Starting /dee2/code/volunteer_pipeline.sh SRR7168849 current disk space = 3092872663040 free memory = 1579846152 SRR7168849 SRAfilesize bb7dd7769510add56c5865c22c2fafe7 SRR7168849.sra SRR7168849.sra file validated SRR7168849 is paired end SRR7168849 is conventional basespace SRR7168849 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31375 34.0 34.0 34.0 33.0 34.0 2 33.39725 34.0 34.0 34.0 33.0 34.0 3 33.482 34.0 34.0 34.0 33.0 34.0 4 33.56175 34.0 34.0 34.0 33.0 34.0 5 33.65475 34.0 34.0 34.0 33.0 34.0 6 37.4675 38.0 38.0 38.0 37.0 38.0 7 37.56275 38.0 38.0 38.0 37.0 38.0 8 37.609 38.0 38.0 38.0 38.0 38.0 9 37.662 38.0 38.0 38.0 38.0 38.0 10-14 37.64695 38.0 38.0 38.0 38.0 38.0 15-19 37.663850000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.634499999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5748 38.0 38.0 38.0 38.0 38.0 30-34 37.62205 38.0 38.0 38.0 38.0 38.0 35-39 37.573299999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.558 38.0 38.0 38.0 38.0 38.0 45-49 37.51875 38.0 38.0 38.0 37.8 38.0 50-54 37.48395000000001 38.0 38.0 38.0 37.6 38.0 55-59 37.41125 38.0 38.0 38.0 37.0 38.0 60-64 37.411649999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.320299999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.2285 38.0 38.0 38.0 36.6 38.0 75-79 37.156349999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.10025 38.0 38.0 38.0 36.0 38.0 85-89 37.012249999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.888400000000004 38.0 38.0 38.0 35.6 38.0 95-99 36.7658 38.0 38.0 38.0 34.8 38.0 100-104 36.613350000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.4794 38.0 38.0 38.0 34.0 38.0 110-114 36.334 38.0 38.0 38.0 34.0 38.0 115-119 36.011849999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.74125 38.0 36.4 38.0 31.0 38.0 125-129 35.415800000000004 38.0 36.0 38.0 30.6 38.0 130-134 35.179649999999995 38.0 35.8 38.0 29.2 38.0 135-139 34.51965 38.0 34.4 38.0 26.2 38.0 140-144 33.857000000000006 38.0 33.0 38.0 23.2 38.0 145-149 32.89254999999999 38.0 33.0 38.0 18.2 38.0 150-151 27.854875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 3.0 17 3.0 18 2.0 19 1.0 20 4.0 21 2.0 22 1.0 23 6.0 24 8.0 25 12.0 26 11.0 27 16.0 28 11.0 29 25.0 30 29.0 31 40.0 32 74.0 33 86.0 34 154.0 35 311.0 36 798.0 37 2399.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.640344018764665 13.630440448266876 11.232733906697941 35.49648162627052 2 21.325 19.45 33.925 25.3 3 19.875 24.099999999999998 25.95 30.075000000000003 4 21.775 32.425 22.95 22.85 5 20.8 36.075 24.25 18.875 6 18.35 37.974999999999994 23.799999999999997 19.875 7 13.075000000000001 24.375 43.8 18.75 8 18.8 22.95 31.874999999999996 26.375 9 18.025 24.575 32.525 24.875 10-14 20.555 29.095 26.51 23.84 15-19 19.985 29.035 27.625 23.355 20-24 19.86 29.265 27.73 23.145 25-29 19.095000000000002 28.83 28.535 23.54 30-34 19.695 28.999999999999996 27.900000000000002 23.405 35-39 19.875 28.575 28.1 23.45 40-44 19.77 28.365000000000002 28.505000000000003 23.36 45-49 20.275000000000002 28.384999999999998 27.735 23.605 50-54 19.855 28.749999999999996 27.68 23.715 55-59 19.605 28.610000000000003 28.199999999999996 23.585 60-64 20.335 28.64 27.38 23.645 65-69 20.05 28.725 28.189999999999998 23.035 70-74 19.955000000000002 28.470000000000002 28.294999999999998 