.57 23.595 115-119 19.855 28.84 27.77 23.535 120-124 19.955000000000002 28.375 27.71 23.96 125-129 20.32 28.93 27.150000000000002 23.599999999999998 130-134 20.685000000000002 28.7 27.13 23.485 135-139 20.28 29.03 26.865 23.825 140-144 20.495 28.42 27.265 23.82 145-149 19.99 28.79 27.435 23.785 150-151 21.151911468812877 28.445674044265594 27.263581488933603 23.138832997987926 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 3.0 24 3.5 25 2.5 26 4.5 27 7.5 28 9.5 29 14.0 30 20.0 31 36.0 32 45.0 33 48.5 34 63.0 35 82.5 36 99.0 37 120.0 38 154.5 39 167.0 40 179.5 41 212.5 42 240.5 43 271.0 44 279.0 45 262.5 46 257.0 47 246.5 48 230.5 49 206.5 50 162.5 51 121.0 52 101.5 53 85.5 54 61.0 55 44.0 56 43.5 57 36.5 58 23.0 59 17.5 60 11.0 61 8.0 62 5.5 63 3.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.175 0.0 0.0 0.025 0.0 82-83 0.2 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.2875 0.0 0.0 0.025 0.0 88-89 0.32499999999999996 0.0 0.0 0.025 0.0 90-91 0.4375 0.0 0.0 0.025 0.0 92-93 0.5625 0.0 0.0 0.025 0.0 94-95 0.725 0.0 0.0 0.025 0.0 96-97 0.9125 0.0 0.0 0.025 0.0 98-99 1.0125 0.0 0.0 0.025 0.0 100-101 1.2 0.0 0.0 0.025 0.0 102-103 1.375 0.0 0.0 0.025 0.0 104-105 1.7125 0.0 0.0 0.025 0.0 106-107 1.95 0.0 0.0 0.025 0.0 108-109 2.2125 0.0 0.0 0.025 0.0 110-111 2.4375 0.0 0.0 0.025 0.0 112-113 2.7874999999999996 0.0 0.0 0.025 0.0 114-115 3.125 0.0 0.0 0.025 0.0 116-117 3.425 0.0 0.0 0.025 0.0 118-119 3.8875 0.0 0.0 0.025 0.0 120-121 4.2625 0.0 0.0 0.025 0.0 122-123 4.65 0.0 0.0 0.025 0.0 124-125 5.3625 0.0 0.0 0.025 0.0 126-127 6.1375 0.0 0.0 0.025 0.0 128-129 6.574999999999999 0.0 0.0 0.025 0.0 130-131 7.15 0.0 0.0 0.025 0.0 132-133 7.575 0.0 0.0 0.025 0.0 134-135 8.2375 0.0 0.0 0.025 0.0 136-137 8.7 0.0 0.0 0.025 0.0 138-139 9.25 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTATG 10 0.006331531 148.67949 1 AATCATG 10 0.006836113 144.9625 3 TCGGCTG 10 0.006836113 144.9625 7 CTTGATC 10 0.006836113 144.9625 2 AAAAAAA 20 0.005942617 28.992498 105-109 TTTTTTT 160 3.9646777E-4 9.060156 105-109 >>END_MODULE SRR7168840 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168840_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08125 33.0 33.0 34.0 32.0 34.0 2 33.195 34.0 33.0 34.0 33.0 34.0 3 33.197 34.0 33.0 34.0 33.0 34.0 4 33.244 34.0 33.0 34.0 33.0 34.0 5 33.243 34.0 33.0 34.0 33.0 34.0 6 37.35925 38.0 38.0 38.0 38.0 38.0 7 37.357 38.0 38.0 38.0 38.0 38.0 8 37.29725 38.0 38.0 38.0 38.0 38.0 9 37.32875 38.0 38.0 38.0 38.0 38.0 10-14 37.33995 38.0 38.0 38.0 38.0 38.0 15-19 37.3176 38.0 38.0 38.0 38.0 38.0 20-24 37.3118 38.0 38.0 38.0 38.0 38.0 25-29 37.285450000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.29885 38.0 38.0 38.0 38.0 38.0 35-39 37.27805 38.0 38.0 38.0 38.0 38.0 40-44 37.30735 38.0 38.0 38.0 38.0 38.0 45-49 37.27015 38.0 38.0 38.0 38.0 38.0 50-54 37.20895 38.0 38.0 38.0 37.2 38.0 55-59 37.18580000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.1259 38.0 38.0 38.0 37.0 38.0 65-69 37.07695 38.0 38.0 38.0 37.0 38.0 70-74 37.006099999999996 38.0 38.0 38.0 37.0 38.0 75-79 36.9798 38.0 38.0 38.0 36.8 38.0 80-84 36.88869999999999 38.0 38.0 38.0 36.6 38.0 85-89 36.7555 38.0 38.0 38.0 36.0 38.0 90-94 36.654250000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.67155 38.0 38.0 38.0 35.8 38.0 100-104 36.60315 38.0 38.0 38.0 35.6 38.0 105-109 36.50335 38.0 38.0 38.0 35.0 38.0 110-114 36.28830000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.106550000000006 38.0 38.0 38.0 34.0 38.0 120-124 35.900999999999996 38.0 38.0 38.0 33.2 38.0 125-129 35.6952 38.0 37.8 38.0 32.6 38.0 130-134 35.4881 38.0 37.0 38.0 31.2 38.0 135-139 34.962599999999995 38.0 36.0 38.0 29.8 38.0 140-144 34.36814999999999 38.0 35.8 38.0 26.8 38.0 145-149 33.63525 38.0 34.0 38.0 22.2 38.0 150-151 28.4625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 0.