Starting /dee2/code/volunteer_pipeline.sh SRR7168846 current disk space = 3092893110272 free memory = 1582525936 SRR7168846 SRAfilesize c24f144965e80b59de0c6f6effa0b275 SRR7168846.sra SRR7168846.sra file validated SRR7168846 is paired end SRR7168846 is conventional basespace SRR7168846 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40825 34.0 33.0 34.0 32.0 34.0 2 33.0675 34.0 33.0 34.0 32.0 34.0 3 33.03325 34.0 33.0 34.0 32.0 34.0 4 33.158 34.0 33.0 34.0 32.0 34.0 5 33.21675 34.0 33.0 34.0 32.0 34.0 6 36.97475 38.0 37.0 38.0 36.0 38.0 7 37.2145 38.0 38.0 38.0 36.0 38.0 8 37.334 38.0 38.0 38.0 37.0 38.0 9 37.39925 38.0 38.0 38.0 37.0 38.0 10-14 37.4094 38.0 38.0 38.0 37.0 38.0 15-19 37.39305 38.0 38.0 38.0 37.0 38.0 20-24 37.3755 38.0 38.0 38.0 37.0 38.0 25-29 37.3484 38.0 38.0 38.0 37.0 38.0 30-34 37.34785000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.29065 38.0 38.0 38.0 37.0 38.0 40-44 37.223349999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.2183 38.0 38.0 38.0 36.4 38.0 50-54 37.20495 38.0 38.0 38.0 36.6 38.0 55-59 37.1232 38.0 38.0 38.0 36.0 38.0 60-64 37.0843 38.0 38.0 38.0 36.2 38.0 65-69 37.049899999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.9624 38.0 38.0 38.0 35.8 38.0 75-79 36.7898 38.0 38.0 38.0 35.2 38.0 80-84 36.7224 38.0 38.0 38.0 35.0 38.0 85-89 36.657900000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.5543 38.0 38.0 38.0 34.2 38.0 95-99 36.420500000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.239000000000004 38.0 37.8 38.0 33.6 38.0 105-109 36.1502 38.0 37.2 38.0 33.4 38.0 110-114 35.93135 38.0 37.0 38.0 32.6 38.0 115-119 35.83385 38.0 37.0 38.0 31.6 38.0 120-124 35.49235 38.0 36.2 38.0 30.6 38.0 125-129 35.160450000000004 38.0 35.8 38.0 28.2 38.0 130-134 34.9199 38.0 35.2 38.0 27.6 38.0 135-139 34.60659999999999 38.0 34.6 38.0 27.2 38.0 140-144 33.97045000000001 38.0 34.0 38.0 23.4 38.0 145-149 32.995400000000004 38.0 33.0 38.0 17.0 38.0 150-151 29.139625000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 3.0 16 6.0 17 1.0 18 4.0 19 3.0 20 4.0 21 1.0 22 6.0 23 5.0 24 8.0 25 17.0 26 16.0 27 20.0 28 32.0 29 42.0 30 49.0 31 69.0 32 86.0 33 103.0 34 145.0 35 293.0 36 715.0 37 2366.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.68290182004614 12.073827223788772 12.894129710330684 38.3491412458344 2 22.6 16.575 33.45 27.375 3 21.425 22.85 24.975 30.75 4 23.525 29.45 22.35 24.675 5 23.3 33.925 22.2 20.575 6 18.775 37.075 24.0 20.150000000000002 7 14.825 25.624999999999996 41.75 17.8 8 19.375 23.95 31.2 25.474999999999998 9 18.15 24.275 33.225 24.349999999999998 10-14 19.485 29.94 26.75 23.825 15-19 19.37 28.599999999999998 27.79 24.240000000000002 20-24 20.02 27.800000000000004 28.34 23.84 25-29 19.950000000000003 28.32 27.57 24.16 30-34 19.475 28.34 27.83 24.355 35-39 19.61 28.83 27.315 24.245 40-44 20.035 28.970000000000002 27.389999999999997 23.605 45-49 19.93 29.044999999999998 27.38 23.645 50-54 20.665 28.205000000000002 27.3 23.830000000000002 55-59 20.19 28.285 27.425 24.099999999999998 60-64 20.015 28.410000000000004 27.485 24.09 65-69 19.939999999999998 28.384999999999998 27.985 23.69 70-74 20.605 