Starting /dee2/code/volunteer_pipeline.sh SRR7168843 current disk space = 3093116510208 free memory = 1476716172 SRR7168843 SRAfilesize 68a41e374c62bd8b4cf6a3d13dec287b SRR7168843.sra SRR7168843.sra file validated SRR7168843 is paired end SRR7168843 is conventional basespace SRR7168843 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06925 34.0 33.0 34.0 32.0 34.0 2 33.192 34.0 33.0 34.0 32.0 34.0 3 33.186 34.0 33.0 34.0 31.0 34.0 4 33.28575 34.0 33.0 34.0 33.0 34.0 5 33.383 34.0 33.0 34.0 33.0 34.0 6 37.01725 38.0 37.0 38.0 36.0 38.0 7 37.32 38.0 38.0 38.0 37.0 38.0 8 37.44525 38.0 38.0 38.0 37.0 38.0 9 37.531 38.0 38.0 38.0 37.0 38.0 10-14 37.51305 38.0 38.0 38.0 37.2 38.0 15-19 37.5092 38.0 38.0 38.0 37.4 38.0 20-24 37.43665 38.0 38.0 38.0 37.0 38.0 25-29 37.36275 38.0 38.0 38.0 37.0 38.0 30-34 37.39245000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.35655 38.0 38.0 38.0 37.0 38.0 40-44 37.32854999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.32505 38.0 38.0 38.0 37.0 38.0 50-54 37.25984999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.237100000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.156850000000006 38.0 38.0 38.0 36.2 38.0 65-69 37.11195 38.0 38.0 38.0 36.0 38.0 70-74 37.027300000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9058 38.0 38.0 38.0 35.4 38.0 80-84 36.762150000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.74079999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.589000000000006 38.0 38.0 38.0 34.4 38.0 95-99 36.46545 38.0 38.0 38.0 34.0 38.0 100-104 36.322199999999995 38.0 37.6 38.0 34.0 38.0 105-109 36.1896 38.0 37.4 38.0 33.6 38.0 110-114 35.943450000000006 38.0 37.0 38.0 32.6 38.0 115-119 35.8426 38.0 37.0 38.0 32.2 38.0 120-124 35.612700000000004 38.0 36.0 38.0 31.0 38.0 125-129 35.33905 38.0 36.0 38.0 30.0 38.0 130-134 35.048500000000004 38.0 35.6 38.0 28.2 38.0 135-139 34.637649999999994 38.0 35.0 38.0 26.8 38.0 140-144 33.9239 38.0 33.8 38.0 23.6 38.0 145-149 33.039049999999996 38.0 33.4 38.0 18.4 38.0 150-151 28.710250000000002 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 2.0 14 3.0 15 2.0 16 1.0 17 0.0 18 3.0 19 2.0 20 2.0 21 2.0 22 4.0 23 6.0 24 4.0 25 12.0 26 16.0 27 28.0 28 23.0 29 41.0 30 37.0 31 62.0 32 80.0 33 125.0 34 156.0 35 299.0 36 742.0 37 2346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.55801825293351 11.629726205997393 11.264667535853977 40.547588005215125 2 22.15 17.299999999999997 34.025 26.525 3 20.25 23.599999999999998 23.799999999999997 32.35 4 23.025000000000002 29.125 22.25 25.6 5 22.63631815907954 35.79289644822411 22.71135567783892 18.859429714857427 6 18.25 36.3 26.424999999999997 19.025 7 14.95 23.325000000000003 43.625 18.099999999999998 8 18.2 24.525 30.075000000000003 27.200000000000003 9 18.525 24.125 32.2 25.15 10-14 20.495 29.599999999999998 26.555 23.35 15-19 20.74 28.410000000000004 27.36 23.49 20-24 20.29 28.275 27.91 23.525 25-29 20.49 29.065 26.745 23.7 30-34 20.645 27.92 28.134999999999998 23.3 35-39 20.205000000000002 28.660000000000004 27.455000000000002 23.68 40-44 20.02 28.57 27.685 23.724999999999998 45-49 20.375 28.645 27.589999999999996 23.39 50-54 20.275000000000002 28.625 27.810000000000002 23.29 55-59 20.22 28.42 27.589999999999996 23.77 60-64 20.415 27.625 27.92 24.04 65-69 20.45 27.99 27.779999999999998 23.78 70-74 20.66 27.91 27.46 23.97 75-79 20.57 28.384999999999998 27.42 23.625 80-84 20.59 28.439999999999998 27.615000000000002 