Starting /dee2/code/volunteer_pipeline.sh SRR7168848 current disk space = 3093115666432 free memory = 1449564784 SRR7168848 SRAfilesize 1e304186e4c11202bd1f361af978154b SRR7168848.sra SRR7168848.sra file validated SRR7168848 is paired end SRR7168848 is conventional basespace SRR7168848 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.76975 34.0 33.0 34.0 32.0 34.0 2 33.1875 34.0 33.0 34.0 32.0 34.0 3 33.30775 34.0 33.0 34.0 32.0 34.0 4 33.454 34.0 34.0 34.0 33.0 34.0 5 33.481 34.0 34.0 34.0 33.0 34.0 6 37.18275 38.0 38.0 38.0 36.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.529 38.0 38.0 38.0 37.0 38.0 9 37.53325 38.0 38.0 38.0 37.0 38.0 10-14 37.568400000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.53715 38.0 38.0 38.0 37.8 38.0 20-24 37.452600000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.4184 38.0 38.0 38.0 37.2 38.0 30-34 37.44715 38.0 38.0 38.0 37.2 38.0 35-39 37.45325 38.0 38.0 38.0 37.4 38.0 40-44 37.43745 38.0 38.0 38.0 37.4 38.0 45-49 37.35055 38.0 38.0 38.0 37.0 38.0 50-54 37.392849999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.33585 38.0 38.0 38.0 37.0 38.0 60-64 37.237049999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.21 38.0 38.0 38.0 36.8 38.0 70-74 37.116499999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.08559999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.019450000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.99640000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.7916 38.0 38.0 38.0 35.2 38.0 95-99 36.77255 38.0 38.0 38.0 35.0 38.0 100-104 36.6648 38.0 38.0 38.0 34.8 38.0 105-109 36.5991 38.0 38.0 38.0 34.8 38.0 110-114 36.440250000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.27374999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.086800000000004 38.0 37.2 38.0 33.2 38.0 125-129 35.962199999999996 38.0 37.0 38.0 32.6 38.0 130-134 35.429500000000004 38.0 36.0 38.0 30.2 38.0 135-139 35.23415000000001 38.0 36.0 38.0 29.6 38.0 140-144 34.7458 38.0 35.2 38.0 28.0 38.0 145-149 33.964749999999995 38.0 33.2 38.0 25.0 38.0 150-151 29.1275 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 3.0 19 3.0 20 1.0 21 3.0 22 4.0 23 9.0 24 9.0 25 8.0 26 9.0 27 18.0 28 19.0 29 31.0 30 31.0 31 57.0 32 53.0 33 85.0 34 125.0 35 215.0 36 628.0 37 2678.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.895001322401484 11.00238032266596 12.853742396191484 39.248875958741074 2 21.125 18.2 34.125 26.55 3 19.925 22.575 25.624999999999996 31.874999999999996 4 22.1 31.65 21.45 24.8 5 22.18054513628407 35.8589647411853 23.755938984746187 18.204551137784446 6 18.975 36.15 25.674999999999997 19.2 7 14.274999999999999 24.2 43.225 18.3 8 18.4 24.725 30.55 26.325 9 16.975 24.925 33.95 24.15 10-14 19.33 29.515 27.29 23.865 15-19 19.7 28.63 28.38 23.29 20-24 19.689999999999998 28.615000000000002 28.060000000000002 23.635 25-29 19.495 28.59 27.950000000000003 23.965 30-34 19.735 28.57 28.044999999999998 23.65 35-39 20.04 29.145 27.515 23.3 40-44 19.259999999999998 28.59 28.24 23.91 45-49 19.645000000000003 28.77 27.975 23.61 50-54 19.915 28.42 28.04 23.625 55-59 20.025000000000002 28.59 27.884999999999998 23.5 60-64 19.615 28.065 28.660000000000004 23.66 65-69 19.675 28.53 28.215 23.580000000000002 70-74 19.555 28.970000000000002 27.939999999999998 23.535 75-79 19.965 28.560000000000002 27.810000000000002 23.665 80-84 20.095 28.754999999999995 27.445000000000004 23.705000000000002 85-89 20.4 