Starting /dee2/code/volunteer_pipeline.sh SRR7168841 current disk space = 3094182936576 free memory = 1446126444 SRR7168841 SRAfilesize 1f46e49dd5f0f3aea21da19d63d6dad0 SRR7168841.sra SRR7168841.sra file validated SRR7168841 is paired end SRR7168841 is conventional basespace SRR7168841 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168841_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10575 34.0 33.0 34.0 32.0 34.0 2 33.15575 34.0 33.0 34.0 32.0 34.0 3 33.238 34.0 33.0 34.0 32.0 34.0 4 33.28675 34.0 33.0 34.0 33.0 34.0 5 33.31875 34.0 33.0 34.0 33.0 34.0 6 37.071 38.0 38.0 38.0 36.0 38.0 7 37.25825 38.0 38.0 38.0 36.0 38.0 8 37.29325 38.0 38.0 38.0 37.0 38.0 9 37.375 38.0 38.0 38.0 37.0 38.0 10-14 37.426 38.0 38.0 38.0 37.0 38.0 15-19 37.44775 38.0 38.0 38.0 37.0 38.0 20-24 37.40665 38.0 38.0 38.0 37.0 38.0 25-29 37.37335 38.0 38.0 38.0 37.0 38.0 30-34 37.3652 38.0 38.0 38.0 37.0 38.0 35-39 37.339299999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.25425 38.0 38.0 38.0 37.0 38.0 45-49 37.208549999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.2378 38.0 38.0 38.0 36.8 38.0 55-59 37.1604 38.0 38.0 38.0 36.6 38.0 60-64 37.136250000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.070550000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.032450000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9837 38.0 38.0 38.0 36.0 38.0 80-84 36.86865 38.0 38.0 38.0 35.8 38.0 85-89 36.7388 38.0 38.0 38.0 35.2 38.0 90-94 36.6331 38.0 38.0 38.0 34.8 38.0 95-99 36.4484 38.0 38.0 38.0 34.0 38.0 100-104 36.500099999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.30505 38.0 38.0 38.0 34.0 38.0 110-114 36.196600000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.854200000000006 38.0 37.0 38.0 31.8 38.0 120-124 35.660900000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.4321 38.0 36.2 38.0 30.6 38.0 130-134 35.03345 38.0 35.8 38.0 29.0 38.0 135-139 34.6543 38.0 35.0 38.0 27.8 38.0 140-144 33.9036 38.0 33.0 38.0 23.0 38.0 145-149 33.063 38.0 33.0 38.0 17.8 38.0 150-151 27.94425 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 3.0 17 1.0 18 3.0 19 5.0 20 3.0 21 4.0 22 9.0 23 7.0 24 12.0 25 10.0 26 24.0 27 23.0 28 30.0 29 32.0 30 41.0 31 62.0 32 64.0 33 104.0 34 148.0 35 297.0 36 641.0 37 2471.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.77933905802758 11.631537861046057 11.917772573510279 40.67135050741608 2 21.825 17.375 35.825 24.975 3 21.0 22.400000000000002 24.5 32.1 4 23.325000000000003 31.15 21.925 23.599999999999998 5 23.075000000000003 34.25 24.2 18.475 6 18.075 36.15 26.474999999999998 19.3 7 14.124999999999998 25.074999999999996 43.075 17.724999999999998 8 18.025 25.674999999999997 30.599999999999998 25.7 9 18.5 24.55 33.074999999999996 23.875 10-14 19.82 29.9 26.71 23.57 15-19 20.064999999999998 28.015 28.17 23.75 20-24 19.615 29.335 27.63 23.419999999999998 25-29 20.244999999999997 28.475 28.115000000000002 23.165 30-34 20.125 28.544999999999998 27.915 23.415 35-39 20.005 28.38 27.845 23.77 40-44 20.185 28.76 27.855 23.200000000000003 45-49 20.255000000000003 28.375 27.825 23.544999999999998 50-54 19.515 28.345 28.29 23.849999999999998 55-59 19.755 28.63 27.825 23.79 60-64 19.695 28.01 28.665000000000003 