Starting /dee2/code/volunteer_pipeline.sh SRR7168856 current disk space = 3092860051456 free memory = 1449554844 SRR7168856 SRAfilesize 556797fd4356e8fb7773a42e4a25e7e0 SRR7168856.sra SRR7168856.sra file validated SRR7168856 is paired end SRR7168856 is conventional basespace SRR7168856 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22575 34.0 33.0 34.0 32.0 34.0 2 33.2035 34.0 33.0 34.0 32.0 34.0 3 33.24125 34.0 33.0 34.0 32.0 34.0 4 33.30825 34.0 33.0 34.0 33.0 34.0 5 33.32925 34.0 33.0 34.0 33.0 34.0 6 37.072 38.0 37.0 38.0 36.0 38.0 7 37.3425 38.0 38.0 38.0 37.0 38.0 8 37.3895 38.0 38.0 38.0 37.0 38.0 9 37.4935 38.0 38.0 38.0 37.0 38.0 10-14 37.489 38.0 38.0 38.0 37.2 38.0 15-19 37.468450000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.41705 38.0 38.0 38.0 37.4 38.0 25-29 37.4233 38.0 38.0 38.0 37.0 38.0 30-34 37.399699999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.34795 38.0 38.0 38.0 37.0 38.0 40-44 37.2793 38.0 38.0 38.0 37.0 38.0 45-49 37.254450000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.1354 38.0 38.0 38.0 36.6 38.0 55-59 37.1558 38.0 38.0 38.0 36.6 38.0 60-64 36.95255 38.0 38.0 38.0 36.0 38.0 65-69 36.98225 38.0 38.0 38.0 36.0 38.0 70-74 37.01025 38.0 38.0 38.0 36.0 38.0 75-79 36.93814999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.772299999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.58 38.0 38.0 38.0 34.4 38.0 90-94 36.538850000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.21405 38.0 38.0 38.0 33.6 38.0 100-104 36.2178 38.0 38.0 38.0 33.8 38.0 105-109 36.0689 38.0 37.8 38.0 33.2 38.0 110-114 35.797799999999995 38.0 37.2 38.0 32.0 38.0 115-119 35.5579 38.0 37.0 38.0 31.0 38.0 120-124 35.356700000000004 38.0 36.4 38.0 29.6 38.0 125-129 35.0378 38.0 36.0 38.0 28.0 38.0 130-134 34.46065 38.0 35.2 38.0 24.6 38.0 135-139 34.01924999999999 38.0 34.4 38.0 22.4 38.0 140-144 33.404650000000004 38.0 33.4 38.0 20.2 38.0 145-149 32.022800000000004 38.0 32.2 38.0 10.8 38.0 150-151 28.04175 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 0.0 15 1.0 16 4.0 17 2.0 18 2.0 19 4.0 20 7.0 21 11.0 22 8.0 23 13.0 24 17.0 25 16.0 26 33.0 27 26.0 28 40.0 29 41.0 30 41.0 31 60.0 32 86.0 33 99.0 34 164.0 35 265.0 36 641.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.950700570835494 12.610275038920602 12.091333679294241 40.347690710949664 2 21.25 18.625 34.775 25.35 3 20.65 22.175 25.874999999999996 31.3 4 22.900000000000002 30.2 22.25 24.65 5 22.375 36.3 23.375 17.95 6 16.92923230807702 37.95948987246812 24.706176544136035 20.40510127531883 7 13.950000000000001 25.474999999999998 41.875 18.7 8 16.875 26.025 31.624999999999996 25.474999999999998 9 16.75 24.474999999999998 34.475 24.3 10-14 19.415 30.5 26.505000000000003 23.580000000000002 15-19 18.985 28.73 27.595 24.69 20-24 19.314999999999998 28.384999999999998 28.389999999999997 23.91 25-29 19.185 29.325000000000003 27.694999999999997 23.794999999999998 30-34 19.395 29.04 28.115000000000002 23.45 35-39 19.82 29.165000000000003 27.26 23.755000000000003 40-44 20.055 28.884999999999998 27.55 23.51 45-49 19.56 29.054999999999996 27.215 24.169999999999998 50-54 20.255000000000003 28.285 27.92 23.54 55-59 19.695 