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 3.0 11 2.0 12 1.0 13 5.0 14 4.0 15 0.0 16 0.0 17 5.0 18 5.0 19 4.0 20 8.0 21 10.0 22 11.0 23 12.0 24 14.0 25 14.0 26 14.0 27 9.0 28 15.0 29 22.0 30 33.0 31 44.0 32 47.0 33 74.0 34 91.0 35 170.0 36 497.0 37 2869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.300000000000004 18.725 16.075 25.900000000000002 2 27.05 24.45 32.15 16.35 3 20.724999999999998 28.050000000000004 31.75 19.475 4 24.575 34.65 22.575 18.2 5 24.025 37.225 22.400000000000002 16.35 6 20.265531062124246 37.399799599198396 24.599198396793586 17.73547094188377 7 18.782870022539445 20.485850237916353 41.27222639619334 19.459053343350863 8 21.72172172172172 25.125125125125123 28.553553553553552 24.5995995995996 9 22.097097097097095 24.54954954954955 29.204204204204203 24.14914914914915 10-14 22.814221331998 28.71306960440661 27.215823735603408 21.256885327991988 15-19 22.864296444667 28.037055583375064 28.367551326990487 20.73109664496745 20-24 22.72203576616741 28.38751690627661 28.462655913439868 20.427791414116115 25-29 23.263036617742824 28.137053549065772 27.73130291038421 20.868606922807192 30-34 22.89850716361086 28.323815248973048 27.842901512874462 20.934776074541627 35-39 23.130887953497695 27.515534175185408 28.537783122870312 20.815794748446585 40-44 23.220992538434572 28.459111623015676 27.662877460063097 20.657018378486654 45-49 22.842842842842842 27.75275275275275 28.1981981981982 21.206206206206208 50-54 22.846273214196327 28.077288882214546 28.167392501376582 20.909045402212545 55-59 23.489059135746835 27.53993290270893 28.76170447148365 20.209303490060588 60-64 22.67334167709637 28.330413016270338 28.075093867334168 20.921151439299123 65-69 22.562227675664847 28.361796964992237 28.27164821956228 20.804327139780636 70-74 22.971348427168902 28.080544980965737 27.880184331797235 21.067922260068123 75-79 22.83354192740926 27.964956195244056 28.846057571964955 20.355444305381727 80-84 22.923138591041187 27.658081972141495 28.099007916624913 21.319771520192404 85-89 23.395621461850606 28.189970442362604 28.395370973398126 20.019037122388657 90-94 22.905922996044662 28.578581084464027 28.06288489460772 20.452611024883595 95-99 23.006856513688003 27.516140333316653 28.872428807367 20.604574345628347 100-104 23.392222611480907 28.276863019868877 28.3719533556879 19.958961012962316 105-109 23.285614175593153 28.39123035338873 28.31614776253879 20.00700770847933 110-114 23.890306760746636 28.213981884601914 28.063854276134713 19.83185707851674 115-119 24.3114672008012 28.01702553830746 27.936905358037055 19.734601902854283 120-124 23.57625845229151 27.948910593538695 28.665164037064862 19.809666917104934 125-129 24.256086564472497 28.00821560965835 28.00320609157399 19.73249173429516 130-134 24.88857729480695 28.399018478641896 27.10701587460564 19.605388351945514 135-139 24.97245868803205 28.01702553830746 27.230846269404108 19.779669504256383 140-144 24.76853010359842 28.24683449276813 27.08573144487263 19.898903958760823 145-149 25.32171648890892 28.55139952931751 26.813880126182966 19.31300385559061 150-151 24.5 28.775000000000002 27.3125 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 2.5 26 4.5 27 5.0 28 7.0 29 12.5 30 20.5 31 26.5 32 32.5 33 49.0 34 65.0 35 67.5 36 90.5 37 126.5 38 152.0 39 175.5 40 188.5 41 216.5 42 260.0 43 267.0 44 272.5 45 285.0 46 266.5 47 236.5 48 217.0 49 203.5 50 164.0 51 118.0 52 97.5 53 79.0 54 63.0 55 58.0 56 40.0 57 26.5 58 22.0 59 18.5 60 18.0 61 12.0 62 6.5 63 4.5 64 3.