Starting /dee2/code/volunteer_pipeline.sh SRR7168853 current disk space = 3092747599872 free memory = 1581617384 SRR7168853 SRAfilesize 9af7a0368c559c7dafb11ec0d814e1a7 SRR7168853.sra SRR7168853.sra file validated SRR7168853 is paired end SRR7168853 is conventional basespace SRR7168853 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.963 34.0 33.0 34.0 32.0 34.0 2 33.15925 34.0 33.0 34.0 32.0 34.0 3 33.1215 34.0 33.0 34.0 31.0 34.0 4 33.25025 34.0 33.0 34.0 33.0 34.0 5 33.29975 34.0 33.0 34.0 33.0 34.0 6 36.9885 38.0 37.0 38.0 36.0 38.0 7 37.3295 38.0 38.0 38.0 36.0 38.0 8 37.4365 38.0 38.0 38.0 37.0 38.0 9 37.52025 38.0 38.0 38.0 37.0 38.0 10-14 37.5182 38.0 38.0 38.0 37.2 38.0 15-19 37.4687 38.0 38.0 38.0 37.2 38.0 20-24 37.44115 38.0 38.0 38.0 37.0 38.0 25-29 37.322050000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.355450000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.337650000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.301750000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.237300000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.174350000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.110699999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.1254 38.0 38.0 38.0 36.2 38.0 65-69 37.077149999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.98065 38.0 38.0 38.0 35.8 38.0 75-79 36.8662 38.0 38.0 38.0 35.4 38.0 80-84 36.723 38.0 38.0 38.0 34.8 38.0 85-89 36.65835 38.0 38.0 38.0 34.4 38.0 90-94 36.5478 38.0 38.0 38.0 34.2 38.0 95-99 36.3585 38.0 38.0 38.0 34.0 38.0 100-104 36.208299999999994 38.0 37.0 38.0 33.6 38.0 105-109 36.08305 38.0 37.0 38.0 33.0 38.0 110-114 35.87515 38.0 37.0 38.0 31.8 38.0 115-119 35.7306 38.0 36.8 38.0 31.4 38.0 120-124 35.4212 38.0 36.0 38.0 30.2 38.0 125-129 35.0813 38.0 35.6 38.0 28.2 38.0 130-134 34.735749999999996 38.0 34.8 38.0 27.4 38.0 135-139 34.3005 38.0 34.8 38.0 24.2 38.0 140-144 33.632999999999996 38.0 33.4 38.0 22.2 38.0 145-149 32.72065 38.0 33.2 38.0 15.2 38.0 150-151 27.73375 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 0.0 17 2.0 18 1.0 19 4.0 20 3.0 21 6.0 22 12.0 23 3.0 24 14.0 25 14.0 26 18.0 27 26.0 28 26.0 29 33.0 30 55.0 31 64.0 32 73.0 33 99.0 34 176.0 35 341.0 36 814.0 37 2211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.069353572363255 11.88170635959173 13.713687516356973 39.335252551688036 2 23.275000000000002 16.75 34.475 25.5 3 20.575 22.6 23.95 32.875 4 23.799999999999997 31.075000000000003 20.775 24.349999999999998 5 22.347347347347345 36.486486486486484 22.597597597597595 18.56856856856857 6 19.0 35.575 23.95 21.475 7 13.825000000000001 25.0 42.875 18.3 8 17.599999999999998 24.725 31.424999999999997 26.25 9 18.575 24.025 32.574999999999996 24.825 10-14 20.18 29.86 26.919999999999998 23.04 15-19 19.835 28.565 27.744999999999997 23.855 20-24 19.545 28.384999999999998 28.410000000000004 23.66 25-29 19.82 28.804999999999996 27.765 23.61 30-34 20.0 28.895 27.51 23.595 35-39 19.785 28.93 27.83 23.455000000000002 40-44 19.64 28.53 28.105000000000004 23.724999999999998 45-49 19.919999999999998 28.705000000000002 27.82 23.555 50-54 19.725 28.99 27.615000000000002 23.669999999999998 55-59 20.1 28.73 27.785 23.385 60-64 20.435 28.16 27.894999999999996 23.51 65-69 19.905 28.715000000000003 27.845 23.535 70-74 20.424999999999997 28.315 28.044999999999998 