Starting /dee2/code/volunteer_pipeline.sh SRR7168845 current disk space = 3092915101696 free memory = 1579213584 SRR7168845 SRAfilesize a45b30bfdae04d37504e8ea2cb6085a2 SRR7168845.sra SRR7168845.sra file validated SRR7168845 is paired end SRR7168845 is conventional basespace SRR7168845 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22325 34.0 33.0 34.0 32.0 34.0 2 33.145 34.0 33.0 34.0 32.0 34.0 3 33.247 34.0 33.0 34.0 32.0 34.0 4 33.3335 34.0 33.0 34.0 33.0 34.0 5 33.3525 34.0 33.0 34.0 33.0 34.0 6 37.088 38.0 38.0 38.0 36.0 38.0 7 37.318 38.0 38.0 38.0 37.0 38.0 8 37.394 38.0 38.0 38.0 37.0 38.0 9 37.4255 38.0 38.0 38.0 37.0 38.0 10-14 37.4664 38.0 38.0 38.0 37.2 38.0 15-19 37.4525 38.0 38.0 38.0 37.0 38.0 20-24 37.392450000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.4222 38.0 38.0 38.0 37.0 38.0 30-34 37.403999999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.36875 38.0 38.0 38.0 37.0 38.0 40-44 37.3069 38.0 38.0 38.0 37.0 38.0 45-49 37.325399999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2504 38.0 38.0 38.0 37.0 38.0 55-59 37.16835 38.0 38.0 38.0 36.4 38.0 60-64 37.1844 38.0 38.0 38.0 36.4 38.0 65-69 37.13225 38.0 38.0 38.0 36.4 38.0 70-74 37.0832 38.0 38.0 38.0 36.0 38.0 75-79 37.02275 38.0 38.0 38.0 36.0 38.0 80-84 36.9664 38.0 38.0 38.0 36.0 38.0 85-89 36.88635 38.0 38.0 38.0 35.6 38.0 90-94 36.747249999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.59675 38.0 38.0 38.0 34.0 38.0 100-104 36.56675 38.0 38.0 38.0 34.2 38.0 105-109 36.4072 38.0 38.0 38.0 34.0 38.0 110-114 36.356100000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.05645 38.0 37.0 38.0 32.6 38.0 120-124 35.83905 38.0 37.0 38.0 31.8 38.0 125-129 35.5544 38.0 36.2 38.0 31.0 38.0 130-134 35.17765 38.0 35.8 38.0 30.0 38.0 135-139 34.821600000000004 38.0 35.6 38.0 28.0 38.0 140-144 33.99525 38.0 33.8 38.0 24.0 38.0 145-149 32.98845 38.0 33.0 38.0 17.2 38.0 150-151 27.954375 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 2.0 18 0.0 19 3.0 20 2.0 21 3.0 22 8.0 23 8.0 24 10.0 25 14.0 26 10.0 27 19.0 28 46.0 29 25.0 30 45.0 31 57.0 32 76.0 33 102.0 34 143.0 35 272.0 36 638.0 37 2511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.83904465212876 14.537902388369679 7.139148494288682 43.48390446521287 2 20.575 18.3 38.9 22.225 3 18.025 24.5 25.974999999999998 31.5 4 22.05 33.375 21.8 22.775000000000002 5 21.725 35.449999999999996 23.95 18.875 6 18.7 36.175000000000004 25.974999999999998 19.15 7 14.174999999999999 24.275 43.824999999999996 17.724999999999998 8 18.675 23.325000000000003 31.15 26.85 9 15.6 22.375 35.85 26.174999999999997 10-14 19.205 30.104999999999997 27.255000000000003 23.435 15-19 19.63 28.785 27.860000000000003 23.724999999999998 20-24 20.36 28.660000000000004 27.62 23.36 25-29 19.82 28.425 28.189999999999998 23.565 30-34 19.55 28.42 28.360000000000003 23.669999999999998 35-39 20.235 28.43 28.175 23.16 40-44 19.96 28.82 27.91 23.31 45-49 20.07 28.48 27.894999999999996 23.555 50-54 19.98 28.79 27.750000000000004 23.48 55-59 19.945 28.87 27.544999999999998 23.64 60-64 19.96 28.794999999999998 27.61 23.635 65-69 20.255000000000003 28.410000000000004 27.794999999999998 23.54 70-74 20.45 28.395 27.565 23.59 75-79 20.0 28.79 28.110000000000003 23.1 80-84 20.195 28.465 27.98 23.36 85-89 