Starting /dee2/code/volunteer_pipeline.sh SRR7168847 current disk space = 3093115666432 free memory = 1459406224 SRR7168847 SRAfilesize 7d21941fefb7679a19474ae2ad1f1d43 SRR7168847.sra SRR7168847.sra file validated SRR7168847 is paired end SRR7168847 is conventional basespace SRR7168847 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1675 34.0 33.0 34.0 32.0 34.0 2 33.086 34.0 33.0 34.0 32.0 34.0 3 33.07875 34.0 33.0 34.0 32.0 34.0 4 33.194 34.0 33.0 34.0 32.0 34.0 5 33.246 34.0 33.0 34.0 33.0 34.0 6 37.0535 38.0 37.0 38.0 36.0 38.0 7 37.38525 38.0 38.0 38.0 37.0 38.0 8 37.39775 38.0 38.0 38.0 37.0 38.0 9 37.40025 38.0 38.0 38.0 37.0 38.0 10-14 37.43015 38.0 38.0 38.0 37.0 38.0 15-19 37.4564 38.0 38.0 38.0 37.2 38.0 20-24 37.43775 38.0 38.0 38.0 37.0 38.0 25-29 37.3737 38.0 38.0 38.0 37.0 38.0 30-34 37.3476 38.0 38.0 38.0 37.0 38.0 35-39 37.333600000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.25025 38.0 38.0 38.0 36.6 38.0 45-49 37.229600000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.21175 38.0 38.0 38.0 36.6 38.0 55-59 37.15445 38.0 38.0 38.0 36.2 38.0 60-64 37.1147 38.0 38.0 38.0 36.0 38.0 65-69 37.0629 38.0 38.0 38.0 36.0 38.0 70-74 36.9755 38.0 38.0 38.0 36.0 38.0 75-79 36.794200000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.79090000000001 38.0 38.0 38.0 35.2 38.0 85-89 36.68155 38.0 38.0 38.0 34.8 38.0 90-94 36.6402 38.0 38.0 38.0 34.8 38.0 95-99 36.4138 38.0 38.0 38.0 34.0 38.0 100-104 36.248450000000005 38.0 38.0 38.0 33.8 38.0 105-109 36.2197 38.0 37.4 38.0 33.4 38.0 110-114 35.99300000000001 38.0 37.0 38.0 32.6 38.0 115-119 35.851549999999996 38.0 37.0 38.0 32.2 38.0 120-124 35.5224 38.0 36.4 38.0 30.6 38.0 125-129 35.113350000000004 38.0 36.0 38.0 28.2 38.0 130-134 34.9255 38.0 35.6 38.0 28.0 38.0 135-139 34.57885 38.0 34.6 38.0 26.8 38.0 140-144 34.14815 38.0 34.0 38.0 24.4 38.0 145-149 33.2053 38.0 33.0 38.0 18.2 38.0 150-151 29.448999999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 4.0 18 3.0 19 6.0 20 5.0 21 7.0 22 11.0 23 5.0 24 9.0 25 14.0 26 21.0 27 17.0 28 30.0 29 49.0 30 45.0 31 60.0 32 70.0 33 110.0 34 140.0 35 254.0 36 722.0 37 2414.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35950413223141 13.145661157024794 12.422520661157025 35.07231404958678 2 22.125 16.5 34.975 26.400000000000002 3 20.125 23.525 26.55 29.799999999999997 4 22.175 31.05 21.9 24.875 5 21.15 35.85 23.575 19.425 6 18.224999999999998 36.675000000000004 25.525 19.575 7 13.925 24.85 42.449999999999996 18.775 8 17.325 25.5 30.25 26.924999999999997 9 17.325 24.75 32.875 25.05 10-14 20.015 30.044999999999998 26.645000000000003 23.294999999999998 15-19 19.675 28.57 27.650000000000002 24.104999999999997 20-24 19.675 28.694999999999997 27.950000000000003 23.68 25-29 19.585 28.735 27.744999999999997 23.935000000000002 30-34 20.14 28.499999999999996 27.55 23.810000000000002 35-39 19.74 28.52 27.955000000000002 23.785 40-44 19.595000000000002 28.645 27.6 24.16 45-49 20.18 28.475 27.884999999999998 23.46 50-54 20.125 28.455000000000002 27.939999999999998 23.48 55-59 20.14 28.165000000000003 27.675 24.02 60-64 20.095 28.925 27.11 23.87 65-69 20.06 29.04 27.205000000000002 23.695 70-74 19.77 28.555000000000003 27.485 24.19 75-79 20.025000000000002 28.59 28.084999999999997 23.3 80-84 20.06 28.07 27.634999999999998 24.235 85-89 19.509999999999998 28.305000000000003 28.395 23.79 90-94 20.53 27.52 28.055000000000003 23.895 95-99 20.315 28.29 27.42 23.974999999999998 100-104 20.599999999999998 27.93 27.625 23.845 105-109 20.05 28.51 27.325 24.115000000000002 110-114 20.73 28.34 27.265 23.665 115-119 20.705000000000002 28.415000000000003 26.955000000000002 23.925 120-124 20.419999999999998 28.48 