23.630000000000003 65-69 20.41 28.605000000000004 27.67 23.315 70-74 20.365 28.799999999999997 28.015 22.82 75-79 19.865 28.095 28.475 23.565 80-84 20.4 29.17 27.305 23.125 85-89 20.345 28.765 27.474999999999998 23.415 90-94 20.7 28.82 27.13 23.35 95-99 20.175 28.525 28.060000000000002 23.24 100-104 20.66 28.384999999999998 27.355 23.599999999999998 105-109 20.285 28.555000000000003 27.51 23.65 110-114 20.05 28.515 27.775 23.66 115-119 20.315 28.79 27.35 23.544999999999998 120-124 20.43 28.735 27.355 23.48 125-129 21.13 28.57 26.945000000000004 23.355 130-134 20.685000000000002 28.76 27.22 23.335 135-139 20.630000000000003 28.88 27.045 23.445 140-144 21.055 29.15 26.39 23.405 145-149 20.685000000000002 28.470000000000002 27.045 23.799999999999997 150-151 21.45 28.6125 25.912499999999998 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.5 25 3.0 26 3.0 27 6.0 28 9.5 29 13.5 30 19.0 31 21.5 32 29.0 33 53.5 34 75.5 35 79.5 36 97.5 37 114.5 38 125.5 39 170.0 40 224.5 41 231.5 42 236.5 43 253.5 44 269.0 45 273.0 46 252.5 47 247.0 48 229.5 49 193.5 50 166.5 51 133.5 52 100.5 53 82.0 54 72.0 55 56.5 56 43.0 57 36.0 58 20.0 59 14.0 60 14.5 61 10.0 62 5.5 63 4.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.225 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.2375 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.237500000000001 0.0 0.0 0.0 0.0 136-137 7.8 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAGA 10 0.0068378756 144.95 145 TCATTAA 10 0.0068378756 144.95 4 >>END_MODULE SRR7168841 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168841_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8185 33.0 33.0 34.0 32.0 34.0 2 32.946 33.0 33.0 34.0 32.0 34.0 3 32.9395 34.0 33.0 34.0 32.0 34.0 4 32.93475 34.0 33.0 34.0 32.0 34.0 5 32.92775 34.0 33.0 34.0 32.0 34.0 6 37.125 38.0 38.0 38.0 37.0 38.0 7 37.11925 38.0 38.0 38.0 37.0 38.0 8 37.22175 38.0 38.0 38.0 37.0 38.0 9 37.19625 38.0 38.0 38.0 37.0 38.0 10-14 37.143299999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.1399 38.0 38.0 38.0 37.0 38.0 20-24 37.1057 38.0 38.0 38.0 37.0 38.0 25-29 37.1079 38.0 38.0 38.0 36.8 38.0 30-34 37.12075 38.0 38.0 38.0 36.8 38.0 35-39 37.103950000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.0843 38.0 38.0 38.0 36.4 38.0 45-49 37.0527 38.0 38.0 38.0 36.4 38.0 50-54 37.0205 38.0 38.0 38.0 36.2 38.0 55-59 36.977500000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.968050000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.93555 38.0 38.0 38.0 36.0 38.0 70-74 36.815599999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.7136 38.0 38.0 38.0 35.6 38.0 80-84 36.5793 38.0 38.0 38.0 35.0 38.0 85-89 36.4316 38.0 38.0 38.0 34.2 38.0 90-94 36.4156 38.0 38.0 38.0 34.0 38.0 95-99 36.3876 38.0 38.0 38.0 34.2 38.0 100-104 36.29315 38.0 38.0 38.0 34.0 38.0 105-109 36.10965 38.0 38.0 38.0 33.6 38.0 110-114 35.84955 38.0 37.6 38.0 32.0 38.0 115-119 35.731 38.0 37.0 38.0 32.0 38.0 120-124 35.49495 38.0 36.8 38.0 30.8 38.0 125-129 35.265 38.0 36.6 38.0 30.0 38.0 130-134 34.80440000000001 38.0 36.0 38.0 28.0 38.0 135-139 34.28765 38.0 34.8 38.0 25.6 38.0 140-144 33.58695000000001 38.0 33.2 38.0 21.2 38.0 145-149 32.31635 38.0 33.0 38.0 10.6 