Starting /dee2/code/volunteer_pipeline.sh SRR7168842 current disk space = 3093118701568 free memory = 1581934812 SRR7168842 SRAfilesize 052b74121c9bd3c90702b057d314fa05 SRR7168842.sra SRR7168842.sra file validated SRR7168842 is paired end SRR7168842 is conventional basespace SRR7168842 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54125 34.0 33.0 34.0 33.0 34.0 2 33.269 34.0 33.0 34.0 32.0 34.0 3 33.3645 34.0 34.0 34.0 33.0 34.0 4 33.4315 34.0 34.0 34.0 33.0 34.0 5 33.48025 34.0 34.0 34.0 33.0 34.0 6 37.1605 38.0 38.0 38.0 36.0 38.0 7 37.4305 38.0 38.0 38.0 37.0 38.0 8 37.4455 38.0 38.0 38.0 37.0 38.0 9 37.50325 38.0 38.0 38.0 37.0 38.0 10-14 37.5552 38.0 38.0 38.0 37.8 38.0 15-19 37.55050000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.52225000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.51365 38.0 38.0 38.0 37.8 38.0 30-34 37.48885 38.0 38.0 38.0 38.0 38.0 35-39 37.469849999999994 38.0 38.0 38.0 37.6 38.0 40-44 37.4154 38.0 38.0 38.0 37.0 38.0 45-49 37.435900000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.3911 38.0 38.0 38.0 37.0 38.0 55-59 37.36135 38.0 38.0 38.0 37.0 38.0 60-64 37.350649999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.30255 38.0 38.0 38.0 37.0 38.0 70-74 37.273649999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.186350000000004 38.0 38.0 38.0 36.2 38.0 80-84 37.08765000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.99105 38.0 38.0 38.0 36.0 38.0 90-94 36.9395 38.0 38.0 38.0 36.0 38.0 95-99 36.81885 38.0 38.0 38.0 35.4 38.0 100-104 36.6906 38.0 38.0 38.0 35.0 38.0 105-109 36.571000000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.450700000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.28845 38.0 38.0 38.0 33.6 38.0 120-124 36.00235 38.0 37.0 38.0 32.6 38.0 125-129 35.8226 38.0 37.0 38.0 32.4 38.0 130-134 35.4953 38.0 36.0 38.0 31.0 38.0 135-139 35.24495 38.0 36.0 38.0 31.0 38.0 140-144 34.73195 38.0 35.2 38.0 27.6 38.0 145-149 34.0417 38.0 33.8 38.0 25.2 38.0 150-151 29.472749999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 2.0 18 1.0 19 6.0 20 3.0 21 1.0 22 4.0 23 7.0 24 11.0 25 7.0 26 10.0 27 11.0 28 27.0 29 21.0 30 36.0 31 40.0 32 57.0 33 81.0 34 119.0 35 243.0 36 587.0 37 2717.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.26020015396459 13.651526815499102 11.034128817038749 37.054144213497565 2 22.3 18.4 34.175 25.124999999999996 3 19.900000000000002 23.825 26.275 30.0 4 22.375 33.425 21.8 22.400000000000002 5 21.975 35.675000000000004 22.875 19.475 6 18.3 35.375 25.3 21.025 7 14.7 24.4 42.199999999999996 18.7 8 17.875 24.975 30.599999999999998 26.55 9 17.4 23.575 33.375 25.650000000000002 10-14 19.97 28.994999999999997 27.1 23.935000000000002 15-19 19.64 27.87 28.415000000000003 24.075 20-24 19.900000000000002 28.895 27.72 23.485 25-29 19.54 28.76 28.095 23.605 30-34 20.195 28.93 27.74 23.135 35-39 20.11 28.565 27.805000000000003 23.52 40-44 19.705000000000002 28.435 27.810000000000002 24.05 45-49 19.875 28.410000000000004 28.02 23.695 50-54 20.349999999999998 28.01 27.639999999999997 24.0 55-59 20.485 28.04 27.694999999999997 23.78 