Starting /dee2/code/volunteer_pipeline.sh SRR7168852 current disk space = 3092858556416 free memory = 1449113036 SRR7168852 SRAfilesize 6c4e41c351f74430ceb778a4d8820fcf SRR7168852.sra SRR7168852.sra file validated SRR7168852 is paired end SRR7168852 is conventional basespace SRR7168852 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1885 34.0 34.0 34.0 33.0 34.0 2 33.395 34.0 34.0 34.0 33.0 34.0 3 33.49325 34.0 34.0 34.0 33.0 34.0 4 33.604 34.0 34.0 34.0 33.0 34.0 5 33.61925 34.0 34.0 34.0 33.0 34.0 6 37.49175 38.0 38.0 38.0 37.0 38.0 7 37.56325 38.0 38.0 38.0 37.0 38.0 8 37.64875 38.0 38.0 38.0 38.0 38.0 9 37.70125 38.0 38.0 38.0 38.0 38.0 10-14 37.7054 38.0 38.0 38.0 38.0 38.0 15-19 37.68145 38.0 38.0 38.0 38.0 38.0 20-24 37.64635 38.0 38.0 38.0 38.0 38.0 25-29 37.59655 38.0 38.0 38.0 38.0 38.0 30-34 37.606550000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.65445 38.0 38.0 38.0 38.0 38.0 40-44 37.60079999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.596199999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.5467 38.0 38.0 38.0 38.0 38.0 55-59 37.47885 38.0 38.0 38.0 38.0 38.0 60-64 37.4768 38.0 38.0 38.0 37.4 38.0 65-69 37.40485 38.0 38.0 38.0 37.0 38.0 70-74 37.389450000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.31655 38.0 38.0 38.0 37.0 38.0 80-84 37.2143 38.0 38.0 38.0 37.0 38.0 85-89 37.14955 38.0 38.0 38.0 36.6 38.0 90-94 37.0706 38.0 38.0 38.0 36.0 38.0 95-99 36.9331 38.0 38.0 38.0 35.8 38.0 100-104 36.90215 38.0 38.0 38.0 35.6 38.0 105-109 36.72234999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.61195 38.0 38.0 38.0 34.8 38.0 115-119 36.44375 38.0 38.0 38.0 34.0 38.0 120-124 36.249100000000006 38.0 37.8 38.0 34.0 38.0 125-129 36.0216 38.0 37.4 38.0 33.4 38.0 130-134 35.788 38.0 36.8 38.0 32.2 38.0 135-139 35.470150000000004 38.0 36.0 38.0 31.8 38.0 140-144 34.97355 38.0 35.8 38.0 29.6 38.0 145-149 34.246900000000004 38.0 33.8 38.0 27.6 38.0 150-151 29.76075 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 6.0 20 4.0 21 3.0 22 5.0 23 4.0 24 7.0 25 8.0 26 14.0 27 7.0 28 14.0 29 14.0 30 29.0 31 32.0 32 40.0 33 60.0 34 125.0 35 189.0 36 570.0 37 2861.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.10878112712975 12.477064220183486 11.428571428571429 36.98558322411533 2 22.025 17.75 33.425 26.8 3 19.0 24.175 25.624999999999996 31.2 4 21.675 30.349999999999998 23.1 24.875 5 21.226533166458072 35.66958698372966 23.27909887359199 19.824780976220275 6 18.4 36.75 23.65 21.2 7 14.000000000000002 25.074999999999996 43.275000000000006 17.65 8 17.349999999999998 26.224999999999998 30.15 26.275 9 17.5 24.95 33.074999999999996 24.474999999999998 10-14 19.705000000000002 29.74 27.134999999999998 23.419999999999998 15-19 20.02 28.645 27.794999999999998 23.54 20-24 20.19 28.92 27.065 23.825 25-29 19.676967696769676 29.687968796879687 26.892689268926894 23.742374237423743 30-34 20.11108887109688 28.617894315452364 27.802241793434746 23.468775020016015 35-39 19.80396079215843 28.550710142028407 28.330666133226647 23.314662932586515 40-44 20.16 28.599999999999998 28.04 23.200000000000003 45-49 20.005 28.915000000000003 27.48 23.599999999999998 50-54 19.955000000000002 28.46 28.07 23.515 55-59 19.735 28.87 27.700000000000003 23.695 60-64 20.3 29.01 27.46 23.23 65-69 20.015 28.42 27.675 23.89 70-74 19.31 28.945 28.175 23.57 75-79 20.549999999999997 27.950000000000003 27.98 23.52 80-84 20.46 28.665000000000003 27.375 23.5 85-89 19.865 29.195 27.339999999999996 23.599999999999998 90-94 