28.715000000000003 28.125 23.465 60-64 20.005 28.825 28.03 23.14 65-69 20.215 28.12 27.97 23.695 70-74 19.715 28.26 28.499999999999996 23.525 75-79 19.875 28.310000000000002 28.325 23.49 80-84 19.8 28.89 27.375 23.935000000000002 85-89 19.689999999999998 28.345 28.285 23.68 90-94 20.119999999999997 29.01 27.46 23.41 95-99 19.8 28.754999999999995 27.515 23.93 100-104 19.7 28.720000000000002 27.485 24.095 105-109 20.095 28.035 27.839999999999996 24.03 110-114 20.375 28.57 27.145000000000003 23.91 115-119 20.705000000000002 28.305000000000003 26.674999999999997 24.315 120-124 20.325 28.63 27.169999999999998 23.875 125-129 20.815 28.34 27.02 23.825 130-134 20.815 28.28 26.695 24.21 135-139 20.535 29.160000000000004 26.435 23.87 140-144 21.529999999999998 27.634999999999998 26.66 24.175 145-149 21.065 28.189999999999998 26.6 24.145 150-151 21.75 28.537499999999998 26.1625 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.5 24 3.0 25 3.0 26 4.5 27 6.0 28 9.5 29 16.0 30 22.5 31 30.5 32 42.0 33 52.0 34 64.0 35 74.0 36 88.0 37 128.0 38 147.0 39 179.0 40 222.0 41 221.0 42 230.5 43 260.5 44 263.5 45 249.0 46 251.5 47 234.5 48 228.0 49 206.5 50 156.5 51 126.0 52 117.0 53 100.0 54 69.5 55 54.5 56 36.5 57 24.0 58 21.5 59 16.0 60 9.0 61 9.0 62 7.5 63 2.5 64 0.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.4249999999999998 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.9000000000000004 0.0 0.0 0.0 0.0 108-109 3.2750000000000004 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.65 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.2875 0.0 0.0 0.0 0.0 126-127 7.824999999999999 0.0 0.0 0.0 0.0 128-129 8.649999999999999 0.0 0.0 0.0 0.0 130-131 9.3875 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 10.4125 0.0 0.0 0.0 0.0 136-137 10.9 0.0 0.0 0.0 0.0 138-139 11.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGCCC 10 0.0068343505 144.975 7 >>END_MODULE SRR7168856 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82275 33.0 33.0 34.0 32.0 34.0 2 32.947 33.0 33.0 34.0 32.0 34.0 3 32.98625 34.0 33.0 34.0 32.0 34.0 4 32.8905 34.0 33.0 34.0 32.0 34.0 5 32.9105 34.0 33.0 34.0 32.0 34.0 6 37.0965 38.0 38.0 38.0 37.0 38.0 7 37.133 38.0 38.0 38.0 37.0 38.0 8 37.0855 38.0 38.0 38.0 37.0 38.0 9 37.097 38.0 38.0 38.0 37.0 38.0 10-14 37.060550000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.12624999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.102850000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.09295000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.088049999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0795 38.0 38.0 38.0 37.0 38.0 40-44 36.96015 38.0 38.0 38.0 36.6 38.0 45-49 36.931 38.0 38.0 38.0 36.2 38.0 50-54 36.850350000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.82465 38.0 38.0 38.0 35.8 38.0 60-64 36.81485 38.0 38.0 38.0 36.0 38.0 65-69 36.787400000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.68635 38.0 38.0 38.0 35.6 38.0 75-79 36.528800000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.616 38.0 38.0 38.0 35.2 38.0 85-89 36.452099999999994 38.0 38.0 38.0 34.6 38.0 90-94 36.37525 38.0 38.0 38.0 34.0 38.0 95-99 