Starting /dee2/code/volunteer_pipeline.sh SRR7168850 current disk space = 3092699389952 free memory = 1575658004 SRR7168850 SRAfilesize bf8c3d5150a26392cf88831a37cb1024 SRR7168850.sra SRR7168850.sra file validated SRR7168850 is paired end SRR7168850 is conventional basespace SRR7168850 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41875 34.0 33.0 34.0 32.0 34.0 2 33.116 34.0 33.0 34.0 32.0 34.0 3 33.12625 34.0 33.0 34.0 32.0 34.0 4 33.28 34.0 33.0 34.0 32.0 34.0 5 33.261 34.0 33.0 34.0 33.0 34.0 6 37.108 38.0 37.0 38.0 36.0 38.0 7 37.293 38.0 38.0 38.0 37.0 38.0 8 37.41975 38.0 38.0 38.0 37.0 38.0 9 37.4845 38.0 38.0 38.0 37.0 38.0 10-14 37.42205 38.0 38.0 38.0 37.0 38.0 15-19 37.42375 38.0 38.0 38.0 37.0 38.0 20-24 37.4052 38.0 38.0 38.0 37.0 38.0 25-29 37.376250000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.332 38.0 38.0 38.0 37.0 38.0 35-39 37.33415 38.0 38.0 38.0 37.0 38.0 40-44 37.24060000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.226350000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.2255 38.0 38.0 38.0 36.8 38.0 55-59 37.149800000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.091750000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.1186 38.0 38.0 38.0 36.0 38.0 70-74 36.979400000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.861599999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.82855000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.70415 38.0 38.0 38.0 35.0 38.0 90-94 36.6622 38.0 38.0 38.0 34.8 38.0 95-99 36.51545 38.0 38.0 38.0 34.0 38.0 100-104 36.384600000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.242599999999996 38.0 37.8 38.0 33.8 38.0 110-114 36.00755 38.0 37.0 38.0 33.0 38.0 115-119 35.86305 38.0 37.0 38.0 32.0 38.0 120-124 35.59570000000001 38.0 36.6 38.0 30.6 38.0 125-129 35.2491 38.0 36.0 38.0 29.0 38.0 130-134 35.0125 38.0 35.8 38.0 28.0 38.0 135-139 34.651300000000006 38.0 34.6 38.0 27.4 38.0 140-144 34.2992 38.0 34.2 38.0 25.8 38.0 145-149 33.22625000000001 38.0 33.0 38.0 18.8 38.0 150-151 28.98225 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 1.0 16 3.0 17 0.0 18 1.0 19 0.0 20 8.0 21 2.0 22 5.0 23 10.0 24 18.0 25 11.0 26 10.0 27 27.0 28 36.0 29 28.0 30 41.0 31 61.0 32 69.0 33 113.0 34 152.0 35 280.0 36 706.0 37 2411.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.243326488706366 13.578028747433265 9.471252566735112 39.70739219712526 2 20.775 18.375 36.675000000000004 24.175 3 19.15 23.775 27.200000000000003 29.875 4 21.725 32.225 23.65 22.400000000000002 5 22.1 35.775 23.25 18.875 6 17.375 36.8 27.0 18.825 7 13.475000000000001 24.825 42.875 18.825 8 17.224999999999998 23.799999999999997 31.924999999999997 27.05 9 16.8 24.125 34.300000000000004 24.775 10-14 19.98 29.4 27.12 23.5 15-19 19.905 28.585 27.655 23.855 20-24 19.950000000000003 28.675 27.794999999999998 23.580000000000002 25-29 19.545 29.26 27.644999999999996 23.549999999999997 30-34 19.439999999999998 29.115000000000002 27.965 23.48 35-39 19.905 28.244999999999997 28.105000000000004 23.745 40-44 20.305 28.625 27.875 23.195 45-49 20.535 28.685 27.744999999999997 23.035 50-54 20.06 28.935 27.865000000000002 23.14 55-59 20.064999999999998 