60-64 20.064999999999998 28.365000000000002 27.85 23.72 65-69 20.04 29.005 27.375 23.580000000000002 70-74 20.075000000000003 28.249999999999996 27.6 24.075 75-79 19.86 28.32 27.93 23.89 80-84 19.86 28.325 27.644999999999996 24.169999999999998 85-89 19.615 28.535 28.17 23.68 90-94 20.46 28.754999999999995 27.245 23.54 95-99 20.150000000000002 28.205000000000002 27.825 23.82 100-104 20.845 28.315 27.49 23.35 105-109 20.465 28.83 27.43 23.275000000000002 110-114 20.75 27.865000000000002 27.565 23.82 115-119 20.65 28.435 27.375 23.54 120-124 20.815 27.82 27.33 24.035 125-129 20.875 28.355000000000004 27.075 23.695 130-134 20.695 28.444999999999997 26.965 23.895 135-139 20.955 28.22 27.165 23.66 140-144 21.205 27.450000000000003 27.13 24.215 145-149 20.79 28.215 27.279999999999998 23.715 150-151 21.087500000000002 28.175 27.212500000000002 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.0 24 2.0 25 1.5 26 2.0 27 4.5 28 7.5 29 15.5 30 21.0 31 29.5 32 35.0 33 35.5 34 53.5 35 81.0 36 104.0 37 118.0 38 141.0 39 174.0 40 208.5 41 229.0 42 246.0 43 256.5 44 266.0 45 255.5 46 241.5 47 245.5 48 219.0 49 194.0 50 165.0 51 128.5 52 101.5 53 87.5 54 75.0 55 52.0 56 43.0 57 39.5 58 30.5 59 22.0 60 17.0 61 13.5 62 7.0 63 4.0 64 5.0 65 6.5 66 3.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.475 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 3.9625 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.1 0.0 0.0 0.0 0.0 124-125 5.4125 0.0 0.0 0.0 0.0 126-127 5.9625 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.587499999999999 0.0 0.0 0.0 0.0 138-139 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168842 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168842_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.882 33.0 33.0 34.0 32.0 34.0 2 33.05525 34.0 33.0 34.0 32.0 34.0 3 33.05725 34.0 33.0 34.0 33.0 34.0 4 33.018 34.0 33.0 34.0 33.0 34.0 5 32.99075 34.0 33.0 34.0 33.0 34.0 6 37.2255 38.0 38.0 38.0 37.0 38.0 7 37.2235 38.0 38.0 38.0 37.0 38.0 8 37.3575 38.0 38.0 38.0 37.0 38.0 9 37.20825 38.0 38.0 38.0 37.0 38.0 10-14 37.24665 38.0 38.0 38.0 37.0 38.0 15-19 37.2262 38.0 38.0 38.0 37.0 38.0 20-24 37.2116 38.0 38.0 38.0 37.0 38.0 25-29 37.2205 38.0 38.0 38.0 37.0 38.0 30-34 37.1696 38.0 38.0 38.0 37.0 38.0 35-39 37.1798 38.0 38.0 38.0 37.0 38.0 40-44 37.17605 38.0 38.0 38.0 37.0 38.0 45-49 37.185950000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.070550000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.03095 38.0 38.0 38.0 37.0 38.0 60-64 37.05525 38.0 38.0 38.0 37.0 38.0 65-69 36.994600000000005 38.0 38.0 38.0 37.0 38.0 70-74 36.9396 38.0 38.0 38.0 36.2 38.0 75-79 36.83 38.0 38.0 38.0 36.0 38.0 80-84 36.71085 38.0 38.0 38.0 36.0 38.0 85-89 36.6045 38.0 38.0 38.0 35.2 38.0 90-94 36.5592 38.0 38.0 38.0 35.0 38.0 95-99 36.6279 38.0 38.0 38.0 35.2 38.0 100-104 36.4455 38.0 38.0 38.0 34.8 38.0 105-109 36.32655 38.0 38.0 38.0 34.0 38.0 110-114 36.209199999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.07769999999999 38.0 38.0 38.0 33.6 38.0 120-124 35.79965 38.0 37.6 38.0 32.6 38.0 125-129 35.596349999999994 