Starting /dee2/code/volunteer_pipeline.sh SRR7168851 current disk space = 3093016444928 free memory = 1474957764 SRR7168851 SRAfilesize e49d95fa9eb1aebfeae9e00b49ae435f SRR7168851.sra SRR7168851.sra file validated SRR7168851 is paired end SRR7168851 is conventional basespace SRR7168851 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76075 34.0 33.0 34.0 33.0 34.0 2 33.28075 34.0 33.0 34.0 33.0 34.0 3 33.402 34.0 34.0 34.0 33.0 34.0 4 33.419 34.0 34.0 34.0 33.0 34.0 5 33.46975 34.0 34.0 34.0 33.0 34.0 6 37.21975 38.0 38.0 38.0 36.0 38.0 7 37.3905 38.0 38.0 38.0 37.0 38.0 8 37.5495 38.0 38.0 38.0 37.0 38.0 9 37.48675 38.0 38.0 38.0 38.0 38.0 10-14 37.56785 38.0 38.0 38.0 38.0 38.0 15-19 37.55545 38.0 38.0 38.0 38.0 38.0 20-24 37.519 38.0 38.0 38.0 38.0 38.0 25-29 37.5274 38.0 38.0 38.0 37.6 38.0 30-34 37.51205 38.0 38.0 38.0 38.0 38.0 35-39 37.4766 38.0 38.0 38.0 38.0 38.0 40-44 37.43945 38.0 38.0 38.0 37.0 38.0 45-49 37.43615 38.0 38.0 38.0 37.0 38.0 50-54 37.37595 38.0 38.0 38.0 37.0 38.0 55-59 37.326 38.0 38.0 38.0 37.0 38.0 60-64 37.25755 38.0 38.0 38.0 37.0 38.0 65-69 37.25545 38.0 38.0 38.0 37.0 38.0 70-74 37.2229 38.0 38.0 38.0 36.8 38.0 75-79 37.1052 38.0 38.0 38.0 36.2 38.0 80-84 37.099450000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.04825 38.0 38.0 38.0 36.0 38.0 90-94 36.90925 38.0 38.0 38.0 36.0 38.0 95-99 36.785199999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.747 38.0 38.0 38.0 35.0 38.0 105-109 36.64919999999999 38.0 38.0 38.0 34.6 38.0 110-114 36.473349999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.42475 38.0 38.0 38.0 34.0 38.0 120-124 36.09505 38.0 37.4 38.0 33.4 38.0 125-129 35.915949999999995 38.0 37.0 38.0 32.8 38.0 130-134 35.6205 38.0 36.0 38.0 31.0 38.0 135-139 35.30884999999999 38.0 36.0 38.0 31.0 38.0 140-144 34.709199999999996 38.0 34.6 38.0 28.0 38.0 145-149 34.12915 38.0 33.8 38.0 25.6 38.0 150-151 29.603375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 5.0 16 3.0 17 0.0 18 1.0 19 2.0 20 1.0 21 3.0 22 2.0 23 10.0 24 6.0 25 8.0 26 14.0 27 16.0 28 26.0 29 30.0 30 34.0 31 37.0 32 48.0 33 93.0 34 115.0 35 211.0 36 577.0 37 2756.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.05912334352701 12.334352701325178 11.697247706422019 43.909276248725796 2 21.025 18.175 36.925000000000004 23.875 3 19.900000000000002 24.65 24.525 30.925000000000004 4 22.55 32.550000000000004 20.7 24.2 5 21.4 36.425000000000004 23.549999999999997 18.625 6 18.025 36.425000000000004 25.3 20.25 7 13.950000000000001 22.575 45.875 17.599999999999998 8 16.975 23.150000000000002 34.275 25.6 9 18.575 23.9 33.1 24.425 10-14 19.759999999999998 30.014999999999997 26.52 23.705000000000002 15-19 20.155 28.18 27.800000000000004 23.865 20-24 20.169999999999998 28.01 28.57 23.25 25-29 19.45 28.749999999999996 28.325 23.474999999999998 30-34 19.875 28.804999999999996 27.744999999999997 23.575 35-39 19.73 29.005 27.98 23.285 40-44 19.79 29.020000000000003 27.99 23.200000000000003 45-49 19.755 28.64 28.084999999999997 23.52 50-54 20.155 29.13 27.355 23.36 55-59 19.905 28.694999999999997 27.944999999999997 23.455000000000002 60-64 19.685 29.244999999999997 27.785 23.285 65-69 20.02 27.939999999999998 28.17 23.87 70-74 20.165 28.475 27.655 23.705000000000002 75-79 19.755 28.854999999999997 