38.0 150-151 27.12825 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 3.0 11 3.0 12 4.0 13 2.0 14 1.0 15 2.0 16 4.0 17 5.0 18 11.0 19 9.0 20 9.0 21 11.0 22 11.0 23 15.0 24 14.0 25 16.0 26 25.0 27 22.0 28 28.0 29 30.0 30 44.0 31 62.0 32 75.0 33 102.0 34 139.0 35 229.0 36 615.0 37 2503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 17.625 16.725 30.075000000000003 2 26.85 27.025 31.025000000000002 15.1 3 21.825 29.25 29.099999999999998 19.825 4 23.674999999999997 35.125 21.675 19.525000000000002 5 24.575 35.725 21.825 17.875 6 19.05 39.45 23.075000000000003 18.425 7 20.125 19.725 39.875 20.275000000000002 8 21.875 24.349999999999998 29.049999999999997 24.725 9 23.35 25.4 28.299999999999997 22.95 10-14 23.615 29.125 26.51 20.75 15-19 23.380000000000003 28.199999999999996 28.410000000000004 20.01 20-24 22.889577915583118 28.315663132626522 27.930586117223445 20.86417283456691 25-29 23.584716943388678 28.070614122824566 27.565513102620525 20.779155831166232 30-34 22.66339950992649 28.004200630094516 27.944191628744314 21.388208231234685 35-39 23.372011603481045 27.72331699509853 28.05841752525758 20.846253876162848 40-44 22.354470894178835 28.275655131026205 28.310662132426483 21.059211842368477 45-49 23.445 28.305000000000003 27.894999999999996 20.355 50-54 22.825 28.365000000000002 27.694999999999997 21.115000000000002 55-59 22.737273727372738 27.83778377837784 28.417841784178417 21.007100710071008 60-64 22.994999999999997 28.215 28.144999999999996 20.645 65-69 22.84 27.529999999999998 28.970000000000002 20.66 70-74 22.794117647058822 28.106242496998803 27.806122448979593 21.293517406962785 75-79 22.98149074537269 27.768884442221108 28.349174587293646 20.900450225112557 80-84 23.251975592677805 28.26848054416325 28.283485045513657 20.196058817645294 85-89 23.223223223223226 27.26226226226226 28.563563563563566 20.95095095095095 90-94 23.038430744595676 28.102481985588472 28.237590072057646 20.621497197758206 95-99 23.34834834834835 27.652652652652655 28.088088088088085 20.91091091091091 100-104 23.523819055244196 27.697157726180944 28.502802241793436 20.276220976781424 105-109 23.263263263263262 27.762762762762762 28.403403403403406 20.57057057057057 110-114 23.990593886025916 28.29339070395757 27.89313053484765 19.82288487516886 115-119 24.00940564338603 27.976786071642984 27.641584950970582 20.3722233340004 120-124 24.054243394715773 27.95736589271417 28.252602081665334 19.735788630904725 125-129 24.337168584292147 28.25912956478239 27.023511755877937 20.380190095047524 130-134 24.67097032477606 28.0288245008257 27.433318320572486 19.86688685382575 135-139 24.816056859702687 28.249662145252515 27.308674107813204 19.62560688723159 140-144 25.355213127876723 28.32699619771863 26.45587352411447 19.86191715029017 145-149 25.565452361889513 28.182546036829464 26.901521216973578 19.350480384307446 150-151 25.72536268134067 27.71385692846423 27.301150575287643 19.259629814907452 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 1.5 26 3.0 27 4.5 28 4.5 29 11.5 30 18.0 31 20.0 32 30.5 33 46.0 34 65.0 35 79.0 36 85.0 37 98.0 38 130.0 39 169.5 40 208.0 41 232.5 42 251.5 43 283.0 44 294.5 45 279.5 46 260.0 47 244.5 48 224.5 49 190.0 50 161.5 51 134.0 