28.265 27.18 23.95 75-79 20.330000000000002 28.16 27.315 24.195 80-84 20.635 28.43 27.24 23.695 85-89 20.78 28.115000000000002 26.865 24.240000000000002 90-94 20.525 28.105000000000004 27.785 23.585 95-99 20.005 28.144999999999996 27.900000000000002 23.95 100-104 21.58 27.92 27.065 23.435 105-109 20.424999999999997 28.384999999999998 27.255000000000003 23.935000000000002 110-114 20.86 27.455000000000002 28.189999999999998 23.494999999999997 115-119 20.97 27.855 27.415 23.76 120-124 21.205 27.655 27.245 23.895 125-129 21.32 27.79 26.834999999999997 24.055 130-134 21.265 28.4 26.740000000000002 23.595 135-139 21.445 27.96 26.665 23.93 140-144 21.33 27.950000000000003 26.22 24.5 145-149 21.525 28.28 25.595000000000002 24.6 150-151 20.974999999999998 28.262500000000003 26.337500000000002 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 3.5 24 2.0 25 2.0 26 2.5 27 3.0 28 6.5 29 10.5 30 13.0 31 23.5 32 25.5 33 31.5 34 54.5 35 75.5 36 88.0 37 98.5 38 123.0 39 152.5 40 202.5 41 246.5 42 239.0 43 247.0 44 264.0 45 257.0 46 248.5 47 245.5 48 247.5 49 218.0 50 175.0 51 139.0 52 117.0 53 100.5 54 80.0 55 63.5 56 49.5 57 45.0 58 32.0 59 20.5 60 16.5 61 8.0 62 5.0 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.37678975131876413 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGGCGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.8875000000000002 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.7125 0.0 0.0 0.0 0.0 110-111 3.1125 0.0 0.0 0.0 0.0 112-113 3.5999999999999996 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.762499999999999 0.0 0.0 0.0 0.0 120-121 5.175000000000001 0.0 0.0 0.0 0.0 122-123 5.5875 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.7125 0.0 0.0 0.0 0.0 128-129 7.1875 0.0 0.0 0.0 0.0 130-131 7.887499999999999 0.0 0.0 0.0 0.0 132-133 8.537500000000001 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.8625 0.0 0.0 0.0 0.0 138-139 10.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAGA 10 0.0068343505 144.975 2 AATAGGA 10 0.0068343505 144.975 8 GCTTGGG 10 0.0068343505 144.975 145 >>END_MODULE SRR7168846 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5645 33.0 33.0 34.0 32.0 34.0 2 32.7145 33.0 33.0 34.0 32.0 34.0 3 32.6775 33.0 33.0 34.0 31.0 34.0 4 32.681 33.0 33.0 34.0 32.0 34.0 5 32.64 34.0 33.0 34.0 32.0 34.0 6 36.78725 38.0 38.0 38.0 36.0 38.0 7 36.886 38.0 38.0 38.0 36.0 38.0 8 36.84525 38.0 38.0 38.0 36.0 38.0 9 36.781 38.0 38.0 38.0 36.0 38.0 10-14 36.778949999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.80065 38.0 38.0 38.0 36.0 38.0 20-24 36.718 38.0 38.0 38.0 36.0 38.0 25-29 36.737449999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.771 38.0 38.0 38.0 36.0 38.0 35-39 36.75019999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.731049999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.6747 38.0 38.0 38.0 36.0 38.0 50-54 36.60065 38.0 38.0 38.0 36.0 38.0 55-59 36.55165 38.0 38.0 38.0 35.4 38.0 60-64 36.5204 38.0 38.0 38.0 35.4 38.0 65-69 36.423700000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.306050000000006 38.0 38.0 38.0 34.4 38.0 75-79 36.199650000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.1051 