Starting /dee2/code/volunteer_pipeline.sh SRR7168855 current disk space = 3092724555776 free memory = 1541138564 SRR7168855 SRAfilesize 23c41da9aef09c50ab78091b3ae4cb83 SRR7168855.sra SRR7168855.sra file validated SRR7168855 is paired end SRR7168855 is conventional basespace SRR7168855 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12175 34.0 33.0 34.0 32.0 34.0 2 33.247 34.0 33.0 34.0 32.0 34.0 3 33.326 34.0 34.0 34.0 32.0 34.0 4 33.49625 34.0 34.0 34.0 33.0 34.0 5 33.4805 34.0 34.0 34.0 33.0 34.0 6 37.25075 38.0 38.0 38.0 36.0 38.0 7 37.4365 38.0 38.0 38.0 37.0 38.0 8 37.48725 38.0 38.0 38.0 37.0 38.0 9 37.53125 38.0 38.0 38.0 37.0 38.0 10-14 37.50605 38.0 38.0 38.0 37.6 38.0 15-19 37.51795 38.0 38.0 38.0 37.8 38.0 20-24 37.485749999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.4741 38.0 38.0 38.0 37.4 38.0 30-34 37.47545 38.0 38.0 38.0 37.4 38.0 35-39 37.4448 38.0 38.0 38.0 37.0 38.0 40-44 37.432100000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.36645 38.0 38.0 38.0 37.0 38.0 50-54 37.3819 38.0 38.0 38.0 37.0 38.0 55-59 37.29365000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.23205 38.0 38.0 38.0 36.8 38.0 65-69 37.19625 38.0 38.0 38.0 36.8 38.0 70-74 37.14565 38.0 38.0 38.0 36.6 38.0 75-79 37.02975 38.0 38.0 38.0 36.0 38.0 80-84 36.99095 38.0 38.0 38.0 36.0 38.0 85-89 36.9533 38.0 38.0 38.0 36.0 38.0 90-94 36.78605 38.0 38.0 38.0 35.2 38.0 95-99 36.6673 38.0 38.0 38.0 35.0 38.0 100-104 36.6404 38.0 38.0 38.0 34.6 38.0 105-109 36.63634999999999 38.0 38.0 38.0 34.2 38.0 110-114 36.377649999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.209500000000006 38.0 37.6 38.0 33.6 38.0 120-124 36.043 38.0 37.0 38.0 33.0 38.0 125-129 35.795 38.0 37.0 38.0 32.2 38.0 130-134 35.423449999999995 38.0 36.0 38.0 31.0 38.0 135-139 35.22025000000001 38.0 36.0 38.0 29.6 38.0 140-144 34.74555 38.0 35.0 38.0 27.6 38.0 145-149 33.96145 38.0 33.2 38.0 24.6 38.0 150-151 29.384625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 0.0 16 3.0 17 1.0 18 1.0 19 3.0 20 1.0 21 1.0 22 5.0 23 8.0 24 9.0 25 11.0 26 14.0 27 14.0 28 18.0 29 30.0 30 43.0 31 48.0 32 70.0 33 99.0 34 124.0 35 227.0 36 610.0 37 2655.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.875816993464056 12.183006535947714 12.967320261437909 39.97385620915033 2 22.2 17.525 34.625 25.650000000000002 3 19.575 23.25 23.125 34.050000000000004 4 22.6 32.574999999999996 21.425 23.400000000000002 5 22.680670167541887 35.08377094273568 24.031007751937985 18.204551137784446 6 18.775 36.85 24.6 19.775000000000002 7 13.900000000000002 25.4 43.475 17.224999999999998 8 18.55 24.7 31.85 24.9 9 17.325 24.099999999999998 32.75 25.825 10-14 19.615 30.325000000000003 26.965 23.095 15-19 19.395 29.020000000000003 28.555000000000003 23.03 20-24 19.41 28.904999999999998 27.93 23.755000000000003 25-29 19.645000000000003 29.244999999999997 27.855 23.255 30-34 19.42 28.735 28.685 23.16 35-39 19.62 29.675 27.66 23.044999999999998 40-44 19.935 28.975 27.72 23.369999999999997 45-49 19.830000000000002 28.825 27.765 23.580000000000002 50-54 19.825 29.29 27.725 23.16 55-59 19.515 28.470000000000002 28.27 23.745 60-64 20.185 29.455 27.405 22.955000000000002 65-69 19.470000000000002 28.815 27.85 23.865 70-74 19.185 28.88 28.065 23.87 75-79 19.43 28.835 28.325 23.41 80-84 20.45 28.275 27.915 23.36 85-89 