36.266000000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.0252 38.0 38.0 38.0 33.0 38.0 105-109 35.83175 38.0 37.8 38.0 32.2 38.0 110-114 35.86375 38.0 37.8 38.0 32.6 38.0 115-119 35.6857 38.0 37.4 38.0 31.8 38.0 120-124 35.38765 38.0 36.8 38.0 30.0 38.0 125-129 35.2678 38.0 36.4 38.0 30.4 38.0 130-134 34.5946 38.0 35.6 38.0 26.0 38.0 135-139 34.1233 38.0 34.8 38.0 23.8 38.0 140-144 33.392700000000005 38.0 33.0 38.0 19.8 38.0 145-149 32.17875 38.0 33.0 38.0 8.4 38.0 150-151 27.142 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 3.0 12 2.0 13 0.0 14 3.0 15 2.0 16 2.0 17 3.0 18 6.0 19 5.0 20 6.0 21 8.0 22 15.0 23 25.0 24 16.0 25 19.0 26 21.0 27 34.0 28 33.0 29 46.0 30 52.0 31 56.0 32 69.0 33 117.0 34 134.0 35 231.0 36 537.0 37 2536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.475 18.75 17.599999999999998 28.175 2 27.1 24.975 31.674999999999997 16.25 3 23.025000000000002 27.750000000000004 29.525000000000002 19.7 4 25.775 33.85 22.975 17.4 5 25.224999999999998 35.75 22.325 16.7 6 20.5 38.05 23.599999999999998 17.849999999999998 7 20.349999999999998 19.075 40.975 19.6 8 21.525 24.125 28.199999999999996 26.150000000000002 9 22.025 25.525 30.2 22.25 10-14 23.54 28.875 26.534999999999997 21.05 15-19 23.635 27.76 28.63 19.975 20-24 23.799999999999997 28.084999999999997 27.500000000000004 20.615 25-29 23.369999999999997 28.21 27.750000000000004 20.669999999999998 30-34 23.169999999999998 28.09 27.700000000000003 21.04 35-39 22.919999999999998 28.22 28.235 20.625 40-44 23.155 27.779999999999998 28.185 20.880000000000003 45-49 23.365 28.134999999999998 27.48 21.02 50-54 23.369999999999997 28.189999999999998 28.28 20.16 55-59 23.355 28.325 27.97 20.349999999999998 60-64 23.435 27.79 27.965 20.810000000000002 65-69 23.54 28.22 28.1 20.14 70-74 23.505000000000003 27.794999999999998 28.189999999999998 20.51 75-79 23.645 28.005000000000003 28.03 20.32 80-84 23.044999999999998 28.075 28.544999999999998 20.335 85-89 24.255 27.58 27.935 20.23 90-94 24.255 28.18 27.650000000000002 19.915 95-99 24.275 27.99 28.044999999999998 19.689999999999998 100-104 24.29 28.255000000000003 27.705000000000002 19.75 105-109 24.63 27.99 27.67 19.71 110-114 24.82 28.645 27.375 19.16 115-119 24.73 28.165000000000003 27.515 19.59 120-124 24.525 27.839999999999996 27.71 19.925 125-129 25.135 27.894999999999996 27.505000000000003 19.465 130-134 25.27 27.935 27.089999999999996 19.705000000000002 135-139 25.46 27.875 27.395000000000003 19.27 140-144 25.785000000000004 27.145000000000003 27.334999999999997 19.735 145-149 26.229999999999997 27.939999999999998 26.974999999999998 18.855 150-151 25.674999999999997 28.4125 27.250000000000004 18.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 3.0 26 6.0 27 6.5 28 8.5 29 12.5 30 16.0 31 22.5 32 30.5 33 39.5 34 51.0 35 62.5 36 79.5 37 101.0 38 134.5 39 166.5 40 184.0 41 225.0 42 268.0 43 293.0 44 289.5 45 268.0 46 264.0 47 253.5 48 231.5 49 199.0 50 155.0 51 130.5 52 109.5 53 91.0 54 74.5 55 56.0 56 48.5 57 38.0 58 22.0 59 12.0 60 11.5 61 8.0 62 8.5 63 6.5 64 2.5 65 2.