Starting /dee2/code/volunteer_pipeline.sh SRR7168857 current disk space = 3092066934784 free memory = 1581494196 SRR7168857 SRAfilesize ede95793f7c38cf3dfe43b2d8e204eb7 SRR7168857.sra SRR7168857.sra file validated SRR7168857 is paired end SRR7168857 is conventional basespace SRR7168857 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.36725 34.0 33.0 34.0 32.0 34.0 2 33.243 34.0 33.0 34.0 32.0 34.0 3 33.248 34.0 33.0 34.0 32.0 34.0 4 33.33075 34.0 33.0 34.0 33.0 34.0 5 33.3665 34.0 33.0 34.0 33.0 34.0 6 37.07175 38.0 37.0 38.0 36.0 38.0 7 37.37275 38.0 38.0 38.0 37.0 38.0 8 37.4375 38.0 38.0 38.0 37.0 38.0 9 37.50175 38.0 38.0 38.0 38.0 38.0 10-14 37.55985 38.0 38.0 38.0 38.0 38.0 15-19 37.5033 38.0 38.0 38.0 37.8 38.0 20-24 37.45569999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.4433 38.0 38.0 38.0 37.6 38.0 30-34 37.40995 38.0 38.0 38.0 37.2 38.0 35-39 37.37645 38.0 38.0 38.0 37.2 38.0 40-44 37.363099999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.341699999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.26989999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.22555 38.0 38.0 38.0 37.0 38.0 60-64 37.2025 38.0 38.0 38.0 37.0 38.0 65-69 37.15089999999999 38.0 38.0 38.0 36.4 38.0 70-74 36.96435 38.0 38.0 38.0 36.2 38.0 75-79 36.716300000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.6553 38.0 38.0 38.0 35.8 38.0 85-89 36.626050000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.3524 38.0 38.0 38.0 34.6 38.0 95-99 36.336949999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.2153 38.0 38.0 38.0 34.0 38.0 105-109 36.20465 38.0 38.0 38.0 34.0 38.0 110-114 35.861599999999996 38.0 38.0 38.0 33.2 38.0 115-119 35.67715 38.0 37.0 38.0 32.4 38.0 120-124 35.5674 38.0 37.0 38.0 31.4 38.0 125-129 35.335699999999996 38.0 36.0 38.0 30.4 38.0 130-134 34.8951 38.0 35.6 38.0 28.6 38.0 135-139 34.3702 38.0 34.6 38.0 25.6 38.0 140-144 33.9851 38.0 33.4 38.0 24.2 38.0 145-149 32.96235 38.0 33.0 38.0 16.6 38.0 150-151 28.19925 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 4.0 15 2.0 16 4.0 17 6.0 18 15.0 19 22.0 20 3.0 21 11.0 22 4.0 23 5.0 24 6.0 25 13.0 26 17.0 27 13.0 28 26.0 29 38.0 30 48.0 31 38.0 32 69.0 33 96.0 34 129.0 35 229.0 36 624.0 37 2574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.83802634978042 13.433221389821751 12.787393438388014 36.94135882200982 2 21.635817908954476 16.758379189594798 32.04102051025512 29.5647823911956 3 19.925 20.349999999999998 25.924999999999997 33.800000000000004 4 23.150000000000002 28.299999999999997 20.525 28.025 5 23.400000000000002 32.4 23.1 21.099999999999998 6 19.175 34.2 26.424999999999997 20.200000000000003 7 14.075 26.25 41.025 18.65 8 16.75 26.974999999999998 30.9 25.374999999999996 9 18.625 24.55 33.775 23.05 10-14 19.744999999999997 29.86 26.55 23.845 15-19 20.044999999999998 27.625 27.705000000000002 24.625 20-24 20.155 27.855 27.255000000000003 24.735 25-29 19.505 29.054999999999996 26.76 24.68 30-34 19.57 28.18 27.235 25.014999999999997 