19.86 28.7 28.439999999999998 23.0 90-94 20.355 28.355000000000004 27.985 23.305 95-99 19.645000000000003 29.195 28.15 23.01 100-104 20.294999999999998 29.005 27.589999999999996 23.11 105-109 19.915 29.37 27.415 23.3 110-114 19.98 28.49 28.199999999999996 23.330000000000002 115-119 20.875 28.43 27.310000000000002 23.385 120-124 20.544999999999998 28.860000000000003 27.68 22.915 125-129 19.950000000000003 28.575 27.85 23.625 130-134 20.19 28.799999999999997 27.834999999999997 23.175 135-139 19.939999999999998 28.560000000000002 27.955000000000002 23.544999999999998 140-144 20.615 28.305000000000003 27.6 23.48 145-149 20.455000000000002 28.735 27.075 23.735 150-151 20.586025544703233 30.06511394941147 27.222639619333833 22.126220886551465 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 2.5 23 4.0 24 4.5 25 5.5 26 6.0 27 10.0 28 12.0 29 16.0 30 26.5 31 33.5 32 38.5 33 46.5 34 62.5 35 79.5 36 97.0 37 127.0 38 159.0 39 177.0 40 188.5 41 228.0 42 282.0 43 281.0 44 275.5 45 273.5 46 252.0 47 243.5 48 209.0 49 176.0 50 158.5 51 125.5 52 98.0 53 79.5 54 57.0 55 38.0 56 30.5 57 25.0 58 17.5 59 13.5 60 12.0 61 10.5 62 8.5 63 5.5 64 1.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.375 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.3 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.237500000000001 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTGTC 10 0.0068378756 144.95 4 >>END_MODULE SRR7168855 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84175 33.0 33.0 34.0 32.0 34.0 2 32.95825 34.0 33.0 34.0 32.0 34.0 3 32.95575 34.0 33.0 34.0 32.0 34.0 4 32.94125 34.0 33.0 34.0 32.0 34.0 5 32.95375 34.0 33.0 34.0 32.0 34.0 6 37.056 38.0 38.0 38.0 37.0 38.0 7 37.22575 38.0 38.0 38.0 37.0 38.0 8 37.14975 38.0 38.0 38.0 37.0 38.0 9 37.2095 38.0 38.0 38.0 37.0 38.0 10-14 37.1224 38.0 38.0 38.0 36.8 38.0 15-19 37.131350000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.085249999999995 38.0 38.0 38.0 36.8 38.0 25-29 36.9777 38.0 38.0 38.0 36.2 38.0 30-34 37.00475 38.0 38.0 38.0 36.0 38.0 35-39 36.98755 38.0 38.0 38.0 36.0 38.0 40-44 36.936350000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.90295 38.0 38.0 38.0 36.0 38.0 50-54 36.82535 38.0 38.0 38.0 36.0 38.0 55-59 36.70565 38.0 38.0 38.0 35.4 38.0 60-64 36.6301 38.0 38.0 38.0 35.0 38.0 65-69 36.5214 38.0 38.0 38.0 34.6 38.0 70-74 36.471450000000004 38.0 38.0 38.0 34.2 38.0 75-79 36.3706 38.0 38.0 38.0 34.0 38.0 80-84 36.14835 38.0 38.0 38.0 33.2 38.0 85-89 35.95795 38.0 37.8 38.0 32.6 38.0 90-94 35.78060000000001 38.0 37.0 38.0 31.8 38.0 95-99 35.61865 38.0 37.0 38.0 30.6 38.0 100-104 35.42025 38.0 36.8 38.0 29.2 38.0 105-109 35.2255 38.0 36.6 38.0 28.4 38.0 110-114 34.9245 38.0 35.8 38.0 27.4 38.0 115-119 34.71015 38.0 35.6 38.0 26.4 38.0 120-124 34.22945 38.0 35.0 38.0 23.0 38.0 125-129 33.806650000000005 38.0 34.4 38.0 22.2 38.0 130-134 33.191250000000004 38.0 33.6 38.0 15.0 38.0 135-139 32.12325 37.8 31.6 38.0 13.8 38.0 140-144 31.08495 36.8 30.4 38.0 12.8 38.0 145-149 29.446450000000006 36.2 27.4 38.0 2.0 38.0 150-151 24.034375 32.0 7.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 4.0 9 4.0 10 3.0 11 0.0 12 1.0 13 4.0 14 5.0 15 2.0 16 3.0 17 12.0 18 6.0 19 11.0 20 13.0 21 12.0 22 9.0 23 23.0 24 28.0 25 28.0 26 31.0 27 33.0 28 55.0 29 44.0 30 66.0 31 75.0 32 125.0 33 151.0 34 214.0 35 392.0 36 790.0 37 1848.