Starting /dee2/code/volunteer_pipeline.sh SRR7168854 current disk space = 3092890243072 free memory = 1464654048 SRR7168854 SRAfilesize 47c6d6cb45e0a88a62cebcd2e4712b88 SRR7168854.sra SRR7168854.sra file validated SRR7168854 is paired end SRR7168854 is conventional basespace SRR7168854 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0975 34.0 33.0 34.0 32.0 34.0 2 33.1855 34.0 33.0 34.0 32.0 34.0 3 33.1925 34.0 33.0 34.0 32.0 34.0 4 33.35175 34.0 33.0 34.0 33.0 34.0 5 33.38225 34.0 33.0 34.0 33.0 34.0 6 37.09925 38.0 38.0 38.0 36.0 38.0 7 37.3835 38.0 38.0 38.0 37.0 38.0 8 37.466 38.0 38.0 38.0 37.0 38.0 9 37.54675 38.0 38.0 38.0 38.0 38.0 10-14 37.57595 38.0 38.0 38.0 38.0 38.0 15-19 37.552350000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.4944 38.0 38.0 38.0 37.4 38.0 25-29 37.51565000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.4726 38.0 38.0 38.0 37.6 38.0 35-39 37.41360000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.4618 38.0 38.0 38.0 37.2 38.0 45-49 37.3852 38.0 38.0 38.0 37.0 38.0 50-54 37.315400000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.3199 38.0 38.0 38.0 37.0 38.0 60-64 37.20715 38.0 38.0 38.0 36.6 38.0 65-69 37.116949999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.12885 38.0 38.0 38.0 36.4 38.0 75-79 37.06505 38.0 38.0 38.0 36.0 38.0 80-84 36.97474999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.94794999999999 38.0 38.0 38.0 35.8 38.0 90-94 36.74305 38.0 38.0 38.0 35.4 38.0 95-99 36.663650000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.659400000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.49595000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.27075 38.0 38.0 38.0 34.0 38.0 115-119 36.091750000000005 38.0 37.0 38.0 33.4 38.0 120-124 35.89955 38.0 37.0 38.0 32.4 38.0 125-129 35.54535 38.0 36.4 38.0 31.0 38.0 130-134 35.0993 38.0 36.0 38.0 28.2 38.0 135-139 34.6349 38.0 35.2 38.0 27.6 38.0 140-144 34.106700000000004 38.0 33.2 38.0 25.0 38.0 145-149 33.2307 38.0 33.0 38.0 19.0 38.0 150-151 28.35275 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 1.0 18 2.0 19 4.0 20 7.0 21 6.0 22 7.0 23 7.0 24 10.0 25 12.0 26 16.0 27 18.0 28 29.0 29 30.0 30 40.0 31 50.0 32 57.0 33 100.0 34 138.0 35 248.0 36 671.0 37 2543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.347236704900936 11.78310740354536 10.636079249217936 39.23357664233576 2 22.28614307153577 16.60830415207604 35.767883941970986 25.337668834417208 3 19.7 22.625 25.275 32.4 4 23.474999999999998 31.624999999999996 21.725 23.175 5 22.525000000000002 34.75 23.625 19.1 6 17.175 37.075 26.55 19.2 7 13.8 24.15 44.574999999999996 17.474999999999998 8 18.925 24.375 30.55 26.150000000000002 9 17.575 24.025 34.825 23.575 10-14 20.235 29.744999999999997 26.77 23.25 15-19 19.345000000000002 28.73 28.49 23.435 20-24 20.225 28.799999999999997 27.98 22.994999999999997 25-29 20.205000000000002 28.945 28.139999999999997 22.71 30-34 20.055 29.315 27.705000000000002 22.925 35-39 20.28 29.270000000000003 27.155 23.294999999999998 40-44 19.81 29.065 27.529999999999998 23.595 45-49 20.195 28.465 28.244999999999997 23.095 50-54 19.759999999999998 28.46 27.900000000000002 23.880000000000003 55-59 20.330000000000002 29.205 27.075 23.39 60-64 19.975 29.09 27.71 23.225 65-69 20.215 28.410000000000004 28.199999999999996 23.175 70-74 20.735 28.425 27.875 22.965 75-79 20.095 28.410000000000004 28.255000000000003 23.24 80-84 20.39 27.860000000000003 28.194999999999997 23.555 85-89 20.285 28.865000000000002 28.050000000000004 22.8 90-94 20.419999999999998 27.939999999999998 27.88 23.76 95-99 19.88 28.660000000000004 28.189999999999998 23.27 100-104 19.950000000000003 28.99 27.76 23.3 105-109 20.155 28.83 27.894999999999996 23.119999999999997 110-114 21.185000000000002 27.889999999999997 27.534999999999997 23.39 115-119 20.724999999999998 28.765 27.089999999999996 23.419999999999998 120-124 20.44 28.544999999999998 27.565 23.45 125-129 20.525 29.13 27.169999999999998 23.175 130-134 20.79 28.925 26.875 23.41 135-139 21.21 28.465 26.979999999999997 23.345 140-144 21.025 28.694999999999997 26.87 23.41 145-149 20.785 28.575 26.674999999999997 23.965 150-151 20.925 28.962500000000002 26.8125 23.