23.355 85-89 20.705000000000002 28.505000000000003 27.48 23.31 90-94 21.105 28.244999999999997 26.85 23.799999999999997 95-99 20.64 28.27 27.37 23.72 100-104 21.125 28.59 26.334999999999997 23.95 105-109 20.8 28.32 26.99 23.89 110-114 21.345 27.98 27.0 23.674999999999997 115-119 21.195 28.465 26.715 23.625 120-124 21.05 28.575 26.974999999999998 23.400000000000002 125-129 20.985 28.335 26.615 24.065 130-134 21.11 28.685 26.284999999999997 23.919999999999998 135-139 21.565 28.23 26.495 23.71 140-144 20.905 28.075 26.75 24.27 145-149 20.45 27.939999999999998 27.560000000000002 24.05 150-151 22.000752162467094 27.441394007772345 27.027704650871254 23.530149178889307 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 3.0 25 2.0 26 3.0 27 4.5 28 6.5 29 7.0 30 11.0 31 19.5 32 30.0 33 45.0 34 56.5 35 68.5 36 82.5 37 113.5 38 131.5 39 143.0 40 174.0 41 213.5 42 242.0 43 257.5 44 274.5 45 275.0 46 286.5 47 263.0 48 217.0 49 210.0 50 193.5 51 155.0 52 110.0 53 87.5 54 80.0 55 63.0 56 44.5 57 28.5 58 23.0 59 21.5 60 18.0 61 11.0 62 6.0 63 6.0 64 3.0 65 1.5 66 2.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5039052658100277 1.0 3 0.10078105316200556 0.3 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.6375 0.0 0.0 0.0 0.0 122-123 4.9875 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.7375 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.7375 0.0 0.0 0.0 0.0 134-135 8.3375 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTCG 10 0.0068396386 144.9375 6 >>END_MODULE SRR7168843 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94075 33.0 33.0 34.0 32.0 34.0 2 33.10825 34.0 33.0 34.0 32.0 34.0 3 33.11325 34.0 33.0 34.0 33.0 34.0 4 33.1115 34.0 33.0 34.0 33.0 34.0 5 33.12325 34.0 33.0 34.0 33.0 34.0 6 37.3425 38.0 38.0 38.0 37.0 38.0 7 37.34875 38.0 38.0 38.0 37.0 38.0 8 37.26225 38.0 38.0 38.0 37.0 38.0 9 37.282 38.0 38.0 38.0 37.0 38.0 10-14 37.3025 38.0 38.0 38.0 37.0 38.0 15-19 37.28355 38.0 38.0 38.0 37.0 38.0 20-24 37.22195 38.0 38.0 38.0 37.0 38.0 25-29 37.25445 38.0 38.0 38.0 37.0 38.0 30-34 37.19265 38.0 38.0 38.0 37.0 38.0 35-39 37.2898 38.0 38.0 38.0 37.0 38.0 40-44 37.245 38.0 38.0 38.0 37.2 38.0 45-49 37.17105 38.0 38.0 38.0 37.0 38.0 50-54 37.15545 38.0 38.0 38.0 37.0 38.0 55-59 37.0413 38.0 38.0 38.0 36.4 38.0 60-64 37.03355 38.0 38.0 38.0 36.4 38.0 65-69 37.0304 38.0 38.0 38.0 36.2 38.0 70-74 36.93765 38.0 38.0 38.0 36.0 38.0 75-79 36.81925 38.0 38.0 38.0 36.0 38.0 80-84 36.6913 38.0 38.0 38.0 35.0 38.0 85-89 36.5535 38.0 38.0 38.0 35.0 38.0 90-94 36.46 38.0 38.0 38.0 34.4 38.0 95-99 36.40235 38.0 38.0 38.0 34.0 38.0 100-104 36.3313 38.0 38.0 38.0 34.0 38.0 105-109 36.13965 38.0 38.0 38.0 34.0 38.0 110-114 35.88715 38.0 37.6 38.0 32.8 38.0 115-119 35.722500000000004 38.0 37.0 38.0 31.8 38.0 120-124 35.3825 38.0 36.4 38.0 29.6 38.0 125-129 35.064049999999995 38.0 36.0 38.0 28.6 38.0 130-134 34.716150000000006 38.0 35.8 38.0 27.0 38.0 135-139 34.1308 38.0 34.2 38.0 23.6 38.0 140-144 33.414249999999996 38.0 33.0 38.0 21.4 38.0 145-149 32.66445 38.0 33.0 38.0 13.4 38.0 150-151 27.949125000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 6.0 16 3.0 17 7.0 18 1.0 19 9.0 20 6.0 21 16.0 22 10.0 23 13.0 24 23.0 25 13.0 26 19.0 27 21.0 28 30.0 29 29.0 30 36.0 31 51.0 32 64.0 33 82.0 34 143.0 35 270.0 36 646.