38.0 37.2 38.0 31.8 38.0 130-134 35.339099999999995 38.0 36.2 38.0 31.0 38.0 135-139 34.9221 38.0 36.0 38.0 29.0 38.0 140-144 34.42245 38.0 36.0 38.0 27.6 38.0 145-149 33.36955 38.0 33.4 38.0 18.4 38.0 150-151 28.662 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 4.0 6 1.0 7 1.0 8 2.0 9 1.0 10 0.0 11 5.0 12 4.0 13 1.0 14 1.0 15 3.0 16 4.0 17 2.0 18 6.0 19 3.0 20 4.0 21 6.0 22 8.0 23 8.0 24 13.0 25 15.0 26 16.0 27 24.0 28 17.0 29 23.0 30 43.0 31 51.0 32 62.0 33 86.0 34 121.0 35 175.0 36 516.0 37 2764.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 18.975 16.075 24.575 2 27.700000000000003 26.075 29.675 16.55 3 21.2 29.75 29.7 19.35 4 23.599999999999998 35.825 21.85 18.725 5 23.474999999999998 36.375 23.05 17.1 6 19.925 36.375 25.374999999999996 18.325 7 20.225 20.075000000000003 39.225 20.474999999999998 8 21.675 24.575 26.125 27.625 9 21.4 24.55 28.875 25.174999999999997 10-14 23.305 28.325 26.400000000000002 21.97 15-19 23.35 27.500000000000004 28.16 20.990000000000002 20-24 22.830000000000002 28.475 28.12 20.575 25-29 23.265 28.449999999999996 27.529999999999998 20.755000000000003 30-34 23.205000000000002 28.035 27.875 20.885 35-39 23.235 27.83 28.12 20.815 40-44 23.06 27.62 28.134999999999998 21.185000000000002 45-49 23.169999999999998 27.145000000000003 28.615000000000002 21.07 50-54 23.1 27.315 28.645 20.94 55-59 22.445 27.815 28.435 21.305 60-64 23.26 27.915 27.58 21.245 65-69 23.575 27.575 27.915 20.935000000000002 70-74 23.14 28.294999999999998 27.505000000000003 21.060000000000002 75-79 23.155 28.33 27.839999999999996 20.674999999999997 80-84 23.73 28.15 27.950000000000003 20.169999999999998 85-89 23.544999999999998 28.050000000000004 27.375 21.029999999999998 90-94 23.785 28.050000000000004 27.495000000000005 20.669999999999998 95-99 23.266163308165407 27.75638781939097 28.551427571378568 20.426021301065052 100-104 23.711185559277965 28.10140507025351 27.57637881894095 20.611030551527577 105-109 24.238635795369305 27.59913987098065 27.77916687503125 20.383057458618794 110-114 23.886194309715485 28.61143057152858 27.28636431821591 20.216010800540026 115-119 24.127412741274128 28.372837283728376 27.177717771777175 20.32203220322032 120-124 24.09120456022801 28.041402070103505 27.736386819340968 20.131006550327516 125-129 24.315 28.16 27.485 20.04 130-134 24.941247062353117 28.186409320466023 27.051352567628385 19.82099104955248 135-139 25.096254812740636 28.351417570878546 26.336316815840792 20.216010800540026 140-144 24.91 28.044999999999998 27.284999999999997 19.759999999999998 145-149 25.66 28.38 26.575 19.384999999999998 150-151 25.6 28.9375 26.487500000000004 18.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 2.0 25 4.0 26 4.0 27 2.5 28 5.5 29 10.5 30 15.0 31 23.0 32 28.0 33 38.0 34 49.5 35 63.5 36 91.0 37 120.0 38 139.5 39 167.0 40 189.5 41 212.0 42 241.0 43 254.0 44 282.0 45 284.5 46 272.0 47 253.5 48 223.0 49 189.0 50 157.5 51 135.5 52 115.0 53 98.0 54 73.0 55 58.0 56 49.0 57 38.0 58 26.0 59 21.5 60 16.5 61 10.0 62 7.0 63 5.0 64 3.5 65 3.5 66 2.5 67 1.0 68 1.0 69 3.0 70 3.