38.0 38.0 38.0 34.0 38.0 85-89 36.01065 38.0 38.0 38.0 33.4 38.0 90-94 35.902249999999995 38.0 38.0 38.0 33.0 38.0 95-99 35.85265 38.0 38.0 38.0 33.0 38.0 100-104 35.7387 38.0 37.8 38.0 32.6 38.0 105-109 35.55615 38.0 37.4 38.0 31.4 38.0 110-114 35.386250000000004 38.0 37.0 38.0 31.0 38.0 115-119 35.26155 38.0 37.0 38.0 30.2 38.0 120-124 34.9979 38.0 36.0 38.0 28.2 38.0 125-129 34.74765 38.0 36.0 38.0 27.6 38.0 130-134 34.193650000000005 38.0 35.0 38.0 23.4 38.0 135-139 33.696250000000006 38.0 34.6 38.0 21.4 38.0 140-144 33.16330000000001 38.0 33.2 38.0 15.4 38.0 145-149 31.961850000000005 38.0 33.0 38.0 8.6 38.0 150-151 26.844749999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 4.0 4 5.0 5 3.0 6 1.0 7 5.0 8 6.0 9 0.0 10 2.0 11 5.0 12 5.0 13 3.0 14 8.0 15 5.0 16 3.0 17 2.0 18 7.0 19 4.0 20 7.0 21 15.0 22 10.0 23 14.0 24 22.0 25 15.0 26 26.0 27 32.0 28 29.0 29 58.0 30 47.0 31 49.0 32 88.0 33 106.0 34 137.0 35 265.0 36 598.0 37 2396.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.849999999999994 18.4 19.925 26.825 2 27.250000000000004 24.975 30.099999999999998 17.675 3 23.575 27.900000000000002 29.099999999999998 19.425 4 25.174999999999997 34.075 21.725 19.025 5 24.425 36.4 21.85 17.325 6 20.75 37.325 23.65 18.275 7 19.85 20.325 40.0 19.825 8 22.725 24.5 27.950000000000003 24.825 9 23.75 23.75 29.375 23.125 10-14 23.794999999999998 28.044999999999998 26.405 21.755 15-19 22.99 28.345 27.325 21.34 20-24 23.315 28.52 26.765 21.4 25-29 23.465 28.294999999999998 27.6 20.64 30-34 23.365 27.525 27.810000000000002 21.3 35-39 23.485 28.015 27.3 21.2 40-44 23.885 28.384999999999998 26.905 20.825 45-49 23.57 28.32 27.075 21.035 50-54 23.985 27.405 27.750000000000004 20.86 55-59 23.315 27.955000000000002 27.800000000000004 20.93 60-64 23.47 27.389999999999997 27.74 21.4 65-69 23.565 27.439999999999998 27.58 21.415 70-74 24.145 28.205000000000002 26.669999999999998 20.979999999999997 75-79 23.54 27.905 27.555000000000003 21.0 80-84 23.805 27.615000000000002 27.715 20.865000000000002 85-89 24.415 27.375 27.689999999999998 20.52 90-94 23.89 27.83 27.565 20.715 95-99 24.165 27.950000000000003 27.54 20.345 100-104 24.72 27.800000000000004 27.47 20.01 105-109 24.43 27.694999999999997 27.41 20.465 110-114 24.490000000000002 28.22 27.165 20.125 115-119 24.89 27.555000000000003 27.465 20.09 120-124 24.545 28.205000000000002 27.029999999999998 20.22 125-129 25.374999999999996 27.894999999999996 27.125 19.605 130-134 25.6 28.17 26.395000000000003 19.835 135-139 25.16 27.400000000000002 27.250000000000004 20.19 140-144 25.575 27.685 27.229999999999997 19.509999999999998 145-149 25.945 27.96 26.640000000000004 19.455 150-151 25.825 28.4 27.187499999999996 18.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 3.0 28 4.5 29 6.0 30 8.0 31 9.0 32 12.0 33 29.0 34 41.5 35 53.0 36 71.0 37 86.5 38 105.0 39 150.0 40 214.5 41 233.5 42 234.0 43 268.5 44 293.5 45 286.0 46 276.5 47 274.5 48 243.0 49 212.0 50 181.5 51 136.5 52 114.0 53 106.0 54 85.5 55 60.5 56 50.0 57 43.0 58 32.5 59 20.0 60 16.5 61 13.0 62 7.5 63 4.5 64 2.