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.00875218804701 16.55413853463366 16.879219804951237 31.557889472368096 2 27.420565424068048 25.99449587190393 31.17338003502627 15.411558669001751 3 21.591193395046286 27.9459594696022 29.597197898423815 20.8656492369277 4 23.092319239429575 35.37653239929948 22.39179384538404 19.139354515886914 5 24.34325744308231 35.27645734300726 23.617713284963724 16.76257192894671 6 20.090067550662997 36.05203902927195 24.668501376032022 19.189392044033024 7 19.039279459594695 19.339504628471353 40.58043532649487 21.04078058543908 8 22.091568676507382 24.568426319739807 27.795846885163872 25.544158118588946 9 22.892169126845133 24.768576432324245 29.74731048286215 22.59194395796848 10-14 23.6565595917142 28.424897428199742 26.153307315120582 21.765235664965477 15-19 23.53382706164932 27.597077662129703 27.83226581265012 21.036829463570857 20-24 22.36236236236236 28.81881881881882 27.627627627627625 21.19119119119119 25-29 23.157368026019515 28.2661996497373 27.51063297473105 21.065799349512133 30-34 22.67267267267267 28.36836836836837 27.307307307307305 21.65165165165165 35-39 23.107729275130158 27.64817781337605 27.98858630356428 21.255506607929515 40-44 23.42225113858165 27.396026224913665 28.021620539512536 21.16010209699214 45-49 22.80324259407526 27.572057646116892 28.157526020816654 21.467173738991193 50-54 23.68394715772618 27.577061649319457 28.077461969575662 20.661529223378704 55-59 23.39637746422496 27.26408485940158 27.419193435404782 21.920344240968678 60-64 23.361352947062944 27.994596217352147 27.699389572700888 20.94466126288402 65-69 23.050745671103996 27.19947953157842 27.77499749774797 21.974777299569613 70-74 23.14698964015815 27.841449376908063 27.170812271658072 21.84074871127571 75-79 23.095786207586826 27.6949254328896 27.689920928835953 21.51936743068762 80-84 23.36771480072101 27.23813338674144 28.11936711395954 21.27478469857801 85-89 23.245570127139853 27.560316347982784 28.170988086895587 21.02312543798178 90-94 23.76138524672205 27.880092082874587 28.05524972475228 20.303272945651084 95-99 23.756629640748525 27.14900430301211 28.15971179825878 20.934654257980586 100-104 24.453340005003753 27.035276457343006 27.565674255691768 20.945709281961474 105-109 23.626538577003902 27.9495646952867 27.314119883918742 21.109776843790655 110-114 23.880522339520688 27.74303297143143 27.57292239955971 20.803522289488168 115-119 24.86364773580185 27.535651738804102 27.555666750062546 20.0450337753315 120-124 23.963963963963963 27.652652652652655 28.083083083083082 20.3003003003003 125-129 24.54954954954955 27.72272272272272 26.716716716716714 21.01101101101101 130-134 24.97246971668836 27.34007408148964 27.400140154169588 20.287316047652418 135-139 24.421864050455504 27.910701771949142 26.88957853639003 20.777855641205324 140-144 25.1801080648389 28.01681008605163 27.081248749249546 19.721833099859918 145-149 24.673505128846635 27.9459594696022 27.240430322742053 20.140105078809107 150-151 26.437500000000004 27.762500000000003 26.0 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 0.5 26 1.5 27 5.0 28 7.5 29 10.5 30 12.5 31 16.0 32 27.0 33 35.0 34 43.0 35 55.5 36 73.5 37 96.0 38 127.0 39 165.0 40 191.5 41 212.5 42 230.0 43 248.0 44 272.0 45 285.0 46 271.0 47 254.5 48 243.5 49 219.5 50 187.5 51 156.5 52 116.5 53 93.0 54 88.0 55 68.0 56 43.0 57 31.0 58 28.5 59 24.0 60 18.0 61 11.0 62 9.0 63 6.5 64 2.