29.459999999999997 27.57 22.905 60-64 20.385 28.51 27.87 23.235 65-69 20.085 28.595 27.855 23.465 70-74 19.895 29.154999999999998 27.375 23.575 75-79 20.0 28.810000000000002 27.345000000000002 23.845 80-84 20.45 28.675 27.6 23.275000000000002 85-89 20.785 29.025000000000002 27.42 22.770000000000003 90-94 20.625 29.25 26.755000000000003 23.369999999999997 95-99 20.085 28.605000000000004 27.875 23.435 100-104 20.235 28.720000000000002 27.305 23.74 105-109 20.48 29.14 26.68 23.7 110-114 20.815 28.535 27.35 23.3 115-119 20.549999999999997 29.37 26.919999999999998 23.16 120-124 19.86 29.115000000000002 27.389999999999997 23.635 125-129 20.52 28.449999999999996 27.24 23.79 130-134 20.49 28.96 27.034999999999997 23.515 135-139 20.845 28.9 26.36 23.895 140-144 20.349999999999998 28.199999999999996 27.200000000000003 24.25 145-149 20.064999999999998 28.62 26.83 24.485 150-151 20.724999999999998 28.575 26.224999999999998 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 1.5 22 3.0 23 3.5 24 4.0 25 5.0 26 7.0 27 8.0 28 12.5 29 20.5 30 25.5 31 29.0 32 36.0 33 45.5 34 57.5 35 75.5 36 101.0 37 114.0 38 121.5 39 158.5 40 200.0 41 237.5 42 246.5 43 251.5 44 264.5 45 261.5 46 265.0 47 263.0 48 238.5 49 197.0 50 164.0 51 133.5 52 107.5 53 84.0 54 65.5 55 50.0 56 34.0 57 25.5 58 21.5 59 21.0 60 17.5 61 8.5 62 3.0 63 1.5 64 0.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.0 0.0 0.0 0.0 0.0 102-103 2.275 0.0 0.0 0.0 0.0 104-105 2.4125 0.0 0.0 0.0 0.0 106-107 2.7750000000000004 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 114-115 4.65 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 5.8875 0.0 0.0 0.0 0.0 122-123 6.3625 0.0 0.0 0.0 0.0 124-125 6.862500000000001 0.0 0.0 0.0 0.0 126-127 7.4 0.0 0.0 0.0 0.0 128-129 8.0 0.0 0.0 0.0 0.0 130-131 8.475 0.0 0.0 0.0 0.0 132-133 8.975 0.0 0.0 0.0 0.0 134-135 9.5875 0.0 0.0 0.0 0.0 136-137 10.275 0.0 0.0 0.0 0.0 138-139 10.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168850 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.684 33.0 33.0 34.0 32.0 34.0 2 32.872 33.0 33.0 34.0 32.0 34.0 3 32.8545 33.0 33.0 34.0 31.0 34.0 4 32.848 34.0 33.0 34.0 32.0 34.0 5 32.84425 33.0 33.0 34.0 32.0 34.0 6 37.153 38.0 38.0 38.0 37.0 38.0 7 37.058 38.0 38.0 38.0 37.0 38.0 8 37.0815 38.0 38.0 38.0 36.0 38.0 9 37.054 38.0 38.0 38.0 36.0 38.0 10-14 37.0789 38.0 38.0 38.0 36.4 38.0 15-19 37.133599999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.0461 38.0 38.0 38.0 36.6 38.0 25-29 37.07725 38.0 38.0 38.0 36.4 38.0 30-34 37.02795 38.0 38.0 38.0 36.4 38.0 35-39 36.9731 38.0 38.0 38.0 36.0 38.0 40-44 37.028 38.0 38.0 38.0 36.2 38.0 45-49 36.8938 38.0 38.0 38.0 36.0 38.0 50-54 36.88105 38.0 38.0 38.0 36.0 38.0 55-59 36.85805 38.0 38.0 38.0 36.0 38.0 60-64 36.82145 38.0 38.0 38.0 35.8 38.0 65-69 36.71145 38.0 38.0 38.0 35.6 38.0 70-74 36.653800000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.5325 38.0 38.0 38.0 34.2 38.0 80-84 36.3686 38.0 38.0 38.0 34.0 38.0 85-89 36.34295 38.0 38.0 38.0 34.0 38.0 90-94 36.2255 38.0 38.0 38.0 33.8 38.0 95-99 36.128 38.0 38.0 38.0 33.4 38.0 100-104 36.03045 38.0 38.0 38.0 33.4 38.0 105-109 35.9477 38.0 37.6 38.0 33.0 38.0 110-114 35.683499999999995 38.0 37.0 38.0 31.8 38.0 115-119 35.5148 38.0 37.0 38.0 31.0 38.0 120-124 35.2608 38.0 36.2 38.0 29.2 38.0 125-129 34.95885 38.0 36.0 38.0 27.8 38.0 130-134 34.46395 38.0 35.0 38.0 25.2 38.0 135-139 33.97355 38.0 34.6 38.0 22.8 38.0 140-144 33.296499999999995 38.0 33.2 38.0 18.6 38.0 145-149 32.00054999999999 38.0 32.8 38.0 8.6 38.0 150-151 26.8775 34.