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.17500000000000002 8 0.1 9 0.1 10-14 0.15 15-19 0.15 20-24 0.185 25-29 0.185 30-34 0.19 35-39 0.22 40-44 0.155 45-49 0.1 50-54 0.11499999999999999 55-59 0.145 60-64 0.125 65-69 0.165 70-74 0.18 75-79 0.125 80-84 0.21 85-89 0.19499999999999998 90-94 0.135 95-99 0.095 100-104 0.095 105-109 0.11 110-114 0.08499999999999999 115-119 0.15 120-124 0.17500000000000002 125-129 0.19 130-134 0.155 135-139 0.15 140-144 0.095 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.4124999999999996 0.0 0.0 0.0 0.0 118-119 3.85 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.574999999999999 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.612500000000001 0.0 0.0 0.0 0.0 134-135 8.274999999999999 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTTC 20 3.5877043E-4 108.75 2 >>END_MODULE Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579126 spots for SRR7168840.sra Written 579126 spots for SRR7168840.sra Read 579139 spots for SRR7168840.sra Written 579139 spots for SRR7168840.sra SRR ids: ['SRR7168840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fjspr4xl SRR7168840.sra spots: 11582533 blocks: [[1, 579126], [579127, 1158252], [1158253, 1737378], [1737379, 2316504], [2316505, 2895630], [2895631, 3474756], [3474757, 4053882], [4053883, 4633008], [4633009, 5212134], [5212135, 5791260], [5791261, 6370386], [6370387, 6949512], [6949513, 7528638], [7528639, 8107764], [8107765, 8686890], [8686891, 9266016], [9266017, 9845142], [9845143, 10424268], [10424269, 11003394], [11003395, 11582533]] SRR7168840 file size 3903240 SRR7168840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168840 SRR7168840_1.fastq SRR7168840_2.fastq Input file: SRR7168840_1.fastq Paired file: SRR7168840_2.fastq trimmed: SRR7168840-trimmed-pair1.fastq, SRR7168840-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 06:31:51 2025 >> started Sat Feb 15 06:32:06 2025 >> done (14.323s) 11582533 read pairs processed; of these: 15247 ( 0.13%) short read pairs filtered out after trimming by size control 25101 ( 0.22%) empty read pairs filtered out after trimming by size control 11542185 (99.65%) read pairs available; of these: 6014191 (52.11%) trimmed read pairs available after processing 5527994 (47.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 5 0.00% 25 8 0.00% 26 9 0.00% 27 7 0.00% 28 4 0.00% 29 8 0.00% 30 8 0.00% 31 8 0.00% 32 9 0.00% 33 13 0.00% 34 9 0.00% 35 16 0.00% 36 13 0.00% 37 14 0.00% 38 20 0.00% 39 23 0.00% 40 30 0.00% 41 24 0.00% 42 26 0.00% 43 40 0.00% 44 30 0.00% 45 43 0.00% 46 43 0.00% 47 57 0.00% 48 55 0.00% 49 61 0.00% 50 91 0.00% 51 100 0.00% 52 99 0.00% 53 114 0.00% 54 119 0.00% 55 142 0.00% 56 155 0.00% 57 165 0.00% 58 191 0.00% 59 223 0.00% 60 266 0.00% 61 279 0.00% 62 315 0.00% 63 385 0.00% 64 438 0.00% 65 453 0.00% 66 546 0.00% 67 564 0.00% 68 738 0.01% 69 1264 0.01% 70 1544 0.01% 71 1163 0.01% 72 1215 0.01% 73 1298 