23.215 75-79 20.285 28.675 27.48 23.56 80-84 20.43 28.560000000000002 27.595 23.415 85-89 20.47 28.360000000000003 28.04 23.13 90-94 20.335 28.455000000000002 27.255000000000003 23.955000000000002 95-99 20.31 28.355000000000004 27.77 23.565 100-104 20.455000000000002 28.449999999999996 27.12 23.974999999999998 105-109 20.31 28.384999999999998 27.51 23.794999999999998 110-114 20.805 28.994999999999997 27.700000000000003 22.5 115-119 20.45 28.875 27.400000000000002 23.275000000000002 120-124 20.72 28.910000000000004 27.33 23.04 125-129 21.08 28.060000000000002 27.205000000000002 23.655 130-134 21.015 28.43 27.365000000000002 23.189999999999998 135-139 20.674999999999997 28.315 27.384999999999998 23.625 140-144 21.04 28.535 27.544999999999998 22.88 145-149 20.830000000000002 29.14 27.04 22.99 150-151 20.741206030150757 28.75628140703518 27.1356783919598 23.366834170854272 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 4.5 26 6.5 27 6.0 28 10.5 29 15.5 30 20.0 31 24.5 32 32.0 33 48.0 34 65.5 35 80.5 36 88.0 37 112.0 38 149.0 39 172.5 40 190.5 41 203.0 42 230.0 43 251.0 44 267.0 45 284.5 46 271.0 47 251.0 48 234.0 49 210.5 50 169.5 51 122.5 52 100.0 53 88.5 54 75.5 55 58.5 56 38.0 57 29.5 58 23.0 59 15.0 60 15.5 61 11.5 62 3.5 63 3.0 64 4.0 65 3.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74918485076498 99.425 2 0.200652119388011 0.4 3 0.025081514923501375 0.075 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.775 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.4375 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.1375 0.0 0.0 0.0 0.0 138-139 7.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGATC 10 0.006830828 145.0 145 ATCCAGT 10 0.006830828 145.0 6 >>END_MODULE SRR7168853 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89925 33.0 33.0 34.0 32.0 34.0 2 33.04525 34.0 33.0 34.0 32.0 34.0 3 33.06175 34.0 33.0 34.0 32.0 34.0 4 33.008 34.0 33.0 34.0 33.0 34.0 5 33.017 34.0 33.0 34.0 33.0 34.0 6 37.2205 38.0 38.0 38.0 37.0 38.0 7 37.3325 38.0 38.0 38.0 37.0 38.0 8 37.2155 38.0 38.0 38.0 37.0 38.0 9 37.18025 38.0 38.0 38.0 37.0 38.0 10-14 37.199349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.11545 38.0 38.0 38.0 37.0 38.0 20-24 37.07025 38.0 38.0 38.0 37.0 38.0 25-29 37.05015 38.0 38.0 38.0 37.0 38.0 30-34 37.01754999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.98035 38.0 38.0 38.0 36.6 38.0 40-44 36.998149999999995 38.0 38.0 38.0 36.8 38.0 45-49 36.9202 38.0 38.0 38.0 36.2 38.0 50-54 36.88125 38.0 38.0 38.0 36.0 38.0 55-59 36.7346 38.0 38.0 38.0 36.0 38.0 60-64 36.7763 38.0 38.0 38.0 36.0 38.0 65-69 36.69605 38.0 38.0 38.0 35.8 38.0 70-74 36.6522 38.0 38.0 38.0 35.6 38.0 75-79 36.48035 38.0 38.0 38.0 34.8 38.0 80-84 36.366550000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.2218 38.0 38.0 38.0 34.0 38.0 90-94 36.17135 38.0 38.0 38.0 34.0 38.0 95-99 36.050200000000004 38.0 38.0 38.0 33.6 38.0 100-104 35.89405000000001 38.0 37.8 38.0 33.0 38.0 105-109 35.78845 38.0 37.2 38.0 32.4 38.0 110-114 35.6192 38.0 37.0 38.0 31.6 38.0 115-119 35.39399999999999 38.0 37.0 38.0 30.6 38.0 120-124 34.814949999999996 38.0 36.0 38.0 27.4 38.0 125-129 34.40235 38.0 35.2 38.0 25.0 38.0 130-134 34.21565 38.0 35.0 38.0 23.4 38.0 135-139 33.57495 38.0 34.0 38.0 21.4 38.0 140-144 32.84055 38.0 32.8 38.0 15.4 38.0 145-149 31.85635 38.0 