28.415000000000003 27.29 23.895 90-94 20.285 28.51 27.939999999999998 23.265 95-99 20.385 28.655 27.644999999999996 23.315 100-104 20.369999999999997 29.165000000000003 27.334999999999997 23.13 105-109 20.385 28.15 27.625 23.84 110-114 20.055 29.104999999999997 27.445000000000004 23.395 115-119 20.52 28.144999999999996 27.889999999999997 23.445 120-124 20.605 28.294999999999998 27.689999999999998 23.41 125-129 20.3 28.244999999999997 27.625 23.830000000000002 130-134 20.74 28.64 27.345000000000002 23.275000000000002 135-139 20.835 28.499999999999996 26.924999999999997 23.74 140-144 20.39 28.71 27.055 23.845 145-149 20.72 28.63 27.084999999999997 23.565 150-151 20.13540621865597 28.309929789368105 28.07171514543631 23.48294884653962 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 2.5 25 3.0 26 5.0 27 11.0 28 15.0 29 18.5 30 19.5 31 25.0 32 32.5 33 51.0 34 69.5 35 75.0 36 96.5 37 114.5 38 145.0 39 185.0 40 195.5 41 226.0 42 260.5 43 256.0 44 256.5 45 264.5 46 251.5 47 233.5 48 212.5 49 201.5 50 177.5 51 119.0 52 88.0 53 84.0 54 75.5 55 58.5 56 44.5 57 32.0 58 19.5 59 15.5 60 14.0 61 9.5 62 6.0 63 5.5 64 3.5 65 1.5 66 0.5 67 1.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.475 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.612500000000001 0.0 0.0 0.0 0.0 134-135 5.949999999999999 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAG 10 0.0068343505 144.975 9 CCCATAA 25 7.8693073E-4 89.215385 1 GGGGGGG 20 0.005940113 28.995 95-99 >>END_MODULE SRR7168848 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7485 33.0 33.0 34.0 32.0 34.0 2 32.87175 34.0 33.0 34.0 32.0 34.0 3 32.90375 34.0 33.0 34.0 32.0 34.0 4 32.9495 34.0 33.0 34.0 32.0 34.0 5 32.979 34.0 33.0 34.0 32.0 34.0 6 37.1365 38.0 38.0 38.0 37.0 38.0 7 37.1675 38.0 38.0 38.0 37.0 38.0 8 37.08525 38.0 38.0 38.0 37.0 38.0 9 37.08575 38.0 38.0 38.0 37.0 38.0 10-14 37.06575 38.0 38.0 38.0 37.0 38.0 15-19 37.0439 38.0 38.0 38.0 37.0 38.0 20-24 36.986549999999994 38.0 38.0 38.0 36.6 38.0 25-29 36.936150000000005 38.0 38.0 38.0 36.2 38.0 30-34 36.9962 38.0 38.0 38.0 36.8 38.0 35-39 36.933749999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.9481 38.0 38.0 38.0 36.4 38.0 45-49 36.8669 38.0 38.0 38.0 36.0 38.0 50-54 36.79545 38.0 38.0 38.0 36.0 38.0 55-59 36.736850000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.61135 38.0 38.0 38.0 34.8 38.0 65-69 36.587199999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.459050000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.332550000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.09045 38.0 38.0 38.0 33.4 38.0 85-89 35.9029 38.0 37.8 38.0 32.2 38.0 90-94 35.73195 38.0 37.0 38.0 31.4 38.0 95-99 35.6443 38.0 37.0 38.0 30.6 38.0 100-104 35.4328 38.0 37.0 38.0 29.0 38.0 105-109 35.381449999999994 38.0 37.0 38.0 29.4 38.0 110-114 35.08715 38.0 36.2 38.0 28.0 38.0 115-119 34.706050000000005 38.0 36.0 38.0 26.4 38.0 120-124 34.15899999999999 38.0 35.0 38.0 23.2 38.0 125-129 33.796499999999995 38.0 34.6 38.0 22.2 38.0 130-134 33.061899999999994 38.0 33.6 38.0 15.0 38.0 135-139 32.09215 38.0 31.6 38.0 13.0 38.0 140-144 31.3479 38.0 30.8 38.0 12.8 38.0 145-149 29.954449999999998 36.6 28.2 38.0 2.0 38.0 150-151 24.422 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 1.0 11 3.0 12 1.0 13 3.0 14 4.0 15 9.0 16 2.0 17 8.0 18 7.0 19 13.0 20 9.0 21 15.0 22 22.0 23 23.0 24 22.0 25 33.0 26 32.0 27 28.0 28 48.0 29 39.0 30 66.0 31 72.0 32 96.0 33 124.0 34 184.0 35 373.0 36 804.0 37 1938.