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 3.0 23 2.0 24 2.0 25 4.0 26 7.0 27 6.5 28 11.5 29 14.0 30 18.0 31 30.0 32 35.5 33 45.5 34 62.0 35 79.0 36 94.5 37 117.5 38 144.5 39 157.0 40 189.5 41 243.5 42 279.0 43 284.5 44 279.0 45 255.5 46 241.0 47 239.5 48 217.5 49 192.0 50 152.0 51 125.0 52 115.5 53 92.5 54 65.5 55 47.5 56 41.0 57 32.0 58 19.0 59 16.5 60 13.0 61 7.0 62 5.0 63 3.5 64 2.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.2750000000000004 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.387499999999999 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.475 0.0 0.0 0.0 0.0 128-129 7.225 0.0 0.0 0.0 0.0 130-131 7.6125 0.0 0.0 0.0 0.0 132-133 8.212499999999999 0.0 0.0 0.0 0.0 134-135 9.0125 0.0 0.0 0.0 0.0 136-137 9.6125 0.0 0.0 0.0 0.0 138-139 10.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATTG 10 0.006832588 144.9875 5 ATTCATA 10 0.006832588 144.9875 8 >>END_MODULE SRR7168854 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0 33.0 33.0 34.0 32.0 34.0 2 33.12925 34.0 33.0 34.0 33.0 34.0 3 33.14375 34.0 33.0 34.0 33.0 34.0 4 33.15575 34.0 33.0 34.0 33.0 34.0 5 33.1235 34.0 33.0 34.0 33.0 34.0 6 37.32225 38.0 38.0 38.0 37.0 38.0 7 37.331 38.0 38.0 38.0 37.0 38.0 8 37.338 38.0 38.0 38.0 37.0 38.0 9 37.2755 38.0 38.0 38.0 37.0 38.0 10-14 37.25455 38.0 38.0 38.0 37.0 38.0 15-19 37.23305 38.0 38.0 38.0 37.0 38.0 20-24 37.19385 38.0 38.0 38.0 37.0 38.0 25-29 37.15855 38.0 38.0 38.0 37.0 38.0 30-34 37.253499999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.20345 38.0 38.0 38.0 37.0 38.0 40-44 37.1999 38.0 38.0 38.0 37.0 38.0 45-49 37.13655 38.0 38.0 38.0 37.0 38.0 50-54 37.05935 38.0 38.0 38.0 36.6 38.0 55-59 37.0741 38.0 38.0 38.0 36.8 38.0 60-64 36.99135 38.0 38.0 38.0 36.4 38.0 65-69 36.950450000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.979949999999995 38.0 38.0 38.0 36.2 38.0 75-79 36.91425 38.0 38.0 38.0 36.0 38.0 80-84 36.745050000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.69215 38.0 38.0 38.0 35.4 38.0 90-94 36.63119999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.5231 38.0 38.0 38.0 34.8 38.0 100-104 36.29025 38.0 38.0 38.0 34.0 38.0 105-109 36.259949999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.0452 38.0 38.0 38.0 33.6 38.0 115-119 35.95955 38.0 38.0 38.0 33.2 38.0 120-124 35.702799999999996 38.0 37.2 38.0 32.6 38.0 125-129 35.4062 38.0 37.0 38.0 31.0 38.0 130-134 35.0725 38.0 36.0 38.0 29.4 38.0 135-139 34.624900000000004 38.0 35.8 38.0 27.6 38.0 140-144 33.98715 38.0 34.0 38.0 23.8 38.0 145-149 32.99294999999999 38.0 33.0 38.0 14.4 38.0 150-151 27.99575 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 3.0 6 0.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 4.0 16 6.0 17 5.0 18 8.0 19 13.0 20 10.0 21 3.0 22 12.0 23 5.0 24 13.0 25 15.0 26 17.0 27 21.0 28 28.0 29 28.0 30 45.0 31 48.0 32 55.0 33 81.0 34 142.0 35 215.0 36 565.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.575 17.375 17.549999999999997 28.499999999999996 2 26.125 26.674999999999997 32.425 14.774999999999999 3 21.5 27.750000000000004 29.975 20.775 4 23.974999999999998 34.4 22.400000000000002 19.225 5 23.925 36.025 23.35 16.7 6 20.474999999999998 37.175000000000004 24.575 17.775 7 17.875 19.475 40.699999999999996 21.95 8 20.5 24.4 29.925 25.174999999999997 9 22.575 23.674999999999997 31.374999999999996 22.375 10-14 23.125 29.220000000000002 26.695 20.96 15-19 22.71 27.845 28.255000000000003 21.19 20-24 22.650000000000002 28.544999999999998 28.23 20.575 25-29 