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.06999999999999999 15-19 0.08 20-24 0.1 25-29 0.075 30-34 0.1 35-39 0.12 40-44 0.095 45-49 0.08 50-54 0.08 55-59 0.06999999999999999 60-64 0.06999999999999999 65-69 0.09 70-74 0.095 75-79 0.09 80-84 0.13999999999999999 85-89 0.11 90-94 0.09 95-99 0.06999999999999999 100-104 0.075 105-109 0.06999999999999999 110-114 0.065 115-119 0.075 120-124 0.1 125-129 0.1 130-134 0.11 135-139 0.11 140-144 0.06 145-149 0.075 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31835395102246 98.35000000000001 2 0.5301691492047462 1.05 3 0.07573844988639232 0.22499999999999998 4 0.050492299924261554 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025246149962130777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.6875 0.0 0.0 0.0 0.0 122-123 5.0375 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.074999999999999 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.275 0.0 0.0 0.0 0.0 132-133 7.775 0.0 0.0 0.0 0.0 134-135 8.4125 0.0 0.0 0.0 0.0 136-137 8.875 0.0 0.0 0.0 0.0 138-139 9.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798554 spots for SRR7168843.sra Written 798554 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra Read 798543 spots for SRR7168843.sra Written 798543 spots for SRR7168843.sra SRR ids: ['SRR7168843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eazd_83a SRR7168843.sra spots: 15970871 blocks: [[1, 798543], [798544, 1597086], [1597087, 2395629], [2395630, 3194172], [3194173, 3992715], [3992716, 4791258], [4791259, 5589801], [5589802, 6388344], [6388345, 7186887], [7186888, 7985430], [7985431, 8783973], [8783974, 9582516], [9582517, 10381059], [10381060, 11179602], [11179603, 11978145], [11978146, 12776688], [12776689, 13575231], [13575232, 14373774], [14373775, 15172317], [15172318, 15970871]] SRR7168843 file size 5390303 SRR7168843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168843 SRR7168843_1.fastq SRR7168843_2.fastq Input file: SRR7168843_1.fastq Paired file: SRR7168843_2.fastq trimmed: SRR7168843-trimmed-pair1.fastq, SRR7168843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 05:57:56 2025 >> started Sat Feb 15 05:58:13 2025 >> done (17.288s) 15970871 read pairs processed; of these: 17271 ( 0.11%) short read pairs filtered out after trimming by size control 36210 ( 0.23%) empty read pairs filtered out after trimming by size control 15917390 (99.67%) read pairs available; of these: 8642407 (54.30%) trimmed read pairs available after processing 7274983 (45.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 0 0.00% 21 5 0.00% 22 5 0.00% 23 2 0.00% 24 2 0.00% 25 4 0.00% 26 7 0.00% 27 7 0.00% 28 4 0.00% 29 11 0.00% 30 6 0.00% 31 9 0.00% 32 9 0.00% 33 5 0.00% 34 13 0.00% 35 15 0.00% 36 10 0.00% 37 8 0.00% 38 16 0.00% 39 29 0.00% 40 31 0.00% 41 23 0.00% 42 28 0.00% 43 39 0.00% 44 49 0.00% 45 37 0.00% 46 56 0.00% 47 53 0.00% 48 75 0.00% 49 83 0.00% 50 75 0.00% 51 99 0.00% 52 119 0.00% 53 117 0.00% 54 157 0.00% 55 164 0.00% 56 178 0.00% 57 200 0.00% 58 252 0.00% 59 267 0.00% 60 316 0.00% 61 374 0.00% 62 387 0.00% 63 441 0.00% 64 527 0.00% 65 630 0.00% 66 661 0.00% 67 746 0.00% 68 909 0.01% 69 1395 0.01% 70 1383 0.01% 71 1317 0.01% 72 1512 0.01% 73 1648 0.01% 74 1962 0.01% 75 2116 0.01% 76 2286 0.01% 77 2613 0.02% 78 2872 0.02% 79 3265 0.02% 80 3639 0.02% 81 4126 0.03% 82 4587 0.03% 83 5196 0.03% 84 6312 0.04% 85 7056 0.04% 86 7402 0.05% 87 8208 0.05% 88 8856 0.06% 89 9664 0.06% 90 10355 0.07% 91 11000 0.07% 92 11983 0.08% 93 13040 0.08% 94 14204 0.09% 95 15389 0.10% 96 16004 0.10% 97 17078 0.11% 98 17956 0.11% 99 18727 