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.005 105-109 0.015 110-114 0.005 115-119 0.01 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5249999999999999 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.1624999999999996 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.9 0.0 0.0 0.0 0.0 118-119 4.2875 0.0 0.0 0.0 0.0 120-121 4.675 0.0 0.0 0.0 0.0 122-123 5.050000000000001 0.0 0.0 0.0 0.0 124-125 5.362500000000001 0.0 0.0 0.0 0.0 126-127 5.8875 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.4875 0.0 0.0 0.0 0.0 134-135 7.925000000000001 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra Read 875086 spots for SRR7168842.sra Written 875086 spots for SRR7168842.sra Read 875072 spots for SRR7168842.sra Written 875072 spots for SRR7168842.sra SRR ids: ['SRR7168842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dp2j33fo SRR7168842.sra spots: 17501454 blocks: [[1, 875072], [875073, 1750144], [1750145, 2625216], [2625217, 3500288], [3500289, 4375360], [4375361, 5250432], [5250433, 6125504], [6125505, 7000576], [7000577, 7875648], [7875649, 8750720], [8750721, 9625792], [9625793, 10500864], [10500865, 11375936], [11375937, 12251008], [12251009, 13126080], [13126081, 14001152], [14001153, 14876224], [14876225, 15751296], [15751297, 16626368], [16626369, 17501454]] SRR7168842 file size 5908968 SRR7168842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168842 SRR7168842_1.fastq SRR7168842_2.fastq Input file: SRR7168842_1.fastq Paired file: SRR7168842_2.fastq trimmed: SRR7168842-trimmed-pair1.fastq, SRR7168842-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 06:08:40 2025 >> started Sat Feb 15 06:09:14 2025 >> done (33.395s) 17501454 read pairs processed; of these: 21534 ( 0.12%) short read pairs filtered out after trimming by size control 27004 ( 0.15%) empty read pairs filtered out after trimming by size control 17452916 (99.72%) read pairs available; of these: 9292986 (53.25%) trimmed read pairs available after processing 8159930 (46.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 8 0.00% 23 7 0.00% 24 6 0.00% 25 3 0.00% 26 4 0.00% 27 11 0.00% 28 11 0.00% 29 8 0.00% 30 9 0.00% 31 15 0.00% 32 26 0.00% 33 16 0.00% 34 18 0.00% 35 18 0.00% 36 26 0.00% 37 21 0.00% 38 20 0.00% 39 33 0.00% 40 42 0.00% 41 35 0.00% 42 48 0.00% 43 39 0.00% 44 49 0.00% 45 54 0.00% 46 53 0.00% 47 61 0.00% 48 73 0.00% 49 88 0.00% 50 112 0.00% 51 125 0.00% 52 146 0.00% 53 154 0.00% 54 183 0.00% 55 195 0.00% 56 220 0.00% 57 247 0.00% 58 282 0.00% 59 305 0.00% 60 348 0.00% 61 461 0.00% 62 511 0.00% 63 619 0.00% 64 604 0.00% 65 644 0.00% 66 809 0.00% 67 847 0.00% 68 999 0.01% 69 1552 0.01% 70 1614 0.01% 71 1546 0.01% 72 1770 0.01% 73 1997 0.01% 74 2205 0.01% 75 2536 0.01% 76 2649 0.02% 77 2834 0.02% 78 3222 0.02% 79 3583 0.02% 80 4112 0.02% 81 4775 0.03% 82 5524 0.03% 83 6124 0.04% 84 7537 0.04% 85 8584 0.05% 86 9043 0.05% 87 9756 0.06% 88 10327 0.06% 89 11178 0.06% 90 11967 0.07% 91 12744 0.07% 92 14147 0.08% 93 15452 0.09% 94 16606 0.10% 95 17872 0.10% 96 18567 0.11% 97 19352 0.11% 98 19874 0.11% 99 20791 0.12% 100 22196 0.13% 101 23201 0.13% 102 25295 0.14% 