27.93 23.46 80-84 20.14 28.405 27.735 23.72 85-89 19.765 28.895 27.73 23.61 90-94 20.305 28.15 27.93 23.615 95-99 20.365 28.22 27.855 23.56 100-104 20.505000000000003 29.005 27.0 23.49 105-109 20.14 29.080000000000002 27.275 23.505000000000003 110-114 20.560000000000002 28.410000000000004 27.68 23.35 115-119 20.435 29.354999999999997 27.115000000000002 23.095 120-124 20.355 29.39 26.765 23.49 125-129 21.044999999999998 28.549999999999997 26.724999999999998 23.68 130-134 20.45 28.87 26.82 23.86 135-139 20.395 28.74 26.700000000000003 24.165 140-144 20.91 28.87 26.47 23.75 145-149 20.835 28.355000000000004 26.810000000000002 24.0 150-151 21.0375 28.8625 27.0125 23.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 1.5 25 2.5 26 7.0 27 8.5 28 13.0 29 16.0 30 22.0 31 30.5 32 39.0 33 48.5 34 62.5 35 76.0 36 89.5 37 124.5 38 153.0 39 160.0 40 190.0 41 224.0 42 239.5 43 254.0 44 263.5 45 277.5 46 278.5 47 247.5 48 216.0 49 185.0 50 157.5 51 136.5 52 110.0 53 93.0 54 70.5 55 49.0 56 39.0 57 32.0 58 21.0 59 16.0 60 14.5 61 7.5 62 5.0 63 3.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9749999999999999 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.175 0.0 0.0 0.0 0.0 110-111 3.5875000000000004 0.0 0.0 0.0 0.0 112-113 4.050000000000001 0.0 0.0 0.0 0.0 114-115 4.4625 0.0 0.0 0.0 0.0 116-117 4.949999999999999 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 5.824999999999999 0.0 0.0 0.0 0.0 122-123 6.3125 0.0 0.0 0.0 0.0 124-125 6.824999999999999 0.0 0.0 0.0 0.0 126-127 7.325 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.1625 0.0 0.0 0.0 0.0 132-133 8.8125 0.0 0.0 0.0 0.0 134-135 9.4625 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTG 10 0.006832588 144.9875 4 TGGATGT 10 0.006832588 144.9875 3 TCATAGT 10 0.006832588 144.9875 9 GTCACCT 30 0.0014445208 24.164585 140-144 TCACCTC 30 0.0014445208 24.164585 140-144 TCCAGTC 40 0.0076588374 18.123438 135-139 >>END_MODULE SRR7168851 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 33.01425 34.0 33.0 34.0 32.0 34.0 3 33.059 34.0 33.0 34.0 32.0 34.0 4 33.0245 34.0 33.0 34.0 33.0 34.0 5 33.037 34.0 33.0 34.0 32.0 34.0 6 37.26325 38.0 38.0 38.0 37.0 38.0 7 37.3065 38.0 38.0 38.0 37.0 38.0 8 37.33675 38.0 38.0 38.0 37.0 38.0 9 37.33125 38.0 38.0 38.0 37.0 38.0 10-14 37.310249999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.3141 38.0 38.0 38.0 37.0 38.0 20-24 37.307500000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.28285 38.0 38.0 38.0 37.0 38.0 30-34 37.259499999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.24855 38.0 38.0 38.0 37.0 38.0 40-44 37.22625 38.0 38.0 38.0 37.0 38.0 45-49 37.21125 38.0 38.0 38.0 37.0 38.0 50-54 37.14565 38.0 38.0 38.0 37.0 38.0 55-59 37.054649999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1005 38.0 38.0 38.0 36.8 38.0 65-69 37.0723 38.0 38.0 38.0 36.6 38.0 70-74 37.002250000000004 38.0 38.0 38.0 36.2 38.0 75-79 36.929700000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.87395 38.0 38.0 38.0 36.0 38.0 85-89 36.72705 38.0 38.0 38.0 35.6 38.0 90-94 36.6563 38.0 38.0 38.0 35.0 38.0 95-99 36.6723 38.0 38.0 38.0 35.0 38.0 100-104 36.5321 38.0 38.0 38.0 34.8 38.0 105-109 36.41425 38.0 38.0 38.0 34.2 38.0 110-114 36.21804999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.130300000000005 38.0 38.0 38.0 33.8 38.0 120-124 35.87505 38.0 37.4 38.0 32.4 38.0 125-129 35.7214 38.0 37.0 38.0 32.6 38.0 130-134 35.41435 38.0 36.4 38.0 31.2 38.0 135-139 35.026599999999995 38.0 36.0 38.0 29.2 38.0 140-144 34.5555 38.0 36.0 38.0 28.0 38.0 145-149 33.533300000000004 38.0 33.4 38.0 21.2 38.0 150-151 28.580875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 2.0 7 0.0 8 1.