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 1.0 7 3.0 8 2.0 9 1.0 10 0.0 11 3.0 12 2.0 13 7.0 14 4.0 15 3.0 16 6.0 17 4.0 18 6.0 19 4.0 20 10.0 21 12.0 22 17.0 23 9.0 24 24.0 25 19.0 26 25.0 27 21.0 28 35.0 29 45.0 30 49.0 31 63.0 32 78.0 33 112.0 34 155.0 35 251.0 36 640.0 37 2384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.9 18.95 14.124999999999998 29.025000000000002 2 26.375 25.525 32.975 15.125 3 20.275000000000002 28.15 31.25 20.325 4 23.3 35.125 22.2 19.375 5 23.674999999999997 38.625 21.475 16.225 6 19.325 38.65 24.875 17.150000000000002 7 18.675 18.85 42.05 20.424999999999997 8 21.075 24.025 28.549999999999997 26.35 9 21.4 24.65 31.474999999999998 22.475 10-14 23.119999999999997 28.854999999999997 26.840000000000003 21.185000000000002 15-19 23.115 27.965 27.915 21.005 20-24 22.685 27.884999999999998 28.38 21.05 25-29 22.595000000000002 28.035 28.310000000000002 21.060000000000002 30-34 22.975 28.125 28.18 20.72 35-39 22.925 27.96 28.09 21.025 40-44 22.825 27.725 28.465 20.985 45-49 22.595000000000002 27.76 28.389999999999997 21.255 50-54 22.465 27.950000000000003 28.825 20.76 55-59 23.05 27.675 28.74 20.535 60-64 23.27 26.905 28.499999999999996 21.325 65-69 22.855 27.61 28.585 20.95 70-74 23.505000000000003 27.185 28.999999999999996 20.31 75-79 23.169999999999998 27.950000000000003 28.084999999999997 20.794999999999998 80-84 23.064999999999998 27.839999999999996 28.21 20.885 85-89 23.044999999999998 28.265 28.055000000000003 20.635 90-94 22.650000000000002 28.065 28.199999999999996 21.085 95-99 22.975 27.605 28.435 20.985 100-104 23.91 27.900000000000002 28.125 20.064999999999998 105-109 23.400000000000002 27.644999999999996 28.785 20.169999999999998 110-114 24.154999999999998 27.884999999999998 27.525 20.435 115-119 23.935000000000002 28.04 28.08 19.945 120-124 24.79 27.345000000000002 27.91 19.955000000000002 125-129 24.295 27.894999999999996 28.139999999999997 19.67 130-134 24.912491249124912 27.382738273827385 27.872787278727873 19.831983198319833 135-139 25.115 28.134999999999998 27.51 19.24 140-144 25.39 27.85 27.24 19.52 145-149 25.35 28.395 27.455000000000002 18.8 150-151 26.3 27.675 27.2625 18.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 3.0 25 5.0 26 5.0 27 4.5 28 6.5 29 10.5 30 14.0 31 18.5 32 31.5 33 39.5 34 53.0 35 75.0 36 96.5 37 125.5 38 146.5 39 170.0 40 209.5 41 227.0 42 235.5 43 261.5 44 286.0 45 281.0 46 259.0 47 245.5 48 239.0 49 205.0 50 157.0 51 129.0 52 102.5 53 83.0 54 68.5 55 54.0 56 41.5 57 35.0 58 28.0 59 18.0 60 10.5 61 6.5 62 3.5 63 1.5 64 1.5 65 1.