103 26955 0.15% 104 28858 0.17% 105 30281 0.17% 106 31377 0.18% 107 32235 0.18% 108 32827 0.19% 109 33724 0.19% 110 35397 0.20% 111 36751 0.21% 112 38441 0.22% 113 40662 0.23% 114 42772 0.25% 115 44284 0.25% 116 45737 0.26% 117 46443 0.27% 118 47816 0.27% 119 48624 0.28% 120 50197 0.29% 121 51761 0.30% 122 53190 0.30% 123 56096 0.32% 124 58527 0.34% 125 60163 0.34% 126 62915 0.36% 127 63949 0.37% 128 65388 0.37% 129 67116 0.38% 130 68595 0.39% 131 70767 0.41% 132 73131 0.42% 133 77205 0.44% 134 80253 0.46% 135 85175 0.49% 136 87678 0.50% 137 92348 0.53% 138 96996 0.56% 139 102323 0.59% 140 106822 0.61% 141 115400 0.66% 142 125551 0.72% 143 139323 0.80% 144 159498 0.91% 145 187938 1.08% 146 229629 1.32% 147 303453 1.74% 148 449194 2.57% 149 877353 5.03% 150 4182704 23.97% 151 8159930 46.75% 17452916 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=242.44 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.66 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=68.38 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.8 sequence=ACACAGAGAACACATTCATAC SRR7168842 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 06:10:11 Started mapping on | Feb 15 06:10:11 Finished on | Feb 15 06:12:20 Mapping speed, Million of reads per hour | 487.06 Number of input reads | 17452916 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15969297 Uniquely mapped reads % | 91.50% Average mapped length | 290.90 Number of splices: Total | 15101884 Number of splices: Annotated (sjdb) | 14733694 Number of splices: GT/AG | 14814189 Number of splices: GC/AG | 225556 Number of splices: AT/AC | 9239 Number of splices: Non-canonical | 52900 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521987 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 258552 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 979663 979663 979663 N_multimapping 521987 521987 521987 N_noFeature 613135 15604083 838289 N_ambiguous 276257 2104 134569 UnstrandedReadsAssigned:15079905 PositiveStrandReadsAssigned:363110 NegativeStrandReadsAssigned:14996439 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168842 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168842-trimmed-pair1.fastq SRR7168842-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,452,916 reads, 15,190,313 reads pseudoaligned [quant] estimated average fragment length: 226.708 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR7168842.ke.tsv 34699 SRR7168842.se.tsv 87100 total ==> SRR7168842.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.29 1327 47.2798 Potri.005G024800.1.v4.1 1035 809.292 385 30.3787 Potri.004G059700.1.v4.1 961 735.326 5 0.434214 Potri.007G009000.2.v4.1 1416 1190.29 0 0 Potri.003G141000.2.v4.1 2943 2717.29 1019.9 23.9681 Potri.016G087400.1.v4.1 270 88.2266 900.232 651.582 Potri.015G069301.1.v4.1 564 342.37 0 0 Potri.010G195200.1.v4.1 1773 1547.29 1009.97 41.6823 Potri.012G127500.1.v4.1 977 751.303 60 5.09976 ==> SRR7168842.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 179 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7168842 completed mapping pipeline successfully