20.415 27.884999999999998 28.28 23.419999999999998 95-99 19.735 28.51 28.189999999999998 23.565 100-104 20.29 28.189999999999998 27.13 24.39 105-109 20.630000000000003 28.115000000000002 27.894999999999996 23.36 110-114 20.880000000000003 28.625 27.26 23.235 115-119 20.794999999999998 28.88 26.919999999999998 23.405 120-124 20.544999999999998 28.89 26.790000000000003 23.775 125-129 20.825 28.215 26.82 24.14 130-134 20.630000000000003 28.499999999999996 26.985 23.885 135-139 20.369999999999997 28.29 27.07 24.27 140-144 20.535 28.499999999999996 26.540000000000003 24.425 145-149 20.080000000000002 29.2 26.674999999999997 24.044999999999998 150-151 20.539861895794097 28.436911487758948 26.779661016949152 24.243565599497803 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 3.0 26 4.0 27 5.5 28 8.5 29 11.5 30 16.5 31 28.5 32 41.0 33 46.0 34 62.5 35 82.0 36 96.5 37 120.0 38 141.0 39 170.5 40 204.0 41 226.0 42 255.5 43 282.5 44 266.5 45 249.0 46 248.0 47 226.5 48 225.0 49 204.5 50 176.0 51 146.0 52 106.5 53 84.5 54 63.0 55 52.5 56 45.5 57 35.0 58 18.0 59 13.5 60 11.0 61 5.5 62 4.5 63 2.5 64 3.0 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.08 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52177196073497 98.85000000000001 2 0.3523785552479235 0.7000000000000001 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025169896803423106 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACATCTATCTCGTATGC 6 0.15 TruSeq Adapter, Index 8 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9750000000000001 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7999999999999998 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.2874999999999996 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.175 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.7625 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.55 0.0 0.0 0.0 0.0 126-127 5.9 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 6.925000000000001 0.0 0.0 0.0 0.0 132-133 7.2625 0.0 0.0 0.0 0.0 134-135 7.8625 0.0 0.0 0.0 0.0 136-137 8.3 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAAT 10 0.005853838 152.57895 1 >>END_MODULE SRR7168852 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12575 34.0 33.0 34.0 33.0 34.0 2 33.24125 34.0 33.0 34.0 33.0 34.0 3 33.25325 34.0 33.0 34.0 33.0 34.0 4 33.27925 34.0 33.0 34.0 33.0 34.0 5 33.254 34.0 33.0 34.0 33.0 34.0 6 37.42325 38.0 38.0 38.0 38.0 38.0 7 37.46625 38.0 38.0 38.0 38.0 38.0 8 37.44075 38.0 38.0 38.0 38.0 38.0 9 37.49675 38.0 38.0 38.0 38.0 38.0 10-14 37.4367 38.0 38.0 38.0 38.0 38.0 15-19 37.47225 38.0 38.0 38.0 38.0 38.0 20-24 37.429700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.423 38.0 38.0 38.0 38.0 38.0 30-34 37.40175000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.376149999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.403499999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.3495 38.0 38.0 38.0 38.0 38.0 50-54 37.307399999999994 38.0 38.0 38.0 38.0 38.0 55-59 37.3111 38.0 38.0 38.0 38.0 38.0 60-64 37.30955 38.0 38.0 38.0 38.0 38.0 65-69 37.20765 38.0 38.0 38.0 37.4 38.0 70-74 37.1258 38.0 38.0 38.0 37.0 38.0 75-79 37.1128 38.0 38.0 38.0 37.0 38.0 80-84 36.97775 38.0 38.0 38.0 36.8 38.0 85-89 36.9159 38.0 38.0 38.0 36.2 38.0 90-94 36.8395 38.0 38.0 38.0 36.0 38.0 95-99 36.822950000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.6885 38.0 38.0 38.0 35.6 38.0 105-109 36.65775 38.0 38.0 38.0 35.4 38.0 110-114 36.53655 38.0 38.0 38.0 35.0 38.0 115-119 36.30105 38.0 38.0 38.0 34.2 38.0 120-124 36.17115 38.0 38.0 38.0 34.0 38.0 125-129 35.967 38.0 38.0 38.0 33.4 38.0 130-134 35.74225 38.0 37.8 38.0 33.0 38.0 135-139 35.199200000000005 38.0 36.0 38.0 31.0 38.0 140-144 34.66325 38.0 36.0 38.0 28.2 38.0 145-149 33.8484 38.0 34.6 38.0 23.8 38.0 150-151 28.997375 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 1.0 6 1.0 7 2.