52 101.0 53 81.0 54 75.0 55 58.0 56 40.5 57 33.5 58 24.5 59 18.5 60 12.0 61 9.0 62 6.0 63 3.5 64 1.0 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.02 30-34 0.015 35-39 0.03 40-44 0.02 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.04 75-79 0.05 80-84 0.03 85-89 0.1 90-94 0.08 95-99 0.1 100-104 0.08 105-109 0.1 110-114 0.065 115-119 0.06 120-124 0.08 125-129 0.05 130-134 0.08499999999999999 135-139 0.105 140-144 0.06 145-149 0.08 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.4025157232704402 0.8 3 0.07547169811320754 0.22499999999999998 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.825 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944993 spots for SRR7168841.sra Written 944993 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra Read 944980 spots for SRR7168841.sra Written 944980 spots for SRR7168841.sra SRR ids: ['SRR7168841.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_txx_rbpa SRR7168841.sra spots: 18899613 blocks: [[1, 944980], [944981, 1889960], [1889961, 2834940], [2834941, 3779920], [3779921, 4724900], [4724901, 5669880], [5669881, 6614860], [6614861, 7559840], [7559841, 8504820], [8504821, 9449800], [9449801, 10394780], [10394781, 11339760], [11339761, 12284740], [12284741, 13229720], [13229721, 14174700], [14174701, 15119680], [15119681, 16064660], [16064661, 17009640], [17009641, 17954620], [17954621, 18899613]] SRR7168841 file size 6382758 SRR7168841 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168841 SRR7168841_1.fastq SRR7168841_2.fastq Input file: SRR7168841_1.fastq Paired file: SRR7168841_2.fastq trimmed: SRR7168841-trimmed-pair1.fastq, SRR7168841-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:14:37 2025 >> started Sat Feb 15 05:15:07 2025 >> done (29.861s) 18899613 read pairs processed; of these: 24049 ( 0.13%) short read pairs filtered out after trimming by size control 15872 ( 0.08%) empty read pairs filtered out after trimming by size control 18859692 (99.79%) read pairs available; of these: 10316090 (54.70%) trimmed read pairs available after processing 8543602 (45.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 0 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 9 0.00% 25 3 0.00% 26 6 0.00% 27 8 0.00% 28 6 0.00% 29 5 0.00% 30 5 0.00% 31 13 0.00% 32 13 0.00% 33 8 0.00% 34 12 0.00% 35 15 0.00% 36 24 0.00% 37 18 0.00% 38 10 0.00% 39 21 0.00% 40 24 0.00% 41 31 0.00% 42 26 0.00% 43 39 0.00% 44 37 0.00% 45 46 0.00% 46 46 0.00% 47 55 0.00% 48 61 0.00% 49 81 0.00% 50 65 0.00% 51 86 0.00% 52 111 0.00% 53 112 0.00% 54 117 0.00% 55 133 0.00% 56 163 0.00% 57 183 0.00% 58 221 0.00% 59 247 0.00% 60 266 0.00% 61 282 0.00% 62 343 0.00% 63 398 0.00% 64 460 0.00% 65 552 0.00% 66 572 0.00% 67 639 0.00% 68 796 0.00% 69 1254 0.01% 70 1232 0.01% 71 1084 0.01% 72 1212 0.01% 73 1402 0.01% 74 1594 0.01% 75 1800 0.01% 76 1934 0.01% 77 2267 0.01% 78 2446 0.01% 79 2757 0.01% 80 3021 0.02% 81 3482 0.02% 82 3995 0.02% 83 4465 0.02% 84 5773 0.03% 85 6363 0.03% 86 7105 0.04% 87 7725 0.04% 88 8311 0.04% 89 8657 0.05% 90 9269 0.05% 91 10317 0.05% 92 10991 0.06% 93 12255 0.06% 94 13106 0.07% 95 14245 0.08% 96 14873 0.08% 97 16383 0.09% 98 16944 0.09% 99 18023 0.10% 100 19201 0.10% 101 20168 