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.937891309792136 18.80791384923616 17.230152767342847 28.024042073628852 2 29.172932330827066 24.260651629072683 31.629072681704262 14.93734335839599 3 21.779448621553886 29.448621553884713 27.79448621553885 20.977443609022554 4 22.436700927550763 35.89872148408123 23.66507896715969 17.999498621208325 5 24.285714285714285 36.140350877192986 22.481203007518797 17.092731829573935 6 19.459053343350863 38.868019033308286 23.340846481342346 18.332081141998497 7 19.158527422990232 19.534184823441024 40.52091159529176 20.786376158276983 8 21.28725269221137 24.793388429752067 29.301277235161532 24.61808164287503 9 21.888304532932633 24.693213122965187 30.102679689456547 23.31580265464563 10-14 23.72006812944595 28.684500551046987 26.871055004508566 20.724376314998498 15-19 22.729322178247582 28.17995090426331 28.0496969089725 21.041030008516607 20-24 22.639334402566156 28.583600641539697 28.112469927826783 20.66459502806736 25-29 22.85213032581454 28.61152882205514 27.689223057644107 20.847117794486216 30-34 22.707226621228827 27.84905282148943 28.946577127393002 20.497143429888744 35-39 22.503509123721678 28.183276518949267 27.95768999398436 21.355524363344696 40-44 23.24416391143172 28.043282236248874 27.95812042881475 20.754433423504658 45-49 22.903516681695223 27.90301572988679 28.238653441538926 20.95481414687907 50-54 23.19603126879134 27.846261775906996 28.116857085588293 20.840849869713367 55-59 22.880336740829826 27.79615153337342 28.367408298256162 20.95610342754059 60-64 22.673078849814647 27.462178138463077 28.639414888287746 21.225328123434526 65-69 23.18796992481203 27.503759398496243 28.365914786967416 20.94235588972431 70-74 23.440084197864984 27.935648774620358 28.286473212048314 20.337793815466345 75-79 23.561547714514834 28.483360064153967 27.636327185244586 20.31876503608661 80-84 23.220016044925792 28.35439229843562 27.201163257119937 21.22442839951865 85-89 23.296394724966156 27.653813368099083 28.451085593942736 20.598706312992025 90-94 23.104675051360424 27.910006514005108 28.105426667334772 20.879891767299693 95-99 24.144838984324135 27.92607802874743 28.141433365052336 19.787649621876096 100-104 23.4872770987778 28.55640152274093 27.534562211981566 20.4217591664997 105-109 23.715058611361588 28.288748622382524 27.291854523594832 20.704338242661056 110-114 23.474296021645454 28.56498647159034 27.6630924942379 20.297625012526304 115-119 24.31592663125188 28.164778991680866 27.40302696201263 20.116267415054626 120-124 24.16921457571049 28.374517568041703 27.522429953385796 19.933837902862013 125-129 24.239386496917447 28.374517568041703 27.2116685880407 20.17442734700015 130-134 25.037609066292248 28.071407080533543 27.2690803329656 19.621903520208605 135-139 24.62155388471178 27.764411027568926 27.73934837092732 19.87468671679198 140-144 24.668036277997697 28.501277747156383 27.188455178634065 19.642230796211855 145-149 24.921104042478586 28.833341682111907 27.20032059309723 19.045233682312276 150-151 24.690431519699814 27.879924953095685 27.392120075046904 20.0375234521576 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 3.