20.32 28.189999999999998 28.15 23.34 90-94 20.055 28.765 28.110000000000003 23.07 95-99 20.294999999999998 28.58 27.83 23.294999999999998 100-104 20.335 28.994999999999997 27.32 23.35 105-109 20.555 28.804999999999996 27.034999999999997 23.605 110-114 20.535 28.32 27.77 23.375 115-119 20.505000000000003 28.315 27.750000000000004 23.43 120-124 20.44 28.815 27.37 23.375 125-129 20.47 28.660000000000004 27.075 23.794999999999998 130-134 20.575 28.57 27.034999999999997 23.82 135-139 21.01 28.57 27.275 23.145 140-144 20.635 28.49 26.55 24.325 145-149 20.51 29.075 26.595000000000002 23.82 150-151 21.525 28.675 26.1 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 5.5 26 7.0 27 6.0 28 8.5 29 16.5 30 23.5 31 27.0 32 34.0 33 48.0 34 67.0 35 87.0 36 99.0 37 112.5 38 144.5 39 173.0 40 199.0 41 217.0 42 247.5 43 266.5 44 258.0 45 280.5 46 275.0 47 242.0 48 229.0 49 196.5 50 153.0 51 131.5 52 107.5 53 80.5 54 62.0 55 47.5 56 38.0 57 27.0 58 24.0 59 21.0 60 10.5 61 5.5 62 6.0 63 5.0 64 1.5 65 0.0 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.9875 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.3625 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.2125 0.0 0.0 0.0 0.0 118-119 4.575 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.362500000000001 0.0 0.0 0.0 0.0 124-125 5.7625 0.0 0.0 0.0 0.0 126-127 6.237500000000001 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.3125 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 9.1375 0.0 0.0 0.0 0.0 138-139 9.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTCC 10 0.006836113 144.9625 2 GTATGCC 20 3.5913987E-4 108.72187 145 TCGTATG 20 0.005942617 28.992498 140-144 TCACAAG 30 0.0014459731 24.160418 130-134 AGGACAT 35 0.0035419178 20.70893 135-139 CACAAGG 35 0.0035419178 20.70893 130-134 ACGTCTG 40 0.007666461 18.120312 115-119 TCCAGTC 40 0.007666461 18.120312 125-129 GAACTCC 40 0.007666461 18.120312 120-124 AGCACAC 40 0.007666461 18.120312 110-114 GCACACG 40 0.007666461 18.120312 110-114 CGTCTGA 40 0.007666461 18.120312 115-119 >>END_MODULE SRR7168845 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168845_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7625 33.0 33.0 34.0 32.0 34.0 2 32.9235 33.0 33.0 34.0 32.0 34.0 3 32.93575 33.0 33.0 34.0 32.0 34.0 4 32.8695 33.0 33.0 34.0 32.0 34.0 5 32.84325 33.0 33.0 34.0 32.0 34.0 6 37.10925 38.0 38.0 38.0 36.0 38.0 7 37.18675 38.0 38.0 38.0 37.0 38.0 8 37.221 38.0 38.0 38.0 37.0 38.0 9 37.15575 38.0 38.0 38.0 37.0 38.0 10-14 37.17185 38.0 38.0 38.0 37.0 38.0 15-19 37.16435 38.0 38.0 38.0 37.0 38.0 20-24 37.16815 38.0 38.0 38.0 37.0 38.0 25-29 37.1421 38.0 38.0 38.0 37.0 38.0 30-34 37.147000000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.15505 38.0 38.0 38.0 37.0 38.0 40-44 37.0779 38.0 38.0 38.0 36.6 38.0 45-49 37.054050000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.04025 38.0 38.0 38.0 36.2 38.0 55-59 36.9285 38.0 38.0 38.0 36.0 38.0 60-64 36.94690000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.88000000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.87365 38.0 38.0 38.0 35.8 38.0 75-79 36.774699999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.5708 38.0 38.0 38.0 34.8 38.0 85-89 36.47555 38.0 38.0 38.0 34.0 38.0 90-94 36.5443 38.0 38.0 38.0 34.4 38.0 95-99 