27.36 23.74 125-129 20.665 28.065 26.68 24.59 130-134 20.705000000000002 28.249999999999996 27.334999999999997 23.71 135-139 21.044999999999998 27.87 27.034999999999997 24.05 140-144 20.93 27.485 27.095000000000002 24.490000000000002 145-149 21.035 28.299999999999997 26.8 23.865 150-151 20.825 26.987499999999997 27.487499999999997 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 5.0 27 8.5 28 10.0 29 13.5 30 17.0 31 25.5 32 38.0 33 50.5 34 57.0 35 76.0 36 94.5 37 110.0 38 136.0 39 157.0 40 181.5 41 222.5 42 253.0 43 249.0 44 256.0 45 273.0 46 254.0 47 238.0 48 231.0 49 204.5 50 186.0 51 159.0 52 125.0 53 92.0 54 76.0 55 63.0 56 40.0 57 26.0 58 19.0 59 16.0 60 8.5 61 6.0 62 5.0 63 3.5 64 2.0 65 0.5 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.5033979360684621 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025169896803423106 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 23 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.887499999999999 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168847 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72475 33.0 33.0 34.0 32.0 34.0 2 32.84975 33.0 33.0 34.0 32.0 34.0 3 32.81725 33.0 33.0 34.0 31.0 34.0 4 32.78725 33.0 33.0 34.0 32.0 34.0 5 32.8425 34.0 33.0 34.0 32.0 34.0 6 37.02575 38.0 38.0 38.0 36.0 38.0 7 36.93075 38.0 38.0 38.0 36.0 38.0 8 36.94775 38.0 38.0 38.0 36.0 38.0 9 36.92325 38.0 38.0 38.0 36.0 38.0 10-14 36.9737 38.0 38.0 38.0 36.4 38.0 15-19 36.929199999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.956050000000005 38.0 38.0 38.0 36.6 38.0 25-29 36.9375 38.0 38.0 38.0 36.4 38.0 30-34 36.9611 38.0 38.0 38.0 36.0 38.0 35-39 36.907650000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.9125 38.0 38.0 38.0 36.4 38.0 45-49 36.857749999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.78495 38.0 38.0 38.0 36.0 38.0 55-59 36.7744 38.0 38.0 38.0 36.0 38.0 60-64 36.739999999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.72634999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.53045 38.0 38.0 38.0 35.0 38.0 75-79 36.44455 38.0 38.0 38.0 34.6 38.0 80-84 36.317150000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.24974999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.21065 38.0 38.0 38.0 34.0 38.0 95-99 36.101350000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.04705 38.0 38.0 38.0 33.8 38.0 105-109 35.888400000000004 38.0 37.8 38.0 33.2 38.0 110-114 35.6644 38.0 37.4 38.0 31.8 38.0 115-119 35.53235 38.0 37.0 38.0 31.0 38.0 120-124 35.34454999999999 38.0 37.0 38.0 30.2 38.0 125-129 35.18245 38.0 36.0 38.0 29.8 38.0 130-134 34.6962 38.0 35.6 38.0 27.6 38.0 135-139 34.17605 38.0 34.6 38.0 23.2 38.0 140-144 33.67784999999999 38.0 33.4 38.0 22.6 38.0 145-149 32.68325 38.0 33.0 38.0 12.6 38.0 150-151 27.725875000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 0.0 5 3.0 6 3.0 7 3.0 8 0.0 9 3.0 10 3.0 11 2.0 12 3.0 13 4.0 14 3.0 15 0.0 16 8.0 17 6.0 18 6.0 19 10.0 20 3.0 21 7.0 22 13.0 23 11.0 24 23.0 25 16.0 26 19.0 27 23.0 28 35.0 29 44.0 30 59.0 31 48.0 32 68.0 33 92.0 34 151.0 35 221.0 36 592.0 37 2504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.4 19.25 17.025000000000002 26.325 2 27.650000000000002 25.624999999999996 30.5 16.225 3 22.95 28.499999999999996 29.4 19.15 4 23.974999999999998 34.875 22.7 18.45 5 24.975 36.625 21.349999999999998 17.05 6 20.849999999999998 37.675 22.85 18.625 7 19.275000000000002 19.425 40.300000000000004 21.0 8 22.55 24.2 27.775 25.474999999999998 9 22.275 26.05 27.625 24.05 10-14 23.535 28.845 26.06 21.560000000000002 15-19 23.425 28.08 27.685 20.810000000000002 20-24 23.925 28.365000000000002 26.75 20.96 25-29 22.805 28.799999999999997 27.605 