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.9750000000000001 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.5750000000000002 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.25 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.5625 0.0 0.0 0.0 0.0 116-117 5.074999999999999 0.0 0.0 0.0 0.0 118-119 5.612500000000001 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.7625 0.0 0.0 0.0 0.0 124-125 7.3625 0.0 0.0 0.0 0.0 126-127 7.9 0.0 0.0 0.0 0.0 128-129 8.6875 0.0 0.0 0.0 0.0 130-131 9.425 0.0 0.0 0.0 0.0 132-133 10.0375 0.0 0.0 0.0 0.0 134-135 10.475 0.0 0.0 0.0 0.0 136-137 11.025 0.0 0.0 0.0 0.0 138-139 11.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGATG 10 0.006830828 145.0 7 >>END_MODULE Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777150 spots for SRR7168856.sra Written 777150 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra Read 777148 spots for SRR7168856.sra Written 777148 spots for SRR7168856.sra SRR ids: ['SRR7168856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_486tja2k SRR7168856.sra spots: 15542962 blocks: [[1, 777148], [777149, 1554296], [1554297, 2331444], [2331445, 3108592], [3108593, 3885740], [3885741, 4662888], [4662889, 5440036], [5440037, 6217184], [6217185, 6994332], [6994333, 7771480], [7771481, 8548628], [8548629, 9325776], [9325777, 10102924], [10102925, 10880072], [10880073, 11657220], [11657221, 12434368], [12434369, 13211516], [13211517, 13988664], [13988665, 14765812], [14765813, 15542962]] SRR7168856 file size 5245299 SRR7168856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168856 SRR7168856_1.fastq SRR7168856_2.fastq Input file: SRR7168856_1.fastq Paired file: SRR7168856_2.fastq trimmed: SRR7168856-trimmed-pair1.fastq, SRR7168856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:18:38 2025 >> started Sat Feb 15 08:19:07 2025 >> done (28.795s) 15542962 read pairs processed; of these: 14297 ( 0.09%) short read pairs filtered out after trimming by size control 28964 ( 0.19%) empty read pairs filtered out after trimming by size control 15499701 (99.72%) read pairs available; of these: 8302242 (53.56%) trimmed read pairs available after processing 7197459 (46.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 8 0.00% 24 8 0.00% 25 11 0.00% 26 6 0.00% 27 7 0.00% 28 10 0.00% 29 8 0.00% 30 18 0.00% 31 10 0.00% 32 12 0.00% 33 19 0.00% 34 22 0.00% 35 17 0.00% 36 31 0.00% 37 31 0.00% 38 33 0.00% 39 42 0.00% 40 46 0.00% 41 62 0.00% 42 63 0.00% 43 57 0.00% 44 88 0.00% 45 87 0.00% 46 98 0.00% 47 131 0.00% 48 158 0.00% 49 160 0.00% 50 198 0.00% 51 229 0.00% 52 257 0.00% 53 278 0.00% 54 323 0.00% 55 362 0.00% 56 424 0.00% 57 458 0.00% 58 517 0.00% 59 600 0.00% 60 675 0.00% 61 812 0.01% 62 966 0.01% 63 1017 0.01% 64 1100 0.01% 65 1328 0.01% 66 1438 0.01% 67 1521 0.01% 68 1869 0.01% 69 3191 0.02% 70 3028 0.02% 71 2594 0.02% 72 2901 0.02% 73 3329 0.02% 74 3626 0.02% 75 3934 0.03% 76 4398 0.03% 77 4672 0.03% 78 5431 0.04% 79 5923 0.04% 80 6683 0.04% 81 7285 0.05% 82 8079 0.05% 83 9007 0.06% 84 10370 0.07% 85 11328 0.07% 86 12172 0.08% 87 12829 0.08% 88 13906 0.09% 89 14956 0.10% 90 15735 0.10% 91 16866 0.11% 92 18104 0.12% 93 19483 0.13% 94 20626 0.13% 95 22235 0.14% 96 23325 0.15% 97 23896 0.15% 98 24993 0.16% 99 25843 0.17% 100 27437 0.18% 101 28477 0.18% 102 29741 0.19% 103 31358 0.20% 