36.5118 38.0 38.0 38.0 34.0 38.0 100-104 36.319399999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.22280000000001 38.0 38.0 38.0 33.6 38.0 110-114 35.98825 38.0 37.2 38.0 33.0 38.0 115-119 35.827799999999996 38.0 37.0 38.0 32.2 38.0 120-124 35.515 38.0 36.6 38.0 30.6 38.0 125-129 35.26129999999999 38.0 36.2 38.0 30.2 38.0 130-134 34.77145 38.0 35.4 38.0 28.0 38.0 135-139 34.22955 38.0 34.0 38.0 25.2 38.0 140-144 33.52265 38.0 33.0 38.0 21.0 38.0 145-149 32.29795 38.0 33.0 38.0 11.4 38.0 150-151 27.20125 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 3.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 4.0 14 3.0 15 3.0 16 3.0 17 4.0 18 6.0 19 3.0 20 7.0 21 10.0 22 11.0 23 14.0 24 14.0 25 13.0 26 21.0 27 34.0 28 34.0 29 30.0 30 50.0 31 67.0 32 73.0 33 96.0 34 142.0 35 263.0 36 681.0 37 2405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.475 20.674999999999997 12.049999999999999 31.8 2 24.9 25.724999999999998 35.4 13.975000000000001 3 19.825 28.975 31.4 19.8 4 23.125 36.15 22.7 18.025 5 24.075 37.425000000000004 21.65 16.85 6 20.25 37.574999999999996 23.7 18.475 7 18.7 19.7 41.449999999999996 20.150000000000002 8 21.425 22.925 29.475 26.174999999999997 9 21.099999999999998 24.075 31.8 23.025000000000002 10-14 22.869999999999997 28.395 27.495000000000005 21.240000000000002 15-19 23.064999999999998 28.144999999999996 28.060000000000002 20.73 20-24 22.895 28.335 28.26 20.51 25-29 22.965 27.85 28.939999999999998 20.244999999999997 30-34 22.48 28.235 28.54 20.745 35-39 22.470000000000002 28.275 28.050000000000004 21.205 40-44 22.57 28.389999999999997 28.42 20.62 45-49 22.955000000000002 28.48 28.13 20.435 50-54 23.14 28.51 28.09 20.26 55-59 23.200000000000003 28.09 28.205000000000002 20.505000000000003 60-64 23.13 28.294999999999998 27.855 20.72 65-69 23.455000000000002 28.4 27.68 20.465 70-74 23.419999999999998 27.750000000000004 28.43 20.4 75-79 22.95 28.125 28.525 20.4 80-84 23.635 28.199999999999996 27.725 20.44 85-89 23.665 27.99 28.04 20.305 90-94 23.54 28.455000000000002 27.61 20.395 95-99 23.185 27.884999999999998 28.13 20.8 100-104 22.835 28.65 27.51 21.005 105-109 23.955000000000002 27.985 27.6 20.46 110-114 23.89 27.685 28.23 20.195 115-119 24.044999999999998 28.084999999999997 27.845 20.025000000000002 120-124 24.565 27.88 27.62 19.935 125-129 24.685000000000002 27.83 27.82 19.665 130-134 24.88 27.665 27.79 19.665 135-139 24.866243312165608 28.291414570728534 27.156357817890896 19.68598429921496 140-144 24.565 28.449999999999996 27.24 19.744999999999997 145-149 25.605 28.144999999999996 26.75 19.5 150-151 24.725 29.075 26.6 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 4.5 26 7.5 27 7.0 28 7.0 29 12.5 30 17.0 31 25.0 32 37.0 33 41.5 34 56.5 35 74.5 36 97.0 37 123.5 38 155.5 39 190.5 40 201.5 41 218.0 42 251.5 43 285.5 44 279.0 45 266.5 46 252.0 47 233.0 48 217.0 49 189.5 50 166.0 51 122.0 52 98.0 53 93.5 54 75.0 55 52.5 56 34.0 57 26.0 58 23.0 59 18.5 60 12.5 61 8.5 62 6.0 63 3.0 64 2.