23.28 75-79 20.175 28.265 27.694999999999997 23.865 80-84 20.385 29.23 27.11 23.275000000000002 85-89 20.119999999999997 28.494999999999997 27.500000000000004 23.885 90-94 20.13 28.71 27.85 23.31 95-99 20.32 28.439999999999998 27.82 23.419999999999998 100-104 20.169999999999998 28.389999999999997 27.485 23.955000000000002 105-109 20.185 28.365000000000002 27.275 24.175 110-114 20.205000000000002 28.439999999999998 27.834999999999997 23.52 115-119 20.705000000000002 28.01 27.165 24.12 120-124 20.919999999999998 28.22 27.165 23.695 125-129 20.91 28.625 26.66 23.805 130-134 20.57 28.720000000000002 26.900000000000002 23.810000000000002 135-139 20.515 28.37 26.525 24.59 140-144 20.435 28.485 26.61 24.47 145-149 20.805 28.575 26.565 24.055 150-151 22.103677670390358 27.96535709802937 26.10769423873478 23.823270992845487 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 4.0 26 6.0 27 7.0 28 8.5 29 15.0 30 20.5 31 32.5 32 42.0 33 45.5 34 55.0 35 71.5 36 94.0 37 117.5 38 155.0 39 187.5 40 192.5 41 207.0 42 248.5 43 267.0 44 272.0 45 273.5 46 259.5 47 243.5 48 225.5 49 200.5 50 171.5 51 137.0 52 102.5 53 83.0 54 66.5 55 47.5 56 34.5 57 28.5 58 21.0 59 14.0 60 11.5 61 9.5 62 6.5 63 4.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.699999999999999 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.737500000000001 0.0 0.0 0.0 0.0 124-125 6.1 0.0 0.0 0.0 0.0 126-127 6.6 0.0 0.0 0.0 0.0 128-129 7.2 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.6625 0.0 0.0 0.0 0.0 136-137 9.1875 0.0 0.0 0.0 0.0 138-139 9.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168849 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1 33.0 33.0 34.0 32.0 34.0 2 33.22125 34.0 33.0 34.0 33.0 34.0 3 33.1945 34.0 33.0 34.0 33.0 34.0 4 33.23375 34.0 33.0 34.0 33.0 34.0 5 33.21525 34.0 33.0 34.0 33.0 34.0 6 37.381 38.0 38.0 38.0 38.0 38.0 7 37.41875 38.0 38.0 38.0 38.0 38.0 8 37.386 38.0 38.0 38.0 38.0 38.0 9 37.37625 38.0 38.0 38.0 38.0 38.0 10-14 37.345349999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.373799999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.362049999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.35245 38.0 38.0 38.0 37.8 38.0 30-34 37.3429 38.0 38.0 38.0 38.0 38.0 35-39 37.3166 38.0 38.0 38.0 37.6 38.0 40-44 37.33635 38.0 38.0 38.0 37.8 38.0 45-49 37.310950000000005 38.0 38.0 38.0 37.6 38.0 50-54 37.29375 38.0 38.0 38.0 37.4 38.0 55-59 37.22245 38.0 38.0 38.0 37.0 38.0 60-64 37.204899999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.1257 38.0 38.0 38.0 37.0 38.0 70-74 37.133799999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.007600000000004 38.0 38.0 38.0 36.8 38.0 80-84 36.92355 38.0 38.0 38.0 36.2 38.0 85-89 36.7691 38.0 38.0 38.0 36.0 38.0 90-94 36.71745 38.0 38.0 38.0 35.8 38.0 95-99 36.66055 38.0 38.0 38.0 35.2 38.0 100-104 36.63045 38.0 38.0 38.0 35.2 38.0 105-109 36.4702 38.0 38.0 38.0 34.8 38.0 110-114 36.31865 38.0 38.0 38.0 34.0 38.0 115-119 36.1167 38.0 38.0 38.0 34.0 38.0 120-124 35.96315 38.0 37.8 38.0 33.8 38.0 125-129 35.7113 38.0 37.2 38.0 32.6 38.0 130-134 35.47835 38.0 36.6 38.0 31.2 38.0 135-139 34.87005 38.0 36.0 38.0 29.4 38.0 140-144 34.329550000000005 38.0 35.4 38.0 26.2 38.0 145-149 33.462599999999995 38.0 33.2 38.0 20.2 38.0 150-151 28.258 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 3.0 14 0.0 15 4.0 16 4.0 17 6.0 18 7.0 19 3.0 20 3.0 21 6.0 22 5.0 23 13.0 24 10.0 25 11.0 26 11.0 27 20.0 28 20.0 29 21.0 30 38.0 31 39.0 32 60.0 33 63.0 34 115.0 35 188.0 36 545.0 37 2788.