20.79 30-34 23.205000000000002 27.73 27.655 21.41 35-39 23.05 27.77 27.735 21.445 40-44 23.65 27.295 28.095 20.96 45-49 23.51 28.08 27.315 21.095 50-54 23.86 27.98 26.895000000000003 21.265 55-59 24.16 27.595 27.74 20.505000000000003 60-64 22.695 28.499999999999996 27.67 21.135 65-69 24.04 27.54 27.615000000000002 20.805 70-74 23.135 28.01 27.794999999999998 21.060000000000002 75-79 22.875 27.91 28.244999999999997 20.97 80-84 23.485 28.845 27.1 20.57 85-89 24.165 27.334999999999997 27.6 20.9 90-94 23.87 27.88 27.605 20.645 95-99 24.07 27.58 27.99 20.36 100-104 24.240000000000002 28.065 27.575 20.119999999999997 105-109 24.610000000000003 27.315 27.485 20.59 110-114 23.865 28.470000000000002 27.425 20.24 115-119 23.685000000000002 28.904999999999998 27.395000000000003 20.015 120-124 24.34 27.425 27.235 21.0 125-129 24.665 28.475 26.805 20.055 130-134 24.917491749174918 27.632763276327633 27.47274727472747 19.976997699769978 135-139 25.255 27.694999999999997 27.365000000000002 19.685 140-144 25.145 28.035 26.85 19.97 145-149 25.455 27.805000000000003 27.215 19.525000000000002 150-151 25.637500000000003 28.375 26.424999999999997 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 1.0 25 1.5 26 2.0 27 3.0 28 4.5 29 7.5 30 10.5 31 14.0 32 16.5 33 20.0 34 35.5 35 58.5 36 79.0 37 101.0 38 140.0 39 173.5 40 194.0 41 227.5 42 239.0 43 246.5 44 273.5 45 292.0 46 293.0 47 266.5 48 232.0 49 202.0 50 178.5 51 146.0 52 126.0 53 110.5 54 77.5 55 64.0 56 48.5 57 30.5 58 22.0 59 14.5 60 10.0 61 7.5 62 8.5 63 5.5 64 1.5 65 1.0 66 2.5 67 3.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.6555723651033787 1.3 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACCT 10 0.006830828 145.0 1 TTTGGAG 10 0.006830828 145.0 4 TTGGAGA 10 0.006830828 145.0 5 >>END_MODULE Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056317 spots for SRR7168847.sra Written 1056317 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra Read 1056302 spots for SRR7168847.sra Written 1056302 spots for SRR7168847.sra SRR ids: ['SRR7168847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5nhkfi6_ SRR7168847.sra spots: 21126055 blocks: [[1, 1056302], [1056303, 2112604], [2112605, 3168906], [3168907, 4225208], [4225209, 5281510], [5281511, 6337812], [6337813, 7394114], [7394115, 8450416], [8450417, 9506718], [9506719, 10563020], [10563021, 11619322], [11619323, 12675624], [12675625, 13731926], [13731927, 14788228], [14788229, 15844530], [15844531, 16900832], [16900833, 17957134], [17957135, 19013436], [19013437, 20069738], [20069739, 21126055]] SRR7168847 file size 7137226 SRR7168847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168847 SRR7168847_1.fastq SRR7168847_2.fastq Input file: SRR7168847_1.fastq Paired file: SRR7168847_2.fastq trimmed: SRR7168847-trimmed-pair1.fastq, SRR7168847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 06:09:25 2025 >> started Sat Feb 15 06:09:51 2025 >> done (26.314s) 21126055 read pairs processed; of these: 44230 ( 0.21%) short read pairs filtered out after trimming by size control 67111 ( 0.32%) empty read pairs filtered out after trimming by size control 21014714 (99.47%) read pairs available; of these: 12000068 (57.10%) trimmed read pairs available after processing 9014646 (42.