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 5.0 15 2.0 16 5.0 17 9.0 18 5.0 19 4.0 20 6.0 21 5.0 22 3.0 23 7.0 24 10.0 25 13.0 26 12.0 27 14.0 28 10.0 29 23.0 30 20.0 31 28.0 32 51.0 33 55.0 34 90.0 35 177.0 36 483.0 37 2944.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.85 21.3 14.6 26.25 2 26.275 27.6 30.425 15.7 3 19.475 31.45 30.625000000000004 18.45 4 22.975 35.35 23.95 17.724999999999998 5 24.575 36.075 22.1 17.25 6 20.851063829787233 37.947434292866085 23.85481852315394 17.34668335419274 7 18.873591989987485 21.526908635794744 40.150187734668336 19.44931163954944 8 23.2540675844806 24.63078848560701 26.633291614518146 25.481852315394242 9 22.07759699624531 26.25782227784731 28.86107634543179 22.803504380475594 10-14 22.921359563498022 29.10346898933774 26.730740351404116 21.244431095760124 15-19 23.359198998748436 27.85481852315394 28.28535669586984 20.500625782227786 20-24 22.963704630788488 27.59949937421777 28.7008760951189 20.735919899874844 25-29 23.153942428035045 28.856070087609513 27.50938673341677 20.480600750938674 30-34 23.240212275958747 27.996395313908078 27.961349754681088 20.802042655452087 35-39 22.918231435581593 28.165840468679587 28.00060087126333 20.91532722447549 40-44 23.7275411641059 28.19178219308343 27.88148741304239 20.19918922976828 45-49 23.13503777455346 27.873117526392154 28.243358182818834 20.748486516235552 50-54 23.121965867574197 27.7113257594715 28.46203893699014 20.704669435964167 55-59 23.078848560700877 27.674593241551943 28.35043804755945 20.896120150187734 60-64 23.192831397677214 27.46796155386464 28.674409291149377 20.66479775730877 65-69 23.47699854833058 27.421534764979725 28.22746158081794 20.874005105871753 70-74 23.319148936170212 27.91989987484356 27.894868585732162 20.866082603254068 75-79 22.786647314949203 28.166758420499477 28.226815474700967 20.819778789850357 80-84 23.492890046064492 27.773883436811538 27.578610054075707 21.154616463048267 85-89 23.62188955089371 28.082911931106995 28.012817303359533 20.282381214639763 90-94 23.676043648012815 27.86064671138252 27.955751326459104 20.50755831414556 95-99 23.463212124243483 27.9697894262992 27.90476666833392 20.662231781123396 100-104 23.588255889561346 27.70469664382534 27.95478417446106 20.752263292152254 105-109 23.569141484890935 27.78166900140084 28.286972183309988 20.362217330398238 110-114 23.78689344672336 28.274137068534266 27.86893446723362 20.070035017508754 115-119 24.3229714171297 28.117334935175453 27.56670170696301 19.99299194073184 120-124 24.136377290477622 28.226694703114045 27.530790027035145 20.106137979373184 125-129 24.310387984981226 27.969962453066334 27.183979974968707 20.53566958698373 130-134 24.86107634543179 27.92991239048811 27.714643304130167 19.494367959949937 135-139 24.47058823529412 28.585732165206508 27.399249061326657 19.544430538172715 140-144 25.350210126075645 28.036822093255953 27.266359815889533 19.346607964778865 145-149 25.42669803293458 28.319735722508632 26.90324841083137 19.350317833725413 150-151 25.775 27.962500000000002 26.525 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 2.0 26 1.0 