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 2.0 15 0.0 16 1.0 17 6.0 18 8.0 19 3.0 20 6.0 21 7.0 22 8.0 23 11.0 24 17.0 25 12.0 26 13.0 27 18.0 28 29.0 29 24.0 30 35.0 31 58.0 32 52.0 33 90.0 34 119.0 35 231.0 36 512.0 37 2724.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 19.0 16.0 32.9 2 24.425 26.150000000000002 34.525 14.899999999999999 3 20.3 28.050000000000004 30.475 21.175 4 23.599999999999998 35.525 22.15 18.725 5 23.925 38.074999999999996 22.275 15.725 6 19.025 37.375 25.25 18.35 7 18.15 19.25 41.5 21.099999999999998 8 21.5 23.025000000000002 30.2 25.275 9 21.349999999999998 24.5 30.55 23.599999999999998 10-14 23.16 28.884999999999998 26.735 21.22 15-19 22.585 27.779999999999998 28.645 20.990000000000002 20-24 23.01 28.48 28.21 20.3 25-29 22.755 27.825 28.389999999999997 21.029999999999998 30-34 22.509999999999998 27.800000000000004 28.605000000000004 21.085 35-39 22.8 28.060000000000002 28.389999999999997 20.75 40-44 22.46 27.935 28.67 20.935000000000002 45-49 22.555 27.915 28.544999999999998 20.985 50-54 22.21 27.575 28.92 21.295 55-59 23.345 27.744999999999997 28.23 20.68 60-64 22.835 27.49 28.7 20.974999999999998 65-69 22.855 28.27 28.465 20.41 70-74 23.064999999999998 28.005000000000003 28.105000000000004 20.825 75-79 22.915 27.68 28.57 20.835 80-84 23.44 27.650000000000002 27.88 21.029999999999998 85-89 22.84 28.18 28.33 20.65 90-94 23.525 28.77 27.76 19.945 95-99 23.40468093618724 27.675535107021403 28.665733146629325 20.254050810162035 100-104 23.38350752612892 28.264239635945394 28.349252387858183 20.00300045006751 105-109 23.700925231307828 28.052013003250813 28.22205551387847 20.02500625156289 110-114 24.02360354053108 28.34425163774566 27.989198379756964 19.642946441966295 115-119 24.39487897579516 27.745549109821965 27.720544108821766 20.139027805561113 120-124 24.337433743374337 28.332833283328334 27.622762276227625 19.706970697069707 125-129 25.040000000000003 28.15 27.495000000000005 19.314999999999998 130-134 25.153773065959896 28.324248637295597 27.029054358153726 19.49292393859079 135-139 25.20878131719758 27.74916237435615 27.799169875481322 19.242886432964944 140-144 25.195 28.025 27.24 19.54 145-149 25.6 27.744999999999997 27.310000000000002 19.345000000000002 150-151 26.275 27.8875 26.6625 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.5 24 1.5 25 3.0 26 5.0 27 7.0 28 10.5 29 16.0 30 20.0 31 22.5 32 34.0 33 43.5 34 53.0 35 74.0 36 91.5 37 106.5 38 144.0 39 186.0 40 209.0 41 231.5 42 270.5 43 287.5 44 277.5 45 269.5 46 260.5 47 250.5 48 226.5 49 186.5 50 145.5 51 121.0 52 102.0 53 80.5 54 63.0 55 44.5 56 31.0 57 30.5 58 23.5 59 17.0 60 13.0 61 7.5 62 6.5 63 3.0 64 2.0 65 3.0 66 3.0 67 3.