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 11 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 12 0.00% 25 10 0.00% 26 6 0.00% 27 18 0.00% 28 16 0.00% 29 13 0.00% 30 17 0.00% 31 21 0.00% 32 12 0.00% 33 18 0.00% 34 27 0.00% 35 24 0.00% 36 24 0.00% 37 24 0.00% 38 26 0.00% 39 29 0.00% 40 30 0.00% 41 40 0.00% 42 48 0.00% 43 40 0.00% 44 65 0.00% 45 65 0.00% 46 70 0.00% 47 84 0.00% 48 99 0.00% 49 123 0.00% 50 101 0.00% 51 150 0.00% 52 128 0.00% 53 132 0.00% 54 186 0.00% 55 205 0.00% 56 210 0.00% 57 239 0.00% 58 258 0.00% 59 303 0.00% 60 338 0.00% 61 408 0.00% 62 449 0.00% 63 518 0.00% 64 606 0.00% 65 671 0.00% 66 817 0.00% 67 901 0.00% 68 1224 0.01% 69 2972 0.01% 70 2334 0.01% 71 1603 0.01% 72 1659 0.01% 73 1887 0.01% 74 2119 0.01% 75 2356 0.01% 76 2568 0.01% 77 2772 0.01% 78 3153 0.02% 79 3581 0.02% 80 3931 0.02% 81 4558 0.02% 82 5332 0.03% 83 6082 0.03% 84 8109 0.04% 85 9482 0.05% 86 10013 0.05% 87 10772 0.05% 88 11425 0.05% 89 11960 0.06% 90 12803 0.06% 91 13874 0.07% 92 14747 0.07% 93 15979 0.08% 94 17480 0.08% 95 18343 0.09% 96 19397 0.09% 97 20162 0.10% 98 20809 0.10% 99 22262 0.11% 100 23166 0.11% 101 24403 0.12% 102 26708 0.13% 103 28223 0.13% 104 29918 0.14% 105 31515 0.15% 106 33310 0.16% 107 34540 0.16% 108 35795 0.17% 109 37557 0.18% 110 38279 0.18% 111 39981 0.19% 112 42497 0.20% 113 44170 0.21% 114 46071 0.22% 115 48809 0.23% 116 50723 0.24% 117 52123 0.25% 118 53703 0.26% 119 55316 0.26% 120 56497 0.27% 121 59221 0.28% 122 61502 0.29% 123 64956 0.31% 124 67960 0.32% 125 70521 0.34% 126 73824 0.35% 127 76610 0.36% 128 79523 0.38% 129 82104 0.39% 130 85974 0.41% 131 87982 0.42% 132 91869 0.44% 133 97674 0.46% 134 102083 0.49% 135 108410 0.52% 136 114958 0.55% 137 121690 0.58% 138 129354 0.62% 139 138623 0.66% 140 149049 0.71% 141 161351 0.77% 142 176558 0.84% 143 197560 0.94% 144 226802 1.08% 145 267301 1.27% 146 334206 1.59% 147 444003 2.11% 148 654387 3.11% 149 1251050 5.95% 150 5296294 25.20% 151 9014646 42.90% 21014714 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=366.36 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=114.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTC SRR7168847 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 06:11:32 Started mapping on | Feb 15 06:11:32 Finished on | Feb 15 06:14:03 Mapping speed, Million of reads per hour | 501.01 Number of input reads | 21014714 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19589988 Uniquely mapped reads % | 93.22% Average mapped length | 291.29 Number of splices: Total | 18796706 Number of splices: Annotated (sjdb) | 18387854 Number of splices: GT/AG | 18439091 Number of splices: GC/AG | 301480 Number of splices: AT/AC | 10233 Number of splices: Non-canonical | 45902 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 498505 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 49680 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 965522 965522 965522 N_multimapping 498505 498505 498505 N_noFeature 603414 19210584 791862 N_ambiguous 314477 1424 122626 UnstrandedReadsAssigned:18672097 PositiveStrandReadsAssigned:377980 NegativeStrandReadsAssigned:18675500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168847-trimmed-pair1.fastq SRR7168847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,014,714 reads, 18,681,268 reads pseudoaligned [quant] estimated average fragment length: 229.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7168847.ke.tsv 34699 SRR7168847.se.tsv 87100 total ==> SRR7168847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.91 723 21.1222 Potri.005G024800.1.v4.1 1035 806.912 292 18.9229 Potri.004G059700.1.v4.1 961 732.934 25 1.78364 Potri.007G009000.2.v4.1 1416 1187.91 0 0 Potri.003G141000.2.v4.1 2943 2714.91 1233.45 23.7573 Potri.016G087400.1.v4.1 270 85.5012 947 579.175 Potri.015G069301.1.v4.1 564 339.321 0 0 Potri.010G195200.1.v4.1 1773 1544.91 15 0.507714 Potri.012G127500.1.v4.1 977 748.923 187 13.0568 ==> SRR7168847.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1684 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 6 SRR7168847 completed mapping pipeline successfully