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75875875875876 16.666666666666664 17.992992992992992 31.58158158158158 2 24.924924924924923 25.875875875875877 33.133133133133136 16.066066066066064 3 21.72172172172172 26.876876876876878 30.88088088088088 20.52052052052052 4 23.92991239048811 34.11764705882353 22.62828535669587 19.32415519399249 5 25.025025025025027 36.53653653653654 22.52252252252252 15.915915915915916 6 19.46946946946947 38.288288288288285 25.100100100100097 17.14214214214214 7 18.21821821821822 20.02002002002002 42.44244244244244 19.31931931931932 8 20.62062062062062 24.94994994994995 28.628628628628626 25.8008008008008 9 21.72172172172172 25.45045045045045 29.629629629629626 23.1981981981982 10-14 22.662662662662665 29.304304304304303 26.92192192192192 21.11111111111111 15-19 22.762762762762762 27.972972972972972 28.593593593593592 20.67067067067067 20-24 22.59259259259259 28.28828828828829 28.503503503503502 20.615615615615614 25-29 22.098203113268934 28.084488713148808 29.225686971319888 20.591621202262374 30-34 22.93908604034236 28.73016667500876 27.76915761549627 20.56158966915261 35-39 22.133239901896992 28.77521397467341 28.640072075679463 20.451474047750136 40-44 22.167167167167168 28.468468468468465 28.90890890890891 20.455455455455454 45-49 22.31731731731732 28.133133133133132 28.65865865865866 20.89089089089089 50-54 22.69269269269269 27.972972972972972 28.47847847847848 20.855855855855857 55-59 22.56256256256256 28.263263263263262 28.673673673673672 20.5005005005005 60-64 23.17817817817818 28.373373373373372 28.16816816816817 20.28028028028028 65-69 23.78878878878879 28.393393393393396 27.87787787787788 19.93993993993994 70-74 22.558686620952002 28.334751489063514 28.214625356624456 20.891936533360028 75-79 22.828970418939885 28.124530757295158 28.429851343911107 20.616647479853846 80-84 22.41353421092147 28.224635867661046 28.640072075679463 20.721757845738026 85-89 23.485834417859646 28.23105415957553 27.85564120532586 20.427470217238962 90-94 23.113113113113112 28.73873873873874 28.153153153153156 19.994994994994993 95-99 22.94794794794795 28.31831831831832 28.793793793793792 19.93993993993994 100-104 23.323323323323322 28.553553553553552 28.223223223223222 19.8998998998999 105-109 23.353353353353352 28.218218218218215 28.973973973973976 19.454454454454453 110-114 23.053053053053052 28.313313313313316 28.058058058058062 20.575575575575574 115-119 24.03903903903904 27.642642642642645 28.123123123123122 20.195195195195197 120-124 23.329495970769308 28.13454126833175 28.880324340557586 19.655638420341358 125-129 23.920116121928025 28.24465688973422 28.164572801441512 19.670654186896243 130-134 23.934918648310386 27.709637046307883 28.64580725907384 19.709637046307886 135-139 24.325541818909855 27.969367836228038 28.019420391410982 19.685669953451125 140-144 24.00900900900901 27.572572572572575 28.353353353353356 20.065065065065067 145-149 24.504504504504503 28.4984984984985 27.717717717717715 19.27927927927928 150-151 24.818613960470355 28.67150362772079 27.87090317738304 18.638979234425822 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 3.0 25 4.5 26 6.0 27 8.5 28 14.0 29 18.5 30 22.0 31 27.0 32 36.5 33 52.5 34 58.5 35 81.5 36 107.0 37 116.5 38 140.0 39 175.0 40 231.0 41 254.0 42 250.0 43 272.0 44 287.0 45 273.5 46 258.5 47 222.5 48 197.0 49 190.5 50 154.5 51 122.5 52 96.5 53 81.0 54 66.5 55 47.0 56 33.5 57 23.0 58 14.5 59 11.5 60 8.5 61 4.0 62 4.5 63 5.0 64 2.0 65 0.5 66 1.