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.37754845205134663 0.75 3 0.07550969041026932 0.22499999999999998 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.237500000000001 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.0125 0.0 0.0 0.0 0.0 122-123 5.387499999999999 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.8375 0.0 0.0 0.0 0.0 130-131 7.3875 0.0 0.0 0.0 0.0 132-133 7.8375 0.0 0.0 0.0 0.0 134-135 8.337499999999999 0.0 0.0 0.0 0.0 136-137 9.1875 0.0 0.0 0.0 0.0 138-139 9.850000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTG 10 0.006830828 145.0 9 GAAATGT 10 0.006830828 145.0 9 TCGCCGT 10 0.006830828 145.0 145 TGCTAGC 10 0.006830828 145.0 7 AAAACTC 10 0.006830828 145.0 4 TTTGCTA 10 0.006830828 145.0 5 TTGCTAG 10 0.006830828 145.0 6 GTGGTCG 25 4.977651E-4 29.0 140-144 TGGTGGA 20 0.00593511 29.0 95-99 GGTCGCC 20 0.00593511 29.0 140-144 GTAGATC 30 0.0014437955 24.166668 130-134 TGTAGAT 30 0.0014437955 24.166668 130-134 GGTGGTC 35 0.0035366106 20.714287 4 GTGTAGG 40 0.0076550315 18.125 115-119 GCGTCGT 40 0.0076550315 18.125 110-114 AGCGTCG 40 0.0076550315 18.125 110-114 >>END_MODULE Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880031 spots for SRR7168845.sra Written 880031 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra Read 880029 spots for SRR7168845.sra Written 880029 spots for SRR7168845.sra SRR ids: ['SRR7168845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_56klapo9 SRR7168845.sra spots: 17600582 blocks: [[1, 880029], [880030, 1760058], [1760059, 2640087], [2640088, 3520116], [3520117, 4400145], [4400146, 5280174], [5280175, 6160203], [6160204, 7040232], [7040233, 7920261], [7920262, 8800290], [8800291, 9680319], [9680320, 10560348], [10560349, 11440377], [11440378, 12320406], [12320407, 13200435], [13200436, 14080464], [14080465, 14960493], [14960494, 15840522], [15840523, 16720551], [16720552, 17600582]] SRR7168845 file size 5942559 SRR7168845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168845 SRR7168845_1.fastq SRR7168845_2.fastq Input file: SRR7168845_1.fastq Paired file: SRR7168845_2.fastq trimmed: SRR7168845-trimmed-pair1.fastq, SRR7168845-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 07:25:09 2025 >> started Sat Feb 15 07:25:33 2025 >> done (24.402s) 17600582 read pairs processed; of these: 18692 ( 0.11%) short read pairs filtered out after trimming by size control 7935 ( 0.05%) empty read pairs filtered out after trimming by size control 17573955 (99.85%) read pairs available; of these: 9771746 (55.60%) trimmed read pairs available after processing 7802209 (44.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 6 0.00% 21 8 0.00% 22 10 0.00% 23 11 0.00% 24 13 0.00% 25 11 0.00% 26 10 0.00% 27 14 0.00% 28 18 0.00% 29 10 0.00% 30 19 0.00% 31 16 0.00% 32 16 0.00% 33 8 0.00% 34 19 0.00% 35 18 0.00% 36 29 0.00% 37 22 0.00% 38 36 0.00% 39 29 0.00% 40 36 0.00% 41 43 0.00% 42 54 0.00% 43 63 0.00% 44 58 0.00% 45 65 0.00% 46 79 0.00% 47 95 0.00% 48 115 0.00% 49 133 0.00% 50 168 0.00% 51 184 0.00% 52 202 0.00% 53 237 0.00% 54 244 0.00% 55 296 0.00% 56 332 0.00% 57 356 0.00% 58 437 0.00% 59 502 0.00% 60 535 0.00% 61 678 0.00% 62 765 0.00% 63 818 0.00% 64 956 0.01% 65 1042 0.01% 66 1172 0.01% 67 1296 0.01% 68 1450 0.01% 69 1638 0.01% 70 1888 0.01% 71 2271 0.01% 72 2660 0.02% 73 2963 0.02% 74 3308 0.02% 75 3578 0.02% 76 3858 0.02% 77 4239 0.02% 78 4480 0.03% 79 5091 0.03% 80 5783 0.03% 81 6470 0.04% 82 7314 0.04% 83 8225 0.05% 84 9394 0.05% 85 10382 0.06% 86 10936 0.06% 87 11720 0.07% 88 12587 0.07% 89 13143 0.07% 90 14012 0.08% 