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.015 105-109 0.025 110-114 0.015 115-119 0.02 120-124 0.01 125-129 0.0 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.45294413688978363 0.8999999999999999 3 0.10065425264217413 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0375 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 2.025 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.225 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.525 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.512499999999999 0.0 0.0 0.0 0.0 120-121 5.9 0.0 0.0 0.0 0.0 122-123 6.3875 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.45 0.0 0.0 0.0 0.0 128-129 7.9 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 8.9375 0.0 0.0 0.0 0.0 134-135 9.5875 0.0 0.0 0.0 0.0 136-137 10.1875 0.0 0.0 0.0 0.0 138-139 10.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGAT 35 1.1966578E-4 24.857143 140-144 GTGTAGA 30 0.0014437955 24.166668 140-144 AAGAGTG 35 0.0035366106 20.714287 135-139 GTAGATC 40 0.0076550315 18.125 140-144 TCGTGTA 40 0.0076550315 18.125 125-129 AAAGAGT 40 0.0076550315 18.125 135-139 >>END_MODULE Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716832 spots for SRR7168851.sra Written 716832 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra Read 716830 spots for SRR7168851.sra Written 716830 spots for SRR7168851.sra SRR ids: ['SRR7168851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hopvnx_a SRR7168851.sra spots: 14336602 blocks: [[1, 716830], [716831, 1433660], [1433661, 2150490], [2150491, 2867320], [2867321, 3584150], [3584151, 4300980], [4300981, 5017810], [5017811, 5734640], [5734641, 6451470], [6451471, 7168300], [7168301, 7885130], [7885131, 8601960], [8601961, 9318790], [9318791, 10035620], [10035621, 10752450], [10752451, 11469280], [11469281, 12186110], [12186111, 12902940], [12902941, 13619770], [13619771, 14336602]] SRR7168851 file size 4836503 SRR7168851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168851 SRR7168851_1.fastq SRR7168851_2.fastq Input file: SRR7168851_1.fastq Paired file: SRR7168851_2.fastq trimmed: SRR7168851-trimmed-pair1.fastq, SRR7168851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 07:48:40 2025 >> started Sat Feb 15 07:49:00 2025 >> done (19.870s) 14336602 read pairs processed; of these: 12710 ( 0.09%) short read pairs filtered out after trimming by size control 16364 ( 0.11%) empty read pairs filtered out after trimming by size control 14307528 (99.80%) read pairs available; of these: 7698534 (53.81%) trimmed read pairs available after processing 6608994 (46.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 10 0.00% 26 3 0.00% 27 13 0.00% 28 7 0.00% 29 12 0.00% 30 12 0.00% 31 15 0.00% 32 21 0.00% 33 22 0.00% 34 22 0.00% 35 24 0.00% 36 31 0.00% 37 37 0.00% 38 44 0.00% 39 50 0.00% 40 56 0.00% 41 76 0.00% 42 67 0.00% 43 90 0.00% 44 108 0.00% 45 108 0.00% 46 107 0.00% 47 119 0.00% 48 152 0.00% 49 171 0.00% 50 195 0.00% 51 228 0.00% 52 235 0.00% 53 293 0.00% 54 293 0.00% 55 298 0.00% 56 404 0.00% 57 385 0.00% 58 529 0.00% 59 498 0.00% 60 597 0.00% 61 724 0.01% 62 795 0.01% 63 898 0.01% 64 912 0.01% 65 1091 0.01% 66 1139 0.01% 67 1269 0.01% 68 1416 0.01% 69 1588 0.01% 70 1884 0.01% 71 2073 0.01% 72 2298 0.02% 73 2635 0.02% 74 2849 0.02% 75 3086 0.02% 76 3397 0.02% 77 3682 0.03% 78 4058 0.03% 79 4542 0.03% 80 5026 0.04% 81 5756 0.04% 82 6298 0.04% 83 7085 0.05% 84 7874 0.06% 85 8860 0.06% 86 9320 0.07% 87 10035 0.07% 