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 4.5 28 10.0 29 16.5 30 22.5 31 26.5 32 35.0 33 44.5 34 49.5 35 65.0 36 87.0 37 116.0 38 139.5 39 169.0 40 209.0 41 233.0 42 247.5 43 262.0 44 260.5 45 263.5 46 256.5 47 249.5 48 245.0 49 204.5 50 167.0 51 134.0 52 105.0 53 83.0 54 63.5 55 48.0 56 44.5 57 32.5 58 18.0 59 18.5 60 16.0 61 10.5 62 5.0 63 5.0 64 5.0 65 3.0 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.25 3 0.25 4 0.27499999999999997 5 0.25 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.19 15-19 0.19499999999999998 20-24 0.24 25-29 0.25 30-34 0.22999999999999998 35-39 0.26 40-44 0.19 45-49 0.19 50-54 0.22 55-59 0.22 60-64 0.19 65-69 0.25 70-74 0.23500000000000001 75-79 0.24 80-84 0.27999999999999997 85-89 0.28500000000000003 90-94 0.215 95-99 0.165 100-104 0.18 105-109 0.19 110-114 0.21 115-119 0.22999999999999998 120-124 0.245 125-129 0.245 130-134 0.29 135-139 0.25 140-144 0.215 145-149 0.185 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.6555723651033787 1.3 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.4625000000000004 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.112500000000001 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.2625 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCTT 10 0.006830828 145.0 6 >>END_MODULE Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869787 spots for SRR7168848.sra Written 869787 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra Read 869772 spots for SRR7168848.sra Written 869772 spots for SRR7168848.sra SRR ids: ['SRR7168848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6rvph4a8 SRR7168848.sra spots: 17395455 blocks: [[1, 869772], [869773, 1739544], [1739545, 2609316], [2609317, 3479088], [3479089, 4348860], [4348861, 5218632], [5218633, 6088404], [6088405, 6958176], [6958177, 7827948], [7827949, 8697720], [8697721, 9567492], [9567493, 10437264], [10437265, 11307036], [11307037, 12176808], [12176809, 13046580], [13046581, 13916352], [13916353, 14786124], [14786125, 15655896], [15655897, 16525668], [16525669, 17395455]] SRR7168848 file size 5873048 SRR7168848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168848 SRR7168848_1.fastq SRR7168848_2.fastq Input file: SRR7168848_1.fastq Paired file: SRR7168848_2.fastq trimmed: SRR7168848-trimmed-pair1.fastq, SRR7168848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 06:07:14 2025 >> started Sat Feb 15 06:07:42 2025 >> done (28.601s) 17395455 read pairs processed; of these: 18748 ( 0.11%) short read pairs filtered out after trimming by size control 42655 ( 0.25%) empty read pairs filtered out after trimming by size control 17334052 (99.65%) read pairs available; of these: 9446598 (54.50%) trimmed read pairs available after processing 7887454 (45.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 10 0.00% 20 6 0.00% 21 8 0.00% 22 7 0.00% 23 3 0.00% 24 7 0.00% 25 6 0.00% 26 9 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 8 0.00% 31 11 0.00% 32 9 0.00% 33 8 0.00% 34 13 0.00% 35 16 0.00% 36 13 0.00% 37 18 0.00% 38 19 0.00% 39 13 0.00% 40 14 0.00% 41 26 0.00% 42 25 0.00% 43 27 0.00% 44 26 0.00% 45 39 0.00% 46 36 0.00% 47 45 0.00% 48 68 0.00% 49 62 0.00% 50 80 0.00% 51 81 0.00% 52 91 0.00% 53 93 0.00% 54 101 0.00% 55 141 0.00% 56 128 0.00% 57 176 0.00% 58 176 0.00% 59 206 0.00% 60 217 0.00% 61 287 0.00% 62 282 0.00% 63 343 0.00% 64 393 0.00% 65 425 0.00% 66 480 0.00% 67 531 0.00% 68 651 0.00% 69 1024 0.01% 70 989 0.01% 71 964 0.01% 72 1097 0.01% 73 1161 0.01% 74 1287 0.01% 75 1401 0.01% 76 1633 0.01% 77 1871 0.01% 78 2020 0.01% 79 2342 0.01% 80 2481 0.01% 81 2949 0.02% 82 3295 0.02% 83 3820 0.02% 84 4736 0.03% 85 5379 0.03% 86 5818 