32.6 38.0 10.4 38.0 150-151 27.048499999999997 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 1.0 5 2.0 6 1.0 7 1.0 8 4.0 9 1.0 10 5.0 11 4.0 12 1.0 13 3.0 14 8.0 15 3.0 16 2.0 17 5.0 18 6.0 19 3.0 20 13.0 21 17.0 22 17.0 23 23.0 24 19.0 25 18.0 26 16.0 27 30.0 28 25.0 29 29.0 30 46.0 31 51.0 32 63.0 33 106.0 34 156.0 35 277.0 36 748.0 37 2286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.95 16.6 20.150000000000002 29.299999999999997 2 27.325 25.474999999999998 30.175 17.025000000000002 3 21.96098049024512 27.138569284642323 29.989994997498748 20.910455227613806 4 23.56178089044522 34.54227113556778 21.76088044022011 20.135067533766886 5 23.986993496748372 37.44372186093047 22.211105552776388 16.358179089544773 6 19.375 37.974999999999994 23.549999999999997 19.1 7 19.175 18.65 41.225 20.95 8 23.261630815407706 25.162581290645324 26.688344172086044 24.88744372186093 9 21.75 23.875 29.9 24.474999999999998 10-14 22.87186155846754 28.76863058917675 27.13313994198259 21.226367910373114 15-19 22.685671417854465 28.042010502625658 27.556889222305575 21.715428857214302 20-24 22.818691214728837 27.881729037422453 27.65159095457274 21.647988793275967 25-29 22.88144072036018 28.009004502251127 28.254127063531765 20.855427713856926 30-34 22.708625175105063 27.796678006804083 28.47208324994997 21.022613568140887 35-39 22.43070149104373 28.024617232062443 28.209746822775944 21.33493445411788 40-44 22.940323145415437 27.997598919513784 28.267720474213398 20.794357460857384 45-49 22.81184355306592 27.80334100230069 28.433530059017702 20.951285385615684 50-54 22.69180754226268 27.888366509952984 28.37851355406622 21.041312393718115 55-59 23.51440576230492 27.866146458583437 27.485994397759107 21.133453381352542 60-64 22.989597919583918 27.38047609521904 28.32066413282657 21.309261852370472 65-69 23.232778027915355 27.910350692881085 28.190504777627694 20.666366501575865 70-74 23.135410934920714 26.792056425391426 28.772947826521932 21.299584813165925 75-79 22.76024210894903 27.98759441748787 28.127657445850634 21.12450602771247 80-84 23.51498773957864 27.728569283891307 27.913726667667515 20.84271630886253 85-89 23.24010606894481 27.97818582078351 27.75303947565918 21.028668634612497 90-94 23.838110961028566 27.880334183801093 27.30001500825454 20.981539846915805 95-99 23.044999999999998 28.549999999999997 27.72 20.685000000000002 100-104 23.349339735894358 27.591036414565828 27.916166466586635 21.143457382953184 105-109 23.577357735773578 27.63776377637764 28.487848784878487 20.2970297029703 110-114 23.602360236023603 28.342834283428342 27.30773077307731 20.747074707470748 115-119 23.516758379189596 28.149074537268636 28.249124562281143 20.08504252126063 120-124 24.51971182709626 28.311987192315392 27.396437862717633 19.771863117870723 125-129 24.5084796638151 28.045424983741057 27.400070038521186 20.04602531392266 130-134 24.763572679509632 27.610708031023268 27.990993244933698 19.634726044533398 135-139 23.79546705358483 28.1532996447691 27.873117526392154 20.178115775253914 140-144 24.91498299659932 27.980596119223843 27.520504100820165 19.583916783356674 145-149 24.792437731319396 27.658297489246774 27.778333500050017 19.770931279383817 150-151 25.25 28.375 27.037499999999998 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 0.0 25 2.0 26 2.5 27 3.0 28 7.5 29 11.0 30 17.5 31 28.0 32 30.0 33 32.5 34 40.5 35 61.5 36 87.0 37 114.0 38 140.0 39 158.0 40 203.5 41 244.5 42 254.5 43 266.5 44 270.0 45 265.5 46 270.5 47 251.5 48 225.0 49 207.5 50 158.5 51 116.5 52 104.0 53 99.5 54 92.0 55 65.0 56 41.0 57 33.5 58 30.5 59 24.0 60 14.0 61 6.5 62 3.0 63 3.5 64 3.