88 10560 0.07% 89 11421 0.08% 90 12522 0.09% 91 12908 0.09% 92 14167 0.10% 93 15747 0.11% 94 16487 0.12% 95 17708 0.12% 96 18286 0.13% 97 19339 0.14% 98 19345 0.14% 99 20302 0.14% 100 21776 0.15% 101 22336 0.16% 102 23750 0.17% 103 25265 0.18% 104 26307 0.18% 105 27237 0.19% 106 28251 0.20% 107 29164 0.20% 108 29867 0.21% 109 31260 0.22% 110 31842 0.22% 111 33151 0.23% 112 34598 0.24% 113 35377 0.25% 114 36865 0.26% 115 38763 0.27% 116 39233 0.27% 117 40179 0.28% 118 41297 0.29% 119 41557 0.29% 120 42157 0.29% 121 43716 0.31% 122 44899 0.31% 123 46904 0.33% 124 48594 0.34% 125 49667 0.35% 126 51686 0.36% 127 52763 0.37% 128 53342 0.37% 129 54799 0.38% 130 56315 0.39% 131 57717 0.40% 132 60181 0.42% 133 62188 0.43% 134 65183 0.46% 135 67981 0.48% 136 70926 0.50% 137 74046 0.52% 138 77652 0.54% 139 82229 0.57% 140 86896 0.61% 141 93013 0.65% 142 101622 0.71% 143 113303 0.79% 144 129631 0.91% 145 151391 1.06% 146 186393 1.30% 147 247342 1.73% 148 366575 2.56% 149 718068 5.02% 150 3408545 23.82% 151 6608994 46.19% 14307528 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=230.19 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=29.26 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=9.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7168851 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 07:50:25 Started mapping on | Feb 15 07:50:25 Finished on | Feb 15 07:52:24 Mapping speed, Million of reads per hour | 432.83 Number of input reads | 14307528 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13271457 Uniquely mapped reads % | 92.76% Average mapped length | 289.91 Number of splices: Total | 12604716 Number of splices: Annotated (sjdb) | 12298162 Number of splices: GT/AG | 12363651 Number of splices: GC/AG | 193603 Number of splices: AT/AC | 7314 Number of splices: Non-canonical | 40148 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377874 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 87961 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667487 667487 667487 N_multimapping 377874 377874 377874 N_noFeature 582950 12956414 784344 N_ambiguous 207735 1581 92844 UnstrandedReadsAssigned:12480772 PositiveStrandReadsAssigned:313462 NegativeStrandReadsAssigned:12394269 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168851-trimmed-pair1.fastq SRR7168851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,307,528 reads, 12,400,991 reads pseudoaligned [quant] estimated average fragment length: 226.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7168851.ke.tsv 34699 SRR7168851.se.tsv 87100 total ==> SRR7168851.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.21 819 38.6288 Potri.005G024800.1.v4.1 1035 809.208 189 19.7432 Potri.004G059700.1.v4.1 961 735.256 5 0.57484 Potri.007G009000.2.v4.1 1416 1190.21 0 0 Potri.003G141000.2.v4.1 2943 2717.21 951.736 29.608 Potri.016G087400.1.v4.1 270 90.5333 808 754.43 Potri.015G069301.1.v4.1 564 342.346 0 0 Potri.010G195200.1.v4.1 1773 1547.21 388.968 21.2511 Potri.012G127500.1.v4.1 977 751.235 58 6.52631 ==> SRR7168851.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 549 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 296 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7168851 completed mapping pipeline successfully