0.01% 74 1501 0.01% 75 1590 0.01% 76 1713 0.01% 77 1925 0.02% 78 2135 0.02% 79 2429 0.02% 80 2726 0.02% 81 3078 0.03% 82 3563 0.03% 83 3807 0.03% 84 4640 0.04% 85 5228 0.05% 86 5614 0.05% 87 5762 0.05% 88 6519 0.06% 89 6923 0.06% 90 7480 0.06% 91 8172 0.07% 92 8715 0.08% 93 9651 0.08% 94 10501 0.09% 95 10800 0.09% 96 11533 0.10% 97 12084 0.10% 98 12611 0.11% 99 13251 0.11% 100 14191 0.12% 101 14654 0.13% 102 15653 0.14% 103 16750 0.15% 104 17622 0.15% 105 18307 0.16% 106 19159 0.17% 107 19966 0.17% 108 20395 0.18% 109 21000 0.18% 110 21902 0.19% 111 22459 0.19% 112 23944 0.21% 113 24592 0.21% 114 25802 0.22% 115 26722 0.23% 116 27742 0.24% 117 28357 0.25% 118 29256 0.25% 119 29575 0.26% 120 30454 0.26% 121 31266 0.27% 122 32443 0.28% 123 33750 0.29% 124 35351 0.31% 125 36424 0.32% 126 38022 0.33% 127 38861 0.34% 128 39070 0.34% 129 40649 0.35% 130 41831 0.36% 131 43250 0.37% 132 44564 0.39% 133 46745 0.40% 134 48349 0.42% 135 50757 0.44% 136 52408 0.45% 137 54911 0.48% 138 57975 0.50% 139 61417 0.53% 140 64188 0.56% 141 69164 0.60% 142 74932 0.65% 143 83355 0.72% 144 94509 0.82% 145 110185 0.95% 146 136804 1.19% 147 180834 1.57% 148 277140 2.40% 149 557542 4.83% 150 2892565 25.06% 151 5527994 47.89% 11542185 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=308.56 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=18 prefix-density=0.34 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=30.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATAC SRR7168840 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 06:34:28 Started mapping on | Feb 15 06:34:32 Finished on | Feb 15 06:35:45 Mapping speed, Million of reads per hour | 569.20 Number of input reads | 11542185 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10796547 Uniquely mapped reads % | 93.54% Average mapped length | 291.58 Number of splices: Total | 10112095 Number of splices: Annotated (sjdb) | 9876439 Number of splices: GT/AG | 9921013 Number of splices: GC/AG | 156436 Number of splices: AT/AC | 5700 Number of splices: Non-canonical | 28946 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273053 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 60978 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 482756 482756 482756 N_multimapping 273053 273053 273053 N_noFeature 515774 10538730 681749 N_ambiguous 159530 1229 66693 UnstrandedReadsAssigned:10121243 PositiveStrandReadsAssigned:256588 NegativeStrandReadsAssigned:10048105 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168840 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168840-trimmed-pair1.fastq SRR7168840-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,542,185 reads, 10,046,527 reads pseudoaligned [quant] estimated average fragment length: 231.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7168840.ke.tsv 34699 SRR7168840.se.tsv 87100 total ==> SRR7168840.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.01 278.491 16.4635 Potri.005G024800.1.v4.1 1035 804.011 142 18.658 Potri.004G059700.1.v4.1 961 730.08 0 0 Potri.007G009000.2.v4.1 1416 1185.01 0 0 Potri.003G141000.2.v4.1 2943 2712.01 742.477 28.9221 Potri.016G087400.1.v4.1 270 87.3038 486 588.086 Potri.015G069301.1.v4.1 564 337.804 0 0 Potri.010G195200.1.v4.1 1773 1542.01 24 1.64423 Potri.012G127500.1.v4.1 977 746.064 48 6.79677 ==> SRR7168840.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168840 completed mapping pipeline successfully