35-39 20.044999999999998 27.96 27.49 24.505 40-44 20.405 28.389999999999997 27.0 24.205 45-49 20.41 27.875 26.945000000000004 24.77 50-54 20.26 27.83 26.66 25.25 55-59 19.42 27.57 28.139999999999997 24.87 60-64 19.955000000000002 27.560000000000002 27.089999999999996 25.395 65-69 20.01 28.615000000000002 26.895000000000003 24.48 70-74 20.150000000000002 28.799999999999997 26.93 24.12 75-79 20.02 27.63 26.889999999999997 25.46 80-84 20.31 27.985 26.534999999999997 25.169999999999998 85-89 19.955000000000002 28.17 27.034999999999997 24.84 90-94 20.765 27.405 26.840000000000003 24.990000000000002 95-99 21.025 27.365000000000002 26.645000000000003 24.965 100-104 20.86 27.97 26.465 24.705 105-109 20.62 27.57 27.125 24.685000000000002 110-114 21.154999999999998 27.395000000000003 26.665 24.785 115-119 21.325 26.875 26.619999999999997 25.180000000000003 120-124 20.605 27.74 26.255 25.4 125-129 21.695 27.650000000000002 25.7 24.955 130-134 21.265 27.815 25.69 25.230000000000004 135-139 21.790000000000003 28.249999999999996 25.25 24.709999999999997 140-144 21.43 27.689999999999998 25.28 25.6 145-149 21.51 27.245 25.36 25.885 150-151 20.1 27.450000000000003 26.8 25.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 1.0 24 3.5 25 4.0 26 6.0 27 8.0 28 9.5 29 15.5 30 24.5 31 29.0 32 34.0 33 44.0 34 58.5 35 74.5 36 82.0 37 96.0 38 122.5 39 163.5 40 196.5 41 205.5 42 196.0 43 202.0 44 225.0 45 225.5 46 219.0 47 219.5 48 206.5 49 182.0 50 152.5 51 132.0 52 138.5 53 138.5 54 115.5 55 102.0 56 93.5 57 64.5 58 44.5 59 43.0 60 33.5 61 23.0 62 20.0 63 12.0 64 5.5 65 5.0 66 4.0 67 4.5 68 5.0 69 2.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 97.90372670807453 94.575 2 1.7598343685300208 3.4000000000000004 3 0.2070393374741201 0.6 4 0.10351966873706005 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025879917184265012 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 41 1.0250000000000001 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.8875000000000002 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 2.875 0.0 0.0 0.0 0.0 106-107 3.2750000000000004 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.300000000000001 0.0 0.0 0.0 0.0 112-113 4.8125 0.0 0.0 0.0 0.0 114-115 5.4375 0.0 0.0 0.0 0.0 116-117 6.0875 0.0 0.0 0.0 0.0 118-119 6.699999999999999 0.0 0.0 0.0 0.0 120-121 7.3375 0.0 0.0 0.0 0.0 122-123 8.0 0.0 0.0 0.0 0.0 124-125 8.774999999999999 0.0 0.0 0.0 0.0 126-127 9.287500000000001 0.0 0.0 0.0 0.0 128-129 10.0125 0.0 0.0 0.0 0.0 130-131 10.675 0.0 0.0 0.0 0.0 132-133 11.4375 0.0 0.0 0.0 0.0 134-135 12.275 0.0 0.0 0.0 0.0 136-137 13.149999999999999 0.0 0.0 0.0 0.0 138-139 13.