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4 20.7 14.000000000000002 25.900000000000002 2 26.724999999999998 26.174999999999997 31.25 15.85 3 21.75 28.675 29.975 19.6 4 24.0 36.725 20.95 18.325 5 23.849999999999998 35.725 22.525000000000002 17.9 6 20.545545545545547 37.86286286286286 23.4984984984985 18.093093093093092 7 19.314485864398296 20.61546159619715 38.979234425819364 21.09081811358519 8 20.540405303977984 26.1195896922692 28.271203402551915 25.068801601200903 9 22.016512384288216 24.893670252689517 29.622216662496875 23.46760070052539 10-14 23.423738991192955 28.727982385908728 26.56124899919936 21.28702962369896 15-19 22.720448403563207 28.48563707336603 27.795015513962568 20.998899009108197 20-24 22.534154030926288 28.018815993594554 28.589300905769903 20.85772906970925 25-29 23.38955903698884 28.25466740077081 28.0044046248561 20.351368937384255 30-34 22.984133340007006 27.889283747935334 28.474898643575752 20.651684268481908 35-39 23.27642317128123 28.228107945726734 28.097932208481453 20.39753667451059 40-44 23.663931144915935 27.56705364291433 28.037429943955168 20.731585268214573 45-49 22.94261844014208 28.32057631697434 27.980389214067735 20.75641602881585 50-54 23.25011257317256 27.54290288687647 28.18832240956622 21.01866213038475 55-59 22.983386709367494 27.431945556445157 28.652922337870297 20.93174539631705 60-64 23.61270953214911 27.710783087315487 28.29622216662497 20.380285213910433 65-69 23.814051240992796 27.66212970376301 27.772217774219378 20.75160128102482 70-74 23.30714178469546 27.98158250337821 28.10169661178119 20.609579100145137 75-79 22.778222578062447 27.66212970376301 28.132506004803844 21.427141713370695 80-84 23.57947434292866 28.1351689612015 27.319148936170212 20.966207759699625 85-89 23.633360032038446 28.33400080096115 27.683219863836605 20.349419303163796 90-94 22.613090472377902 28.36769415532426 28.422738190552444 20.596477181745396 95-99 23.330832708177045 28.00700175043761 27.711927981995498 20.950237559389848 100-104 23.470867716929234 28.052013003250813 28.22705676419105 20.25006251562891 105-109 23.87574408483818 27.73247961582712 27.72247511380121 20.669301185533488 110-114 23.737121136340903 28.223467040112034 27.96338901670501 20.076022806842055 115-119 24.944955964771818 28.182546036829464 27.111689351481182 19.760808646917535 120-124 24.49572050653186 28.039441413484155 27.61399469442915 19.850843385554835 125-129 24.86862519393424 28.321905810519993 27.125769481006955 19.68369951453881 130-134 25.03628810250763 28.10450973522198 26.98333249912408 19.875869663146304 135-139 25.381574338187455 28.108892558674874 26.837812140319272 19.671720962818394 140-144 25.280112044817926 28.351340536214487 26.855742296918766 19.51280512204882 145-149 26.05323726608626 28.249774842389673 26.668668067647356 19.028319823876714 150-151 24.6875 27.950000000000003 28.3625 19.