27 2.5 28 3.5 29 9.0 30 17.0 31 20.5 32 26.5 33 37.0 34 56.0 35 76.0 36 89.0 37 110.5 38 128.0 39 165.5 40 206.0 41 226.0 42 261.0 43 267.5 44 274.5 45 284.5 46 275.5 47 259.5 48 233.0 49 211.5 50 172.0 51 129.0 52 105.0 53 82.5 54 66.5 55 58.5 56 43.0 57 23.5 58 12.0 59 14.5 60 13.5 61 8.5 62 6.5 63 4.5 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.11499999999999999 15-19 0.125 20-24 0.125 25-29 0.125 30-34 0.13 35-39 0.145 40-44 0.095 45-49 0.065 50-54 0.095 55-59 0.125 60-64 0.12 65-69 0.11499999999999999 70-74 0.125 75-79 0.095 80-84 0.13999999999999999 85-89 0.135 90-94 0.11 95-99 0.034999999999999996 100-104 0.034999999999999996 105-109 0.06 110-114 0.05 115-119 0.11499999999999999 120-124 0.13 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.06 145-149 0.105 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21697398332913 98.2 2 0.6567314978529932 1.3 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7999999999999998 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.199999999999999 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 6.9625 0.0 0.0 0.0 0.0 132-133 7.3625 0.0 0.0 0.0 0.0 134-135 7.925000000000001 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAT 10 0.006830828 145.0 1 AATGCTG 10 0.006830828 145.0 5 >>END_MODULE Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568017 spots for SRR7168852.sra Written 568017 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra Read 568014 spots for SRR7168852.sra Written 568014 spots for SRR7168852.sra SRR ids: ['SRR7168852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gmdmj6ko SRR7168852.sra spots: 11360283 blocks: [[1, 568014], [568015, 1136028], [1136029, 1704042], [1704043, 2272056], [2272057, 2840070], [2840071, 3408084], [3408085, 3976098], [3976099, 4544112], [4544113, 5112126], [5112127, 5680140], [5680141, 6248154], [6248155, 6816168], [6816169, 7384182], [7384183, 7952196], [7952197, 8520210], [8520211, 9088224], [9088225, 9656238], [9656239, 10224252], [10224253, 10792266], [10792267, 11360283]] SRR7168852 file size 3827926 SRR7168852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168852 SRR7168852_1.fastq SRR7168852_2.fastq Input file: SRR7168852_1.fastq Paired file: SRR7168852_2.fastq trimmed: SRR7168852-trimmed-pair1.fastq, SRR7168852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 07:11:33 2025 >> started Sat Feb 15 07:11:52 2025 >> done (18.822s) 11360283 read pairs processed; of these: 14532 ( 0.13%) short read pairs filtered out after trimming by size control 29378 ( 0.26%) empty read pairs filtered out after trimming by size control 11316373 (99.61%) read pairs available; of these: 5862456 (51.81%) trimmed read pairs available after processing 5453917 (48.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 5 0.00% 21 3 0.00% 22 6 0.00% 23 7 0.00% 24 8 0.00% 25 8 0.00% 26 9 0.00% 27 7 0.00% 28 9 0.00% 29 7 0.00% 30 14 0.00% 31 10 0.00% 32 16 0.00% 33 9 0.00% 34 14 0.00% 35 14 0.00% 36 8 0.00% 37 12 0.00% 38 18 0.00% 39 22 0.00% 40 28 0.00% 41 31 0.00% 42 36 0.00% 43 41 0.00% 44 40 0.00% 45 43 0.00% 46 44 0.00% 47 51 0.00% 48 41 0.00% 49 73 0.00% 50 65 0.00% 51 82 0.00% 52 106 0.00% 53 113 0.00% 54 114 0.00% 55 128 0.00% 56 138 0.00% 57 154 0.00% 58 161 0.00% 59 189 0.00% 60 235 0.00% 61 262 0.00% 62 291 0.00% 63 317 0.00% 64 388 0.00% 65 411 0.00% 66 498 0.00% 67 514 0.00% 68 607 0.01% 69 1098 0.01% 70 1276 0.01% 71 1029 0.01% 72 1113 0.01% 73 1221 0.01% 74 1360 0.01% 75 1506 0.01% 76 1601 0.01% 77 1736 