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.05 9 0.0 10-14 0.03 15-19 0.025 20-24 0.06 25-29 0.05 30-34 0.06 35-39 0.06999999999999999 40-44 0.045 45-49 0.03 50-54 0.03 55-59 0.04 60-64 0.02 65-69 0.055 70-74 0.045 75-79 0.045 80-84 0.08499999999999999 85-89 0.065 90-94 0.055 95-99 0.0 100-104 0.04 105-109 0.01 110-114 0.01 115-119 0.05 120-124 0.06 125-129 0.055 130-134 0.075 135-139 0.065 140-144 0.02 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.4124999999999996 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.4875 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATGCT 10 0.006830828 145.0 7 TAAGATC 10 0.006830828 145.0 145 TCATCTT 10 0.006830828 145.0 8 >>END_MODULE Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra Read 827438 spots for SRR7168853.sra Written 827438 spots for SRR7168853.sra SRR ids: ['SRR7168853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5s4eb6hl SRR7168853.sra spots: 16548760 blocks: [[1, 827438], [827439, 1654876], [1654877, 2482314], [2482315, 3309752], [3309753, 4137190], [4137191, 4964628], [4964629, 5792066], [5792067, 6619504], [6619505, 7446942], [7446943, 8274380], [8274381, 9101818], [9101819, 9929256], [9929257, 10756694], [10756695, 11584132], [11584133, 12411570], [12411571, 13239008], [13239009, 14066446], [14066447, 14893884], [14893885, 15721322], [15721323, 16548760]] SRR7168853 file size 5586131 SRR7168853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168853 SRR7168853_1.fastq SRR7168853_2.fastq Input file: SRR7168853_1.fastq Paired file: SRR7168853_2.fastq trimmed: SRR7168853-trimmed-pair1.fastq, SRR7168853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:40:03 2025 >> started Sat Feb 15 08:40:30 2025 >> done (26.374s) 16548760 read pairs processed; of these: 18438 ( 0.11%) short read pairs filtered out after trimming by size control 41777 ( 0.25%) empty read pairs filtered out after trimming by size control 16488545 (99.64%) read pairs available; of these: 8971172 (54.41%) trimmed read pairs available after processing 7517373 (45.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 3 0.00% 21 1 0.00% 22 9 0.00% 23 2 0.00% 24 7 0.00% 25 2 0.00% 26 3 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 10 0.00% 31 10 0.00% 32 11 0.00% 33 6 0.00% 34 11 0.00% 35 14 0.00% 36 13 0.00% 37 18 0.00% 38 13 0.00% 39 17 0.00% 40 24 0.00% 41 33 0.00% 42 36 0.00% 43 34 0.00% 44 40 0.00% 45 46 0.00% 46 47 0.00% 47 52 0.00% 48 61 0.00% 49 84 0.00% 50 86 0.00% 51 93 0.00% 52 94 0.00% 53 120 0.00% 54 150 0.00% 55 130 0.00% 56 165 0.00% 57 162 0.00% 58 223 0.00% 59 246 0.00% 60 258 0.00% 61 312 0.00% 62 335 0.00% 63 370 0.00% 64 452 0.00% 65 567 0.00% 66 578 0.00% 67 662 0.00% 68 869 0.01% 69 2012 0.01% 70 1723 0.01% 71 1292 0.01% 72 1246 0.01% 73 1419 0.01% 74 1593 0.01% 75 1712 0.01% 76 1918 0.01% 77 1996 0.01% 78 2318 0.01% 79 2635 0.02% 80 2887 0.02% 81 3322 0.02% 82 3811 0.02% 83 4256 0.03% 84 5151 0.03% 85 5671 0.03% 86 6232 0.04% 87 6888 0.04% 88 7390 0.04% 89 7757 0.05% 90 8499 0.05% 91 9173 0.06% 92 9769 0.06% 