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 4.5 27 6.0 28 10.5 29 12.5 30 12.0 31 16.0 32 23.5 33 34.5 34 60.0 35 77.0 36 80.5 37 93.5 38 122.5 39 171.0 40 220.5 41 233.5 42 252.0 43 278.0 44 291.0 45 291.5 46 273.0 47 252.0 48 218.0 49 185.0 50 158.0 51 134.5 52 111.0 53 93.5 54 79.5 55 62.0 56 42.5 57 25.5 58 15.0 59 14.0 60 12.5 61 8.0 62 6.0 63 5.0 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.075 9 0.075 10-14 0.08 15-19 0.09 20-24 0.08499999999999999 25-29 0.105 30-34 0.105 35-39 0.135 40-44 0.08 45-49 0.055 50-54 0.065 55-59 0.08 60-64 0.075 65-69 0.08 70-74 0.095 75-79 0.08 80-84 0.125 85-89 0.12 90-94 0.08 95-99 0.025 100-104 0.025 105-109 0.045 110-114 0.03 115-119 0.08 120-124 0.105 125-129 0.095 130-134 0.105 135-139 0.08499999999999999 140-144 0.04 145-149 0.06999999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.199999999999999 0.0 0.0 0.0 0.0 118-119 4.6875 0.0 0.0 0.0 0.0 120-121 5.2375 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.6375 0.0 0.0 0.0 0.0 128-129 7.25 0.0 0.0 0.0 0.0 130-131 7.7625 0.0 0.0 0.0 0.0 132-133 8.15 0.0 0.0 0.0 0.0 134-135 8.649999999999999 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138-139 9.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTCT 10 0.006830828 145.0 1 >>END_MODULE Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483977 spots for SRR7168849.sra Written 483977 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra Read 483965 spots for SRR7168849.sra Written 483965 spots for SRR7168849.sra SRR ids: ['SRR7168849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dbje6v9n SRR7168849.sra spots: 9679312 blocks: [[1, 483965], [483966, 967930], [967931, 1451895], [1451896, 1935860], [1935861, 2419825], [2419826, 2903790], [2903791, 3387755], [3387756, 3871720], [3871721, 4355685], [4355686, 4839650], [4839651, 5323615], [5323616, 5807580], [5807581, 6291545], [6291546, 6775510], [6775511, 7259475], [7259476, 7743440], [7743441, 8227405], [8227406, 8711370], [8711371, 9195335], [9195336, 9679312]] SRR7168849 file size 3258927 SRR7168849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168849 SRR7168849_1.fastq SRR7168849_2.fastq Input file: SRR7168849_1.fastq Paired file: SRR7168849_2.fastq trimmed: SRR7168849-trimmed-pair1.fastq, SRR7168849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:06:39 2025 >> started Sat Feb 15 08:07:00 2025 >> done (21.098s) 9679312 read pairs processed; of these: 12014 ( 0.12%) short read pairs filtered out after trimming by size control 17358 ( 0.18%) empty read pairs filtered out after trimming by size control 9649940 (99.70%) read pairs available; of these: 5453068 (56.51%) trimmed read pairs available after processing 4196872 (43.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 6 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 9 0.00% 31 10 0.00% 32 3 0.00% 33 8 0.00% 34 8 0.00% 35 12 0.00% 36 8 0.00% 37 8 0.00% 38 14 0.00% 39 20 0.00% 40 22 0.00% 41 27 0.00% 42 21 0.00% 43 23 0.00% 44 24 0.00% 45 25 0.00% 46 34 0.00% 47 50 0.00% 48 57 0.00% 49 58 0.00% 50 60 0.00% 51 92 0.00% 52 114 0.00% 53 107 0.00% 54 104 0.00% 55 113 0.00% 56 120 0.00% 57 136 0.00% 58 186 0.00% 59 173 0.00% 60 263 0.00% 61 259 0.00% 62 299 0.00% 63 324 0.00% 64 393 0.00% 65 467 0.00% 66 467 0.00% 67 520 0.01% 68 619 0.01% 69 1134 0.01% 70 1317 0.01% 71 1053 0.01% 72 1055 0.01% 73 1175 0.01% 74 1338 0.01% 75 1494 0.02% 76 1610 0.02% 77 1673 0.02% 78 1924 0.02% 79 2100 0.02% 80 2285 0.02% 81 2674 0.03% 82 3059 