0.02% 78 1955 0.02% 79 2115 0.02% 80 2482 0.02% 81 2820 0.02% 82 3347 0.03% 83 3588 0.03% 84 4387 0.04% 85 4813 0.04% 86 5318 0.05% 87 5693 0.05% 88 5982 0.05% 89 6249 0.06% 90 6993 0.06% 91 7503 0.07% 92 8403 0.07% 93 9256 0.08% 94 9962 0.09% 95 10674 0.09% 96 11130 0.10% 97 11567 0.10% 98 12087 0.11% 99 12549 0.11% 100 13470 0.12% 101 14457 0.13% 102 15428 0.14% 103 16027 0.14% 104 17525 0.15% 105 18505 0.16% 106 18692 0.17% 107 19662 0.17% 108 19924 0.18% 109 20568 0.18% 110 21022 0.19% 111 22137 0.20% 112 23241 0.21% 113 24386 0.22% 114 25919 0.23% 115 26969 0.24% 116 27611 0.24% 117 28657 0.25% 118 29042 0.26% 119 29420 0.26% 120 30260 0.27% 121 31210 0.28% 122 32419 0.29% 123 33717 0.30% 124 35693 0.32% 125 36636 0.32% 126 38484 0.34% 127 39177 0.35% 128 40140 0.35% 129 40757 0.36% 130 41737 0.37% 131 42926 0.38% 132 44193 0.39% 133 46512 0.41% 134 48445 0.43% 135 50929 0.45% 136 53338 0.47% 137 55645 0.49% 138 57769 0.51% 139 60699 0.54% 140 63833 0.56% 141 68306 0.60% 142 73948 0.65% 143 81883 0.72% 144 92781 0.82% 145 107811 0.95% 146 132719 1.17% 147 174756 1.54% 148 266892 2.36% 149 533762 4.72% 150 2806184 24.80% 151 5453917 48.19% 11316373 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=16 prefix-density=0.43 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=228.70 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=18 prefix-density=0.41 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=82.89 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.3 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7168852 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 07:13:03 Started mapping on | Feb 15 07:13:03 Finished on | Feb 15 07:14:34 Mapping speed, Million of reads per hour | 447.68 Number of input reads | 11316373 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10596482 Uniquely mapped reads % | 93.64% Average mapped length | 291.63 Number of splices: Total | 10286893 Number of splices: Annotated (sjdb) | 10034487 Number of splices: GT/AG | 10077782 Number of splices: GC/AG | 173607 Number of splices: AT/AC | 5683 Number of splices: Non-canonical | 29821 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313348 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 21390 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416203 416203 416203 N_multimapping 313348 313348 313348 N_noFeature 419378 10374156 538572 N_ambiguous 179176 972 75314 UnstrandedReadsAssigned:9997928 PositiveStrandReadsAssigned:221354 NegativeStrandReadsAssigned:9982596 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168852-trimmed-pair1.fastq SRR7168852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,316,373 reads, 9,966,012 reads pseudoaligned [quant] estimated average fragment length: 227.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR7168852.ke.tsv 34699 SRR7168852.se.tsv 87100 total ==> SRR7168852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.96 487 25.8156 Potri.005G024800.1.v4.1 1035 808.963 177 20.7839 Potri.004G059700.1.v4.1 961 735.011 8 1.0339 Potri.007G009000.2.v4.1 1416 1189.96 0 0 Potri.003G141000.2.v4.1 2943 2716.96 619.504 21.6592 Potri.016G087400.1.v4.1 270 87.4558 624 677.764 Potri.015G069301.1.v4.1 564 342.117 0 0 Potri.010G195200.1.v4.1 1773 1546.96 41 2.5176 Potri.012G127500.1.v4.1 977 751.001 63 7.96861 ==> SRR7168852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 387 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168852 completed mapping pipeline successfully