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 2.0250000000000004 0.0 0.0 0.0 0.0 102-103 2.3 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.5999999999999996 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.725 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.5125 0.0 0.0 0.0 0.0 120-121 6.0 0.0 0.0 0.0 0.0 122-123 6.5 0.0 0.0 0.0 0.0 124-125 7.012499999999999 0.0 0.0 0.0 0.0 126-127 7.525 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.6 0.0 0.0 0.0 0.0 132-133 9.087499999999999 0.0 0.0 0.0 0.0 134-135 9.7 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 11.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAAAG 10 0.006830828 145.0 2 TTTTGTT 10 0.006830828 145.0 3 >>END_MODULE Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra Read 798992 spots for SRR7168850.sra Written 798992 spots for SRR7168850.sra Read 798979 spots for SRR7168850.sra Written 798979 spots for SRR7168850.sra SRR ids: ['SRR7168850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5jv4hspw SRR7168850.sra spots: 15979593 blocks: [[1, 798979], [798980, 1597958], [1597959, 2396937], [2396938, 3195916], [3195917, 3994895], [3994896, 4793874], [4793875, 5592853], [5592854, 6391832], [6391833, 7190811], [7190812, 7989790], [7989791, 8788769], [8788770, 9587748], [9587749, 10386727], [10386728, 11185706], [11185707, 11984685], [11984686, 12783664], [12783665, 13582643], [13582644, 14381622], [14381623, 15180601], [15180602, 15979593]] SRR7168850 file size 5393259 SRR7168850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168850 SRR7168850_1.fastq SRR7168850_2.fastq Input file: SRR7168850_1.fastq Paired file: SRR7168850_2.fastq trimmed: SRR7168850-trimmed-pair1.fastq, SRR7168850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:29:57 2025 >> started Sat Feb 15 08:30:15 2025 >> done (18.469s) 15979593 read pairs processed; of these: 16931 ( 0.11%) short read pairs filtered out after trimming by size control 21871 ( 0.14%) empty read pairs filtered out after trimming by size control 15940791 (99.76%) read pairs available; of these: 9389575 (58.90%) trimmed read pairs available after processing 6551216 (41.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 12 0.00% 20 3 0.00% 21 3 0.00% 22 7 0.00% 23 5 0.00% 24 9 0.00% 25 9 0.00% 26 12 0.00% 27 11 0.00% 28 12 0.00% 29 9 0.00% 30 14 0.00% 31 10 0.00% 32 24 0.00% 33 20 0.00% 34 24 0.00% 35 23 0.00% 36 32 0.00% 37 41 0.00% 38 42 0.00% 39 60 0.00% 40 61 0.00% 41 81 0.00% 42 89 0.00% 43 94 0.00% 44 81 0.00% 45 133 0.00% 46 111 0.00% 47 145 0.00% 48 183 0.00% 49 219 0.00% 50 231 0.00% 51 284 0.00% 52 255 0.00% 53 315 0.00% 54 397 0.00% 55 414 0.00% 56 427 0.00% 57 460 0.00% 58 545 0.00% 59 632 0.00% 60 755 0.00% 61 806 0.01% 62 955 0.01% 63 1003 0.01% 64 1169 0.01% 65 1256 0.01% 66 1461 0.01% 67 1510 0.01% 68 1726 0.01% 69 2015 0.01% 70 2328 0.01% 71 2559 0.02% 72 2828 0.02% 73 3366 0.02% 74 3565 0.02% 75 3915 0.02% 76 4222 0.03% 77 4479 0.03% 78 5033 0.03% 79 5667 0.04% 80 6249 0.04% 81 6935 0.04% 82 7911 0.05% 83 8734 0.05% 84 9974 0.06% 85 10871 0.07% 86 11602 0.07% 87 12223 0.08% 88 12970 0.08% 89 13669 0.09% 90 14603 0.09% 91 15560 0.10% 92 17018 0.11% 93 18509 0.12% 94 19414 0.12% 95 20838 0.13% 96 21561 0.14% 97 22187 0.14% 98 22835 0.14% 99 23760 0.15% 100 25084 0.16% 101 26439 0.17% 102 27744 0.17% 103 29313 0.18% 104 30480 0.19% 105 31944 0.20% 106 32617 0.20% 107 33439 0.21% 