22.634999999999998 28.51 28.345 20.51 30-34 22.66 28.499999999999996 28.345 20.495 35-39 22.814999999999998 28.26 28.32 20.605 40-44 22.625 28.244999999999997 28.494999999999997 20.635 45-49 23.055 27.950000000000003 28.315 20.68 50-54 22.925 28.349999999999998 28.04 20.685000000000002 55-59 23.01 27.63 28.775000000000002 20.585 60-64 22.32 27.915 28.23 21.535 65-69 23.06 27.725 28.425 20.79 70-74 23.36 28.025 28.29 20.325 75-79 22.41 28.54 28.325 20.724999999999998 80-84 23.07 28.335 27.950000000000003 20.645 85-89 22.925 28.68 28.185 20.21 90-94 22.845 28.625 27.73 20.8 95-99 23.445 28.165000000000003 27.67 20.72 100-104 23.315 27.525 28.689999999999998 20.47 105-109 23.34 28.615000000000002 27.905 20.14 110-114 23.5 28.439999999999998 27.889999999999997 20.169999999999998 115-119 23.84 28.455000000000002 27.685 20.02 120-124 24.44 27.715 27.750000000000004 20.095 125-129 24.310000000000002 28.494999999999997 27.205000000000002 19.99 130-134 24.67 28.525 27.310000000000002 19.495 135-139 24.785 27.79 27.775 19.650000000000002 140-144 24.45 27.73 28.095 19.725 145-149 25.185000000000002 28.515 26.66 19.64 150-151 26.35 28.15 26.650000000000002 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 3.0 23 3.0 24 2.0 25 4.5 26 6.0 27 9.5 28 11.5 29 14.0 30 18.0 31 21.0 32 28.0 33 37.0 34 53.5 35 75.0 36 89.0 37 109.5 38 133.5 39 172.0 40 224.5 41 248.0 42 261.0 43 285.5 44 272.0 45 257.0 46 265.0 47 248.0 48 225.0 49 197.0 50 165.5 51 136.5 52 108.0 53 81.0 54 58.0 55 45.0 56 37.5 57 27.0 58 17.5 59 13.5 60 12.0 61 8.0 62 4.0 63 2.5 64 2.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.7125000000000004 0.0 0.0 0.0 0.0 116-117 4.1125 0.0 0.0 0.0 0.0 118-119 4.525 0.0 0.0 0.0 0.0 120-121 4.925 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.6125 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.6625 0.0 0.0 0.0 0.0 132-133 8.2375 0.0 0.0 0.0 0.0 134-135 9.024999999999999 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra Read 787744 spots for SRR7168854.sra Written 787744 spots for SRR7168854.sra Read 787740 spots for SRR7168854.sra Written 787740 spots for SRR7168854.sra SRR ids: ['SRR7168854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmbyae0_ SRR7168854.sra spots: 15754804 blocks: [[1, 787740], [787741, 1575480], [1575481, 2363220], [2363221, 3150960], [3150961, 3938700], [3938701, 4726440], [4726441, 5514180], [5514181, 6301920], [6301921, 7089660], [7089661, 7877400], [7877401, 8665140], [8665141, 9452880], [9452881, 10240620], [10240621, 11028360], [11028361, 11816100], [11816101, 12603840], [12603841, 13391580], [13391581, 14179320], [14179321, 14967060], [14967061, 15754804]] SRR7168854 file size 5317085 SRR7168854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168854 SRR7168854_1.fastq SRR7168854_2.fastq Input file: SRR7168854_1.fastq Paired file: SRR7168854_2.fastq trimmed: SRR7168854-trimmed-pair1.fastq, SRR7168854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 07:16:54 2025 >> started Sat Feb 15 07:17:19 2025 >> done (24.338s) 15754804 read pairs processed; of these: 13613 ( 0.09%) short read pairs filtered out after trimming by size control 22241 ( 0.14%) empty read pairs filtered out after trimming by size control 15718950 (99.77%) read pairs available; of these: 8193471 (52.12%) trimmed read pairs available after processing 7525479 (47.