0.03% 83 3570 0.04% 84 3921 0.04% 85 4542 0.05% 86 4835 0.05% 87 4975 0.05% 88 5641 0.06% 89 5859 0.06% 90 6459 0.07% 91 7025 0.07% 92 7728 0.08% 93 8570 0.09% 94 9108 0.09% 95 9864 0.10% 96 10152 0.11% 97 10668 0.11% 98 10961 0.11% 99 11404 0.12% 100 12109 0.13% 101 13011 0.13% 102 13857 0.14% 103 14826 0.15% 104 15447 0.16% 105 16370 0.17% 106 17036 0.18% 107 17450 0.18% 108 17848 0.18% 109 18434 0.19% 110 18871 0.20% 111 19646 0.20% 112 20976 0.22% 113 22147 0.23% 114 22769 0.24% 115 24064 0.25% 116 24488 0.25% 117 25260 0.26% 118 26009 0.27% 119 26365 0.27% 120 27286 0.28% 121 27848 0.29% 122 28476 0.30% 123 30443 0.32% 124 31849 0.33% 125 32992 0.34% 126 34313 0.36% 127 34984 0.36% 128 35296 0.37% 129 36972 0.38% 130 37701 0.39% 131 38374 0.40% 132 40285 0.42% 133 42124 0.44% 134 44203 0.46% 135 46751 0.48% 136 48503 0.50% 137 50918 0.53% 138 53087 0.55% 139 55873 0.58% 140 59323 0.61% 141 63896 0.66% 142 69987 0.73% 143 78624 0.81% 144 90817 0.94% 145 107647 1.12% 146 133774 1.39% 147 180119 1.87% 148 280224 2.90% 149 553619 5.74% 150 2515291 26.07% 151 4196872 43.49% 9649940 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=16 prefix-density=0.47 prefix-fanout=2.1 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=455.85 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=0.44 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=36.57 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168849 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:08:06 Started mapping on | Feb 15 08:08:06 Finished on | Feb 15 08:09:07 Mapping speed, Million of reads per hour | 569.50 Number of input reads | 9649940 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9117276 Uniquely mapped reads % | 94.48% Average mapped length | 290.94 Number of splices: Total | 8744747 Number of splices: Annotated (sjdb) | 8543779 Number of splices: GT/AG | 8567942 Number of splices: GC/AG | 147623 Number of splices: AT/AC | 5005 Number of splices: Non-canonical | 24177 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234618 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 18950 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 305424 305424 305424 N_multimapping 234618 234618 234618 N_noFeature 364731 8931427 480059 N_ambiguous 130224 856 59041 UnstrandedReadsAssigned:8622321 PositiveStrandReadsAssigned:184993 NegativeStrandReadsAssigned:8578176 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168849-trimmed-pair1.fastq SRR7168849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,649,940 reads, 8,589,489 reads pseudoaligned [quant] estimated average fragment length: 226.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7168849.ke.tsv 34699 SRR7168849.se.tsv 87100 total ==> SRR7168849.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.9 307 21.4292 Potri.005G024800.1.v4.1 1035 809.901 78 12.0527 Potri.004G059700.1.v4.1 961 735.912 10 1.70058 Potri.007G009000.2.v4.1 1416 1190.9 0 0 Potri.003G141000.2.v4.1 2943 2717.9 527.42 24.2855 Potri.016G087400.1.v4.1 270 88.5774 405 572.21 Potri.015G069301.1.v4.1 564 342.95 0 0 Potri.010G195200.1.v4.1 1773 1547.9 6 0.4851 Potri.012G127500.1.v4.1 977 751.912 41 6.82402 ==> SRR7168849.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7168849 completed mapping pipeline successfully