104 32780 0.21% 105 34032 0.22% 106 35228 0.23% 107 36193 0.23% 108 36995 0.24% 109 38311 0.25% 110 39160 0.25% 111 40724 0.26% 112 41918 0.27% 113 43489 0.28% 114 44535 0.29% 115 47026 0.30% 116 47210 0.30% 117 48496 0.31% 118 49983 0.32% 119 50421 0.33% 120 51375 0.33% 121 52548 0.34% 122 53833 0.35% 123 55478 0.36% 124 57993 0.37% 125 59475 0.38% 126 61124 0.39% 127 62567 0.40% 128 64024 0.41% 129 64761 0.42% 130 67059 0.43% 131 67983 0.44% 132 69949 0.45% 133 73358 0.47% 134 75956 0.49% 135 77592 0.50% 136 81025 0.52% 137 85049 0.55% 138 89244 0.58% 139 93653 0.60% 140 98522 0.64% 141 105522 0.68% 142 112501 0.73% 143 123118 0.79% 144 138491 0.89% 145 160811 1.04% 146 194216 1.25% 147 253850 1.64% 148 375532 2.42% 149 715913 4.62% 150 3499824 22.58% 151 7197459 46.44% 15499701 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=12 prefix-density=0.43 prefix-fanout=2.6 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=44.86 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.2 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=71.17 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.7 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7168856 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:20:03 Started mapping on | Feb 15 08:20:03 Finished on | Feb 15 08:22:07 Mapping speed, Million of reads per hour | 449.99 Number of input reads | 15499701 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14478996 Uniquely mapped reads % | 93.41% Average mapped length | 288.87 Number of splices: Total | 13522813 Number of splices: Annotated (sjdb) | 13188455 Number of splices: GT/AG | 13266561 Number of splices: GC/AG | 203740 Number of splices: AT/AC | 8044 Number of splices: Non-canonical | 44468 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409469 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 92360 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624043 624043 624043 N_multimapping 409469 409469 409469 N_noFeature 615056 14097382 854295 N_ambiguous 241769 2181 97701 UnstrandedReadsAssigned:13622171 PositiveStrandReadsAssigned:379433 NegativeStrandReadsAssigned:13527000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168856-trimmed-pair1.fastq SRR7168856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,499,701 reads, 13,576,355 reads pseudoaligned [quant] estimated average fragment length: 222.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7168856.ke.tsv 34699 SRR7168856.se.tsv 87100 total ==> SRR7168856.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.95 707 28.0451 Potri.005G024800.1.v4.1 1035 813.947 384 33.6285 Potri.004G059700.1.v4.1 961 739.983 2 0.192655 Potri.007G009000.2.v4.1 1416 1194.95 0 0 Potri.003G141000.2.v4.1 2943 2721.95 955.467 25.0212 Potri.016G087400.1.v4.1 270 93.5515 846 644.603 Potri.015G069301.1.v4.1 564 346.784 0 0 Potri.010G195200.1.v4.1 1773 1551.95 233.953 10.7455 Potri.012G127500.1.v4.1 977 755.978 160 15.0863 ==> SRR7168856.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 530 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 96 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7168856 completed mapping pipeline successfully