0.12% 100 19809 0.12% 101 21041 0.13% 102 22317 0.14% 103 23571 0.15% 104 24799 0.16% 105 26289 0.17% 106 27351 0.17% 107 28779 0.18% 108 29740 0.19% 109 30937 0.19% 110 32110 0.20% 111 33150 0.21% 112 34339 0.22% 113 36472 0.23% 114 37736 0.24% 115 39890 0.25% 116 40875 0.26% 117 41780 0.26% 118 43719 0.27% 119 44754 0.28% 120 45950 0.29% 121 47570 0.30% 122 49308 0.31% 123 51008 0.32% 124 53111 0.33% 125 54914 0.34% 126 57733 0.36% 127 59768 0.38% 128 61087 0.38% 129 62765 0.39% 130 65341 0.41% 131 67186 0.42% 132 70263 0.44% 133 73386 0.46% 134 75885 0.48% 135 79698 0.50% 136 83869 0.53% 137 88007 0.55% 138 93017 0.58% 139 98462 0.62% 140 104108 0.65% 141 112130 0.70% 142 120421 0.76% 143 134615 0.85% 144 152130 0.96% 145 178203 1.12% 146 219146 1.38% 147 292453 1.84% 148 436808 2.74% 149 844831 5.31% 150 3829357 24.06% 151 7274983 45.70% 15917390 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.63 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.19 sequence-density-rank=18 fanout-score=23.84 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.5 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=17 prefix-density=0.83 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.21 sequence-density-rank=17 fanout-score=13.91 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=4.9 sequence=AGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168843 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 05:59:11 Started mapping on | Feb 15 05:59:11 Finished on | Feb 15 06:00:51 Mapping speed, Million of reads per hour | 573.03 Number of input reads | 15917390 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14992522 Uniquely mapped reads % | 94.19% Average mapped length | 291.07 Number of splices: Total | 13813225 Number of splices: Annotated (sjdb) | 13513538 Number of splices: GT/AG | 13537998 Number of splices: GC/AG | 233016 Number of splices: AT/AC | 7930 Number of splices: Non-canonical | 34281 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434575 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 40754 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502212 502212 502212 N_multimapping 434575 434575 434575 N_noFeature 539606 14716553 707798 N_ambiguous 211754 1135 103147 UnstrandedReadsAssigned:14241162 PositiveStrandReadsAssigned:274834 NegativeStrandReadsAssigned:14181577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168843-trimmed-pair1.fastq SRR7168843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,917,390 reads, 14,247,314 reads pseudoaligned [quant] estimated average fragment length: 228.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7168843.ke.tsv 34699 SRR7168843.se.tsv 87100 total ==> SRR7168843.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.72 639 27.5107 Potri.005G024800.1.v4.1 1035 807.721 181 17.2761 Potri.004G059700.1.v4.1 961 733.772 14 1.47094 Potri.007G009000.2.v4.1 1416 1188.72 0 0 Potri.003G141000.2.v4.1 2943 2715.72 579 16.437 Potri.016G087400.1.v4.1 270 88.7102 681 591.837 Potri.015G069301.1.v4.1 564 341.442 0 0 Potri.010G195200.1.v4.1 1773 1545.72 14.6186 0.729126 Potri.012G127500.1.v4.1 977 749.757 112 11.5166 ==> SRR7168843.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 322 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 38 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 162 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168843 completed mapping pipeline successfully