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2625000000000002 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1625 0.0 0.0 0.0 0.0 112-113 3.6500000000000004 0.0 0.0 0.0 0.0 114-115 4.1125 0.0 0.0 0.0 0.0 116-117 4.4375 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.199999999999999 0.0 0.0 0.0 0.0 122-123 5.6 0.0 0.0 0.0 0.0 124-125 6.1625 0.0 0.0 0.0 0.0 126-127 6.725 0.0 0.0 0.0 0.0 128-129 7.2125 0.0 0.0 0.0 0.0 130-131 7.887499999999999 0.0 0.0 0.0 0.0 132-133 8.5625 0.0 0.0 0.0 0.0 134-135 9.225 0.0 0.0 0.0 0.0 136-137 10.0 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATCC 10 0.006830828 145.0 8 >>END_MODULE Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra Read 813062 spots for SRR7168846.sra Written 813062 spots for SRR7168846.sra Read 813058 spots for SRR7168846.sra Written 813058 spots for SRR7168846.sra SRR ids: ['SRR7168846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4w735v4m SRR7168846.sra spots: 16261164 blocks: [[1, 813058], [813059, 1626116], [1626117, 2439174], [2439175, 3252232], [3252233, 4065290], [4065291, 4878348], [4878349, 5691406], [5691407, 6504464], [6504465, 7317522], [7317523, 8130580], [8130581, 8943638], [8943639, 9756696], [9756697, 10569754], [10569755, 11382812], [11382813, 12195870], [12195871, 13008928], [13008929, 13821986], [13821987, 14635044], [14635045, 15448102], [15448103, 16261164]] SRR7168846 file size 5488674 SRR7168846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168846 SRR7168846_1.fastq SRR7168846_2.fastq Input file: SRR7168846_1.fastq Paired file: SRR7168846_2.fastq trimmed: SRR7168846-trimmed-pair1.fastq, SRR7168846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 07:26:02 2025 >> started Sat Feb 15 07:26:28 2025 >> done (26.397s) 16261164 read pairs processed; of these: 34299 ( 0.21%) short read pairs filtered out after trimming by size control 69313 ( 0.43%) empty read pairs filtered out after trimming by size control 16157552 (99.36%) read pairs available; of these: 9689898 (59.97%) trimmed read pairs available after processing 6467654 (40.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 18 0.00% 25 4 0.00% 26 8 0.00% 27 14 0.00% 28 10 0.00% 29 12 0.00% 30 8 0.00% 31 21 0.00% 32 17 0.00% 33 10 0.00% 34 11 0.00% 35 21 0.00% 36 23 0.00% 37 19 0.00% 38 31 0.00% 39 38 0.00% 40 29 0.00% 41 27 0.00% 42 35 0.00% 43 50 0.00% 44 41 0.00% 45 64 0.00% 46 49 0.00% 47 85 0.00% 48 98 0.00% 49 106 0.00% 50 137 0.00% 51 109 0.00% 52 135 0.00% 53 128 0.00% 54 148 0.00% 55 180 0.00% 56 194 0.00% 57 215 0.00% 58 271 0.00% 59 299 0.00% 60 329 0.00% 61 391 0.00% 62 427 0.00% 63 505 0.00% 64 618 0.00% 65 719 0.00% 66 764 0.00% 67 962 0.01% 68 1293 0.01% 69 3836 0.02% 70 3053 0.02% 71 1697 0.01% 72 1742 0.01% 73 1935 0.01% 74 2168 0.01% 75 2485 0.02% 76 2756 0.02% 77 2976 0.02% 78 3348 0.02% 79 3770 0.02% 80 4112 0.03% 81 4761 0.03% 82 5357 0.03% 83 6280 0.04% 84 8151 0.05% 85 9119 0.06% 86 9634 0.06% 87 10483 0.06% 88 11186 0.07% 89 11823 0.07% 90 12681 0.08% 91 13498 0.08% 92 14659 0.09% 93 15843 0.10% 94 16640 0.10% 95 17681 0.11% 96 18942 0.12% 97 19795 0.12% 98 20572 0.13% 99 21534 0.13% 100 22648 0.14% 101 23434 0.15% 102 25008 0.15% 103 26110 0.16% 104 