91 15013 0.09% 92 16529 0.09% 93 18165 0.10% 94 19242 0.11% 95 20486 0.12% 96 20957 0.12% 97 21896 0.12% 98 22314 0.13% 99 23051 0.13% 100 24737 0.14% 101 25838 0.15% 102 27422 0.16% 103 29116 0.17% 104 30692 0.17% 105 32195 0.18% 106 33132 0.19% 107 33690 0.19% 108 34123 0.19% 109 35090 0.20% 110 36117 0.21% 111 37486 0.21% 112 39333 0.22% 113 40750 0.23% 114 42209 0.24% 115 44532 0.25% 116 45459 0.26% 117 46514 0.26% 118 47329 0.27% 119 47768 0.27% 120 49138 0.28% 121 50205 0.29% 122 52146 0.30% 123 55005 0.31% 124 57213 0.33% 125 58936 0.34% 126 61543 0.35% 127 62857 0.36% 128 64085 0.36% 129 65974 0.38% 130 68042 0.39% 131 69472 0.40% 132 72593 0.41% 133 77127 0.44% 134 80673 0.46% 135 84911 0.48% 136 89810 0.51% 137 94068 0.54% 138 100419 0.57% 139 105709 0.60% 140 112816 0.64% 141 122048 0.69% 142 134044 0.76% 143 149401 0.85% 144 173372 0.99% 145 205963 1.17% 146 256671 1.46% 147 339180 1.93% 148 506268 2.88% 149 972761 5.54% 150 4309419 24.52% 151 7802209 44.40% 17573955 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=249.26 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=26.51 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.1 sequence=CACAGAGAACACATTCATAC SRR7168845 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 07:26:33 Started mapping on | Feb 15 07:26:33 Finished on | Feb 15 07:28:49 Mapping speed, Million of reads per hour | 465.19 Number of input reads | 17573955 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16239939 Uniquely mapped reads % | 92.41% Average mapped length | 290.06 Number of splices: Total | 15496046 Number of splices: Annotated (sjdb) | 15139246 Number of splices: GT/AG | 15204146 Number of splices: GC/AG | 234051 Number of splices: AT/AC | 8439 Number of splices: Non-canonical | 49410 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434597 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 79815 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.54% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 911376 911376 911376 N_multimapping 434597 434597 434597 N_noFeature 684935 15823156 959126 N_ambiguous 253312 1882 109235 UnstrandedReadsAssigned:15301692 PositiveStrandReadsAssigned:414901 NegativeStrandReadsAssigned:15171578 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168845 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168845-trimmed-pair1.fastq SRR7168845-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,573,955 reads, 15,172,382 reads pseudoaligned [quant] estimated average fragment length: 230.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7168845.ke.tsv 34699 SRR7168845.se.tsv 87100 total ==> SRR7168845.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.18 804 30.3678 Potri.005G024800.1.v4.1 1035 805.177 335 28.101 Potri.004G059700.1.v4.1 961 731.205 12 1.10844 Potri.007G009000.2.v4.1 1416 1186.18 0 0 Potri.003G141000.2.v4.1 2943 2713.18 1281.42 31.8992 Potri.016G087400.1.v4.1 270 88.7811 915 696.095 Potri.015G069301.1.v4.1 564 338.401 0 0 Potri.010G195200.1.v4.1 1773 1543.18 84 3.67648 Potri.012G127500.1.v4.1 977 747.205 246 22.2364 ==> SRR7168845.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 790 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 8 SRR7168845 completed mapping pipeline successfully