93 10851 0.07% 94 11466 0.07% 95 12543 0.08% 96 13014 0.08% 97 13714 0.08% 98 14629 0.09% 99 15121 0.09% 100 16300 0.10% 101 17260 0.10% 102 18003 0.11% 103 19294 0.12% 104 20387 0.12% 105 21455 0.13% 106 22526 0.14% 107 23575 0.14% 108 24562 0.15% 109 25721 0.16% 110 26622 0.16% 111 28282 0.17% 112 28762 0.17% 113 30746 0.19% 114 32110 0.19% 115 33565 0.20% 116 34774 0.21% 117 36027 0.22% 118 37490 0.23% 119 38660 0.23% 120 39387 0.24% 121 40892 0.25% 122 42375 0.26% 123 45093 0.27% 124 46791 0.28% 125 48844 0.30% 126 51502 0.31% 127 53692 0.33% 128 55140 0.33% 129 56935 0.35% 130 59122 0.36% 131 61755 0.37% 132 64440 0.39% 133 67352 0.41% 134 71167 0.43% 135 74444 0.45% 136 79583 0.48% 137 83471 0.51% 138 88791 0.54% 139 95647 0.58% 140 101877 0.62% 141 110530 0.67% 142 121579 0.74% 143 136430 0.83% 144 158560 0.96% 145 187994 1.14% 146 236158 1.43% 147 320507 1.94% 148 486071 2.95% 149 954125 5.79% 150 4196274 25.45% 151 7517373 45.59% 16488545 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=12 prefix-density=0.41 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=35.35 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.42 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=29.07 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR7168853 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:42:44 Started mapping on | Feb 15 08:42:47 Finished on | Feb 15 08:44:32 Mapping speed, Million of reads per hour | 565.32 Number of input reads | 16488545 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14250653 Uniquely mapped reads % | 86.43% Average mapped length | 289.56 Number of splices: Total | 13674451 Number of splices: Annotated (sjdb) | 13351728 Number of splices: GT/AG | 13412859 Number of splices: GC/AG | 211614 Number of splices: AT/AC | 8683 Number of splices: Non-canonical | 41295 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410639 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 91226 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.41% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1841523 1841523 1841523 N_multimapping 410639 410639 410639 N_noFeature 570989 13937915 764101 N_ambiguous 282315 3752 159445 UnstrandedReadsAssigned:13397349 PositiveStrandReadsAssigned:308986 NegativeStrandReadsAssigned:13327107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168853-trimmed-pair1.fastq SRR7168853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,488,545 reads, 14,518,859 reads pseudoaligned [quant] estimated average fragment length: 236.958 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7168853.ke.tsv 34699 SRR7168853.se.tsv 87100 total ==> SRR7168853.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.04 720 29.3909 Potri.005G024800.1.v4.1 1035 799.042 264 24.0344 Potri.004G059700.1.v4.1 961 725.094 8 0.802591 Potri.007G009000.2.v4.1 1416 1180.04 0 0 Potri.003G141000.2.v4.1 2943 2707.04 625 16.7951 Potri.016G087400.1.v4.1 270 86.0952 803 678.478 Potri.015G069301.1.v4.1 564 333.314 0 0 Potri.010G195200.1.v4.1 1773 1537.04 119 5.63197 Potri.012G127500.1.v4.1 977 741.069 564 55.363 ==> SRR7168853.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1044 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 100 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7168853 completed mapping pipeline successfully