28057 0.17% 105 29708 0.18% 106 31168 0.19% 107 31766 0.20% 108 33216 0.21% 109 34400 0.21% 110 35461 0.22% 111 36521 0.23% 112 38198 0.24% 113 40637 0.25% 114 41973 0.26% 115 43915 0.27% 116 45513 0.28% 117 46701 0.29% 118 48376 0.30% 119 48903 0.30% 120 50909 0.32% 121 52699 0.33% 122 54041 0.33% 123 56548 0.35% 124 59421 0.37% 125 61359 0.38% 126 63925 0.40% 127 66393 0.41% 128 68178 0.42% 129 70566 0.44% 130 72950 0.45% 131 74916 0.46% 132 78649 0.49% 133 82328 0.51% 134 86201 0.53% 135 91128 0.56% 136 96910 0.60% 137 102369 0.63% 138 108335 0.67% 139 115583 0.72% 140 123145 0.76% 141 133163 0.82% 142 145610 0.90% 143 162209 1.00% 144 186815 1.16% 145 220594 1.37% 146 273905 1.70% 147 365077 2.26% 148 536687 3.32% 149 1012892 6.27% 150 4013466 24.84% 151 6467654 40.03% 16157552 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=50.42 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.48 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=52.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCTAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7168846 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 07:27:47 Started mapping on | Feb 15 07:27:47 Finished on | Feb 15 07:29:44 Mapping speed, Million of reads per hour | 497.16 Number of input reads | 16157552 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14814964 Uniquely mapped reads % | 91.69% Average mapped length | 289.72 Number of splices: Total | 13749539 Number of splices: Annotated (sjdb) | 13398123 Number of splices: GT/AG | 13468232 Number of splices: GC/AG | 231427 Number of splices: AT/AC | 8357 Number of splices: Non-canonical | 41523 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 523506 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 52182 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847266 847266 847266 N_multimapping 523506 523506 523506 N_noFeature 420794 14500688 578346 N_ambiguous 280265 1670 122323 UnstrandedReadsAssigned:14113905 PositiveStrandReadsAssigned:312606 NegativeStrandReadsAssigned:14114295 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168846-trimmed-pair1.fastq SRR7168846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,157,552 reads, 14,189,211 reads pseudoaligned [quant] estimated average fragment length: 221.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7168846.ke.tsv 34699 SRR7168846.se.tsv 87100 total ==> SRR7168846.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.75 717 25.709 Potri.005G024800.1.v4.1 1035 814.748 121 9.57321 Potri.004G059700.1.v4.1 961 740.758 17 1.47934 Potri.007G009000.2.v4.1 1416 1195.75 0 0 Potri.003G141000.2.v4.1 2943 2722.75 614.284 14.5431 Potri.016G087400.1.v4.1 270 89.0852 961 695.365 Potri.015G069301.1.v4.1 564 346.472 0 0 Potri.010G195200.1.v4.1 1773 1552.75 20 0.830279 Potri.012G127500.1.v4.1 977 756.758 171 14.5658 ==> SRR7168846.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1025 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 207 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 200 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7168846 completed mapping pipeline successfully