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 10 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 3 0.00% 24 8 0.00% 25 6 0.00% 26 11 0.00% 27 11 0.00% 28 10 0.00% 29 17 0.00% 30 11 0.00% 31 8 0.00% 32 14 0.00% 33 12 0.00% 34 15 0.00% 35 12 0.00% 36 14 0.00% 37 24 0.00% 38 28 0.00% 39 36 0.00% 40 34 0.00% 41 39 0.00% 42 62 0.00% 43 54 0.00% 44 55 0.00% 45 61 0.00% 46 78 0.00% 47 84 0.00% 48 92 0.00% 49 111 0.00% 50 135 0.00% 51 148 0.00% 52 171 0.00% 53 183 0.00% 54 191 0.00% 55 228 0.00% 56 272 0.00% 57 277 0.00% 58 335 0.00% 59 382 0.00% 60 501 0.00% 61 587 0.00% 62 587 0.00% 63 722 0.00% 64 772 0.00% 65 917 0.01% 66 1014 0.01% 67 1059 0.01% 68 1298 0.01% 69 2377 0.02% 70 2259 0.01% 71 1875 0.01% 72 2122 0.01% 73 2339 0.01% 74 2676 0.02% 75 2929 0.02% 76 3098 0.02% 77 3504 0.02% 78 4043 0.03% 79 4354 0.03% 80 4801 0.03% 81 5657 0.04% 82 6156 0.04% 83 6884 0.04% 84 8028 0.05% 85 9082 0.06% 86 9468 0.06% 87 10406 0.07% 88 11225 0.07% 89 11736 0.07% 90 13104 0.08% 91 13831 0.09% 92 14952 0.10% 93 16026 0.10% 94 17176 0.11% 95 18430 0.12% 96 19376 0.12% 97 20050 0.13% 98 21048 0.13% 99 21973 0.14% 100 23477 0.15% 101 24358 0.15% 102 26136 0.17% 103 27229 0.17% 104 28063 0.18% 105 29733 0.19% 106 30502 0.19% 107 31815 0.20% 108 32616 0.21% 109 33970 0.22% 110 35032 0.22% 111 36384 0.23% 112 38092 0.24% 113 38958 0.25% 114 40203 0.26% 115 41859 0.27% 116 43081 0.27% 117 43801 0.28% 118 45086 0.29% 119 45919 0.29% 120 47158 0.30% 121 48752 0.31% 122 49943 0.32% 123 51934 0.33% 124 53484 0.34% 125 54734 0.35% 126 56873 0.36% 127 58155 0.37% 128 59194 0.38% 129 61197 0.39% 130 63192 0.40% 131 64507 0.41% 132 66463 0.42% 133 69282 0.44% 134 72084 0.46% 135 74970 0.48% 136 78400 0.50% 137 80972 0.52% 138 84919 0.54% 139 90232 0.57% 140 94398 0.60% 141 100638 0.64% 142 109557 0.70% 143 119844 0.76% 144 136356 0.87% 145 159262 1.01% 146 192213 1.22% 147 252432 1.61% 148 377010 2.40% 149 721903 4.59% 150 3645384 23.19% 151 7525479 47.88% 15718950 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=13 prefix-density=0.40 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=10.18 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=AAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=58.53 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.8 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7168854 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 07:19:06 Started mapping on | Feb 15 07:19:06 Finished on | Feb 15 07:21:00 Mapping speed, Million of reads per hour | 496.39 Number of input reads | 15718950 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14711004 Uniquely mapped reads % | 93.59% Average mapped length | 290.30 Number of splices: Total | 13559932 Number of splices: Annotated (sjdb) | 13217223 Number of splices: GT/AG | 13299648 Number of splices: GC/AG | 210441 Number of splices: AT/AC | 8596 Number of splices: Non-canonical | 41247 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458754 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 105159 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 561344 561344 561344 N_multimapping 458754 458754 458754 N_noFeature 700074 14321166 975469 N_ambiguous 224705 2241 108360 UnstrandedReadsAssigned:13786225 PositiveStrandReadsAssigned:387597 NegativeStrandReadsAssigned:13627175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168854-trimmed-pair1.fastq SRR7168854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,718,950 reads, 13,687,320 reads pseudoaligned [quant] estimated average fragment length: 234.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7168854.ke.tsv 34699 SRR7168854.se.tsv 87100 total ==> SRR7168854.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.15 1328 59.9451 Potri.005G024800.1.v4.1 1035 801.148 324 32.5701 Potri.004G059700.1.v4.1 961 727.242 2 0.221481 Potri.007G009000.2.v4.1 1416 1182.15 0 0 Potri.003G141000.2.v4.1 2943 2709.15 670.975 19.9462 Potri.016G087400.1.v4.1 270 90.8511 640.371 567.659 Potri.015G069301.1.v4.1 564 337.381 0 0 Potri.010G195200.1.v4.1 1773 1539.15 105 5.49409 Potri.012G127500.1.v4.1 977 743.201 110 11.9199 ==> SRR7168854.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 875 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 134 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168854 completed mapping pipeline successfully