108 34057 0.21% 109 35656 0.22% 110 36109 0.23% 111 37406 0.23% 112 39078 0.25% 113 40573 0.25% 114 42087 0.26% 115 43715 0.27% 116 44895 0.28% 117 45953 0.29% 118 47188 0.30% 119 47586 0.30% 120 49052 0.31% 121 50172 0.31% 122 52489 0.33% 123 54604 0.34% 124 56736 0.36% 125 58805 0.37% 126 60586 0.38% 127 62289 0.39% 128 64188 0.40% 129 65930 0.41% 130 68180 0.43% 131 70141 0.44% 132 73598 0.46% 133 77194 0.48% 134 80908 0.51% 135 85456 0.54% 136 89932 0.56% 137 95592 0.60% 138 100437 0.63% 139 107856 0.68% 140 114242 0.72% 141 123917 0.78% 142 136721 0.86% 143 153482 0.96% 144 175723 1.10% 145 207342 1.30% 146 258673 1.62% 147 343286 2.15% 148 504508 3.16% 149 953143 5.98% 150 3909449 24.52% 151 6551216 41.10% 15940791 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=33.22 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=11.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCCTCTGGATCATCAGCCAAGCC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=0.54 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=7.09 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.3 sequence=CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT SRR7168850 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:31:41 Started mapping on | Feb 15 08:31:41 Finished on | Feb 15 08:33:22 Mapping speed, Million of reads per hour | 568.19 Number of input reads | 15940791 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14889070 Uniquely mapped reads % | 93.40% Average mapped length | 288.97 Number of splices: Total | 14031907 Number of splices: Annotated (sjdb) | 13741999 Number of splices: GT/AG | 13755260 Number of splices: GC/AG | 232367 Number of splices: AT/AC | 7365 Number of splices: Non-canonical | 36915 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408799 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 48247 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 657408 657408 657408 N_multimapping 408799 408799 408799 N_noFeature 566340 14502467 859223 N_ambiguous 195032 1809 99831 UnstrandedReadsAssigned:14127698 PositiveStrandReadsAssigned:384794 NegativeStrandReadsAssigned:13930016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168850-trimmed-pair1.fastq SRR7168850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,940,791 reads, 13,980,825 reads pseudoaligned [quant] estimated average fragment length: 229.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7168850.ke.tsv 34699 SRR7168850.se.tsv 87100 total ==> SRR7168850.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.37 511 23.6199 Potri.005G024800.1.v4.1 1035 806.371 141 14.4625 Potri.004G059700.1.v4.1 961 732.396 8 0.903446 Potri.007G009000.2.v4.1 1416 1187.37 0 0 Potri.003G141000.2.v4.1 2943 2714.37 550.738 16.7816 Potri.016G087400.1.v4.1 270 91.0962 764 693.667 Potri.015G069301.1.v4.1 564 340.927 0 0 Potri.010G195200.1.v4.1 1773 1544.37 28 1.49956 Potri.012G127500.1.v4.1 977 748.39 569 62.8843 ==> SRR7168850.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 271 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 397 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7168850 completed mapping pipeline successfully