0.11% 102 21570 0.11% 103 23009 0.12% 104 24638 0.13% 105 26192 0.14% 106 27410 0.15% 107 29160 0.15% 108 30246 0.16% 109 31415 0.17% 110 32923 0.17% 111 33911 0.18% 112 35720 0.19% 113 37510 0.20% 114 39125 0.21% 115 41606 0.22% 116 43285 0.23% 117 44468 0.24% 118 45888 0.24% 119 47467 0.25% 120 49135 0.26% 121 50486 0.27% 122 52415 0.28% 123 55626 0.29% 124 57643 0.31% 125 59966 0.32% 126 62708 0.33% 127 65369 0.35% 128 66844 0.35% 129 69643 0.37% 130 72389 0.38% 131 74770 0.40% 132 78159 0.41% 133 81900 0.43% 134 86185 0.46% 135 90931 0.48% 136 95953 0.51% 137 102102 0.54% 138 107307 0.57% 139 115553 0.61% 140 122376 0.65% 141 133646 0.71% 142 146680 0.78% 143 164803 0.87% 144 189613 1.01% 145 224157 1.19% 146 280544 1.49% 147 369511 1.96% 148 549715 2.91% 149 1058470 5.61% 150 4705906 24.95% 151 8543602 45.30% 18859692 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=14 prefix-density=0.36 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=416.96 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=62.36 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.8 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168841 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:16:16 Started mapping on | Feb 15 05:16:16 Finished on | Feb 15 05:18:28 Mapping speed, Million of reads per hour | 514.36 Number of input reads | 18859692 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17695332 Uniquely mapped reads % | 93.83% Average mapped length | 292.02 Number of splices: Total | 16656232 Number of splices: Annotated (sjdb) | 16254191 Number of splices: GT/AG | 16338926 Number of splices: GC/AG | 257173 Number of splices: AT/AC | 9821 Number of splices: Non-canonical | 50312 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 544579 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 127598 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 635844 635844 635844 N_multimapping 544579 544579 544579 N_noFeature 707026 17341019 912392 N_ambiguous 283327 1770 133042 UnstrandedReadsAssigned:16704979 PositiveStrandReadsAssigned:352543 NegativeStrandReadsAssigned:16649898 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168841 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168841-trimmed-pair1.fastq SRR7168841-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,859,692 reads, 16,707,174 reads pseudoaligned [quant] estimated average fragment length: 232.565 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7168841.ke.tsv 34699 SRR7168841.se.tsv 87100 total ==> SRR7168841.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.43 1522 51.6269 Potri.005G024800.1.v4.1 1035 803.435 237 17.875 Potri.004G059700.1.v4.1 961 729.461 30 2.49211 Potri.007G009000.2.v4.1 1416 1184.43 0 0 Potri.003G141000.2.v4.1 2943 2711.43 1258.73 28.1307 Potri.016G087400.1.v4.1 270 85.4678 881 624.628 Potri.015G069301.1.v4.1 564 337.375 0 0 Potri.010G195200.1.v4.1 1773 1541.43 247.923 9.74631 Potri.012G127500.1.v4.1 977 745.44 213 17.3147 ==> SRR7168841.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 972 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 46 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR7168841 completed mapping pipeline successfully