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.125 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.105 30-34 0.105 35-39 0.105 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.105 75-79 0.105 80-84 0.105 85-89 0.11 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.105 125-129 0.105 130-134 0.125 135-139 0.105 140-144 0.1 145-149 0.1 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.824999999999999 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGGA 10 0.006830828 145.0 2 >>END_MODULE Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776982 spots for SRR7168855.sra Written 776982 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra Read 776968 spots for SRR7168855.sra Written 776968 spots for SRR7168855.sra SRR ids: ['SRR7168855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w5g_y00p SRR7168855.sra spots: 15539374 blocks: [[1, 776968], [776969, 1553936], [1553937, 2330904], [2330905, 3107872], [3107873, 3884840], [3884841, 4661808], [4661809, 5438776], [5438777, 6215744], [6215745, 6992712], [6992713, 7769680], [7769681, 8546648], [8546649, 9323616], [9323617, 10100584], [10100585, 10877552], [10877553, 11654520], [11654521, 12431488], [12431489, 13208456], [13208457, 13985424], [13985425, 14762392], [14762393, 15539374]] SRR7168855 file size 5244083 SRR7168855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168855 SRR7168855_1.fastq SRR7168855_2.fastq Input file: SRR7168855_1.fastq Paired file: SRR7168855_2.fastq trimmed: SRR7168855-trimmed-pair1.fastq, SRR7168855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:49:24 2025 >> started Sat Feb 15 08:49:48 2025 >> done (23.517s) 15539374 read pairs processed; of these: 14746 ( 0.09%) short read pairs filtered out after trimming by size control 34707 ( 0.22%) empty read pairs filtered out after trimming by size control 15489921 (99.68%) read pairs available; of these: 8488820 (54.80%) trimmed read pairs available after processing 7001101 (45.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 6 0.00% 22 5 0.00% 23 5 0.00% 24 10 0.00% 25 5 0.00% 26 5 0.00% 27 11 0.00% 28 6 0.00% 29 5 0.00% 30 10 0.00% 31 14 0.00% 32 10 0.00% 33 9 0.00% 34 13 0.00% 35 13 0.00% 36 19 0.00% 37 17 0.00% 38 18 0.00% 39 22 0.00% 40 26 0.00% 41 29 0.00% 42 31 0.00% 43 34 0.00% 44 29 0.00% 45 52 0.00% 46 52 0.00% 47 63 0.00% 48 59 0.00% 49 53 0.00% 50 68 0.00% 51 88 0.00% 52 85 0.00% 53 103 0.00% 54 121 0.00% 55 122 0.00% 56 143 0.00% 57 174 0.00% 58 205 0.00% 59 220 0.00% 60 233 0.00% 61 284 0.00% 62 336 0.00% 63 379 0.00% 64 412 0.00% 65 514 0.00% 66 543 0.00% 67 630 0.00% 68 837 0.01% 69 1370 0.01% 70 1324 0.01% 71 1158 0.01% 72 1166 0.01% 73 1389 0.01% 74 1429 0.01% 75 1601 0.01% 76 1810 0.01% 77 2063 0.01% 78 2208 0.01% 79 2523 0.02% 80 2833 0.02% 81 3263 0.02% 82 3597 0.02% 83 4068 0.03% 84 5060 0.03% 85 5397 0.03% 86 5844 0.04% 87 6368 0.04% 88 6766 0.04% 89 7418 0.05% 90 7718 0.05% 91 8467 0.05% 92 9152 0.06% 93 10063 0.06% 94 11038 0.07% 95 11492 0.07% 96 12218 0.08% 97 12861 0.08% 98 13551 0.09% 99 14243 0.09% 100 15285 0.10% 101 15857 0.10% 102 16727 0.11% 103 17966 0.12% 