0.03% 87 6234 0.04% 88 6744 0.04% 89 7133 0.04% 90 7723 0.04% 91 8356 0.05% 92 8925 0.05% 93 10061 0.06% 94 10720 0.06% 95 11441 0.07% 96 12180 0.07% 97 12945 0.07% 98 13562 0.08% 99 14552 0.08% 100 15502 0.09% 101 16090 0.09% 102 17466 0.10% 103 18390 0.11% 104 19415 0.11% 105 20765 0.12% 106 21514 0.12% 107 22223 0.13% 108 23084 0.13% 109 24317 0.14% 110 25758 0.15% 111 26179 0.15% 112 28009 0.16% 113 29176 0.17% 114 30537 0.18% 115 32135 0.19% 116 33431 0.19% 117 34480 0.20% 118 36028 0.21% 119 37361 0.22% 120 38659 0.22% 121 40536 0.23% 122 41710 0.24% 123 44013 0.25% 124 46033 0.27% 125 48171 0.28% 126 50647 0.29% 127 52851 0.30% 128 54885 0.32% 129 57189 0.33% 130 60135 0.35% 131 62110 0.36% 132 65784 0.38% 133 69230 0.40% 134 73794 0.43% 135 79630 0.46% 136 84309 0.49% 137 89854 0.52% 138 95881 0.55% 139 103124 0.59% 140 112687 0.65% 141 123396 0.71% 142 137765 0.79% 143 155470 0.90% 144 180996 1.04% 145 217108 1.25% 146 269757 1.56% 147 362030 2.09% 148 538044 3.10% 149 1018485 5.88% 150 4380160 25.27% 151 7887454 45.50% 17334052 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=50.68 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=19 prefix-density=0.42 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=93.87 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.3 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7168848 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 06:09:26 Started mapping on | Feb 15 06:09:26 Finished on | Feb 15 06:11:34 Mapping speed, Million of reads per hour | 487.52 Number of input reads | 17334052 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16226986 Uniquely mapped reads % | 93.61% Average mapped length | 292.84 Number of splices: Total | 15682116 Number of splices: Annotated (sjdb) | 15315626 Number of splices: GT/AG | 15375239 Number of splices: GC/AG | 251116 Number of splices: AT/AC | 9305 Number of splices: Non-canonical | 46456 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454713 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 79366 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667941 667941 667941 N_multimapping 454713 454713 454713 N_noFeature 664438 15915761 831518 N_ambiguous 259417 1419 114305 UnstrandedReadsAssigned:15303131 PositiveStrandReadsAssigned:309806 NegativeStrandReadsAssigned:15281163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7168848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168848-trimmed-pair1.fastq SRR7168848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,334,052 reads, 15,284,861 reads pseudoaligned [quant] estimated average fragment length: 249.049 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52401 SRR7168848.ke.tsv 34699 SRR7168848.se.tsv 87100 total ==> SRR7168848.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.95 1160 42.0556 Potri.005G024800.1.v4.1 1035 786.951 308 25.1149 Potri.004G059700.1.v4.1 961 712.994 16 1.44 Potri.007G009000.2.v4.1 1416 1167.95 0 0 Potri.003G141000.2.v4.1 2943 2694.95 1047.3 24.9372 Potri.016G087400.1.v4.1 270 80.2593 778 622.031 Potri.015G069301.1.v4.1 564 322.182 0 0 Potri.010G195200.1.v4.1 1773 1524.95 250 10.5199 Potri.012G127500.1.v4.1 977 728.984 114 10.0349 ==> SRR7168848.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 500 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 82 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7168848 completed mapping pipeline successfully