104 19183 0.12% 105 20015 0.13% 106 20931 0.14% 107 21618 0.14% 108 22226 0.14% 109 23719 0.15% 110 24461 0.16% 111 25170 0.16% 112 26629 0.17% 113 27682 0.18% 114 28716 0.19% 115 30570 0.20% 116 31459 0.20% 117 32827 0.21% 118 33954 0.22% 119 34927 0.23% 120 36444 0.24% 121 37557 0.24% 122 39303 0.25% 123 40982 0.26% 124 42820 0.28% 125 44753 0.29% 126 47117 0.30% 127 48818 0.32% 128 50733 0.33% 129 53432 0.34% 130 55521 0.36% 131 58032 0.37% 132 60788 0.39% 133 63842 0.41% 134 67964 0.44% 135 72275 0.47% 136 77077 0.50% 137 81960 0.53% 138 87778 0.57% 139 94211 0.61% 140 101413 0.65% 141 112029 0.72% 142 125155 0.81% 143 140682 0.91% 144 161654 1.04% 145 193618 1.25% 146 240896 1.56% 147 321837 2.08% 148 476914 3.08% 149 897384 5.79% 150 3880301 25.05% 151 7001101 45.20% 15489921 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.25 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=14.06 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.5 sequence=ATAAAGACACTATGAGCCGTCCATACTTTTTAAGCA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.1 sequence=TTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=64.71 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.2 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7168855 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:50:50 Started mapping on | Feb 15 08:50:54 Finished on | Feb 15 08:52:56 Mapping speed, Million of reads per hour | 457.08 Number of input reads | 15489921 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14425851 Uniquely mapped reads % | 93.13% Average mapped length | 292.23 Number of splices: Total | 13428868 Number of splices: Annotated (sjdb) | 13098776 Number of splices: GT/AG | 13180607 Number of splices: GC/AG | 193558 Number of splices: AT/AC | 8429 Number of splices: Non-canonical | 46274 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481636 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 90793 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593606 593606 593606 N_multimapping 481636 481636 481636 N_noFeature 641940 14037574 918746 N_ambiguous 239461 2159 126364 UnstrandedReadsAssigned:13544450 PositiveStrandReadsAssigned:386118 NegativeStrandReadsAssigned:13380741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168855-trimmed-pair1.fastq SRR7168855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,489,921 reads, 13,383,371 reads pseudoaligned [quant] estimated average fragment length: 243.972 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7168855.ke.tsv 34699 SRR7168855.se.tsv 87100 total ==> SRR7168855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.03 1281 57.5288 Potri.005G024800.1.v4.1 1035 792.028 216 21.7398 Potri.004G059700.1.v4.1 961 718.084 12 1.33213 Potri.007G009000.2.v4.1 1416 1173.03 0 0 Potri.003G141000.2.v4.1 2943 2700.03 910.397 26.8784 Potri.016G087400.1.v4.1 270 82.2828 1084 1050.18 Potri.015G069301.1.v4.1 564 327.096 0 0 Potri.010G195200.1.v4.1 1773 1530.03 654 34.0738 Potri.012G127500.1.v4.1 977 734.068 37 4.01798 ==> SRR7168855.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 741 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 140 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 161 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR7168855 completed mapping pipeline successfully