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 5.60876E-5 20.3 65-69 >>END_MODULE SRR7168857 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90575 33.0 33.0 34.0 32.0 34.0 2 33.02725 34.0 33.0 34.0 32.0 34.0 3 33.037 34.0 33.0 34.0 33.0 34.0 4 33.02125 34.0 33.0 34.0 33.0 34.0 5 33.01975 34.0 33.0 34.0 33.0 34.0 6 37.16675 38.0 38.0 38.0 37.0 38.0 7 37.13625 38.0 38.0 38.0 37.0 38.0 8 37.18025 38.0 38.0 38.0 37.0 38.0 9 37.15625 38.0 38.0 38.0 37.0 38.0 10-14 37.13465 38.0 38.0 38.0 37.0 38.0 15-19 37.081 38.0 38.0 38.0 37.0 38.0 20-24 37.03555 38.0 38.0 38.0 37.0 38.0 25-29 37.02845000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.056 38.0 38.0 38.0 37.0 38.0 35-39 37.03055 38.0 38.0 38.0 37.0 38.0 40-44 37.0142 38.0 38.0 38.0 37.0 38.0 45-49 36.9812 38.0 38.0 38.0 37.0 38.0 50-54 36.8951 38.0 38.0 38.0 36.6 38.0 55-59 36.8928 38.0 38.0 38.0 36.8 38.0 60-64 36.896750000000004 38.0 38.0 38.0 36.4 38.0 65-69 36.641000000000005 38.0 38.0 38.0 36.2 38.0 70-74 36.43835 38.0 38.0 38.0 36.0 38.0 75-79 36.3976 38.0 38.0 38.0 35.8 38.0 80-84 36.261849999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.124 38.0 38.0 38.0 34.8 38.0 90-94 36.0677 38.0 38.0 38.0 34.4 38.0 95-99 35.952999999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.80655 38.0 38.0 38.0 33.6 38.0 105-109 35.7882 38.0 38.0 38.0 33.8 38.0 110-114 35.65995 38.0 38.0 38.0 33.2 38.0 115-119 35.4058 38.0 37.8 38.0 31.8 38.0 120-124 35.209199999999996 38.0 37.2 38.0 30.6 38.0 125-129 34.9251 38.0 36.4 38.0 29.2 38.0 130-134 34.68195 38.0 36.0 38.0 27.8 38.0 135-139 34.187 38.0 35.4 38.0 25.8 38.0 140-144 33.47525 38.0 33.0 38.0 20.8 38.0 145-149 32.41935 38.0 33.0 38.0 10.8 38.0 150-151 27.269875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 4.0 4 2.0 5 3.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 6.0 13 5.0 14 8.0 15 6.0 16 12.0 17 31.0 18 5.0 19 4.0 20 9.0 21 7.0 22 11.0 23 8.0 24 11.0 25 19.0 26 19.0 27 15.0 28 27.0 29 27.0 30 32.0 31 40.0 32 65.0 33 80.0 34 127.0 35 218.0 36 509.0 37 2666.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.175 16.75 16.5 26.575 2 27.35 25.924999999999997 28.775000000000002 17.95 3 23.799999999999997 26.8 29.225 20.175 4 27.0 33.650000000000006 20.025000000000002 19.325 5 26.724999999999998 35.4 20.375 17.5 6 23.05 36.175000000000004 22.25 18.525 7 21.25 20.549999999999997 37.75 20.45 8 24.6 25.4 25.825 24.175 9 24.275 23.9 28.249999999999996 23.575 10-14 25.240000000000002 27.575 25.305 21.88 15-19 25.205 27.235 25.840000000000003 21.72 20-24 25.545 28.249999999999996 25.740000000000002 20.465 25-29 25.264999999999997 27.595 26.369999999999997 20.77 30-34 25.119999999999997 27.49 26.1 21.29 35-39 25.564999999999998 27.884999999999998 25.14 21.41 40-44 25.89 27.08 26.369999999999997 20.66 45-49 25.324999999999996 26.735 26.575 21.365000000000002 50-54 25.474999999999998 27.05 27.215 20.26 55-59 25.025 27.395000000000003 27.339999999999996 20.24 60-64 25.11 27.99 26.275 20.625 65-69 25.124999999999996 28.27 26.119999999999997 20.485 70-74 24.725 27.905 26.6 20.77 75-79 25.485000000000003 27.810000000000002 26.545 20.16 80-84 25.405 27.505000000000003 26.445 20.645 85-89 25.185000000000002 27.589999999999996 26.71 20.515 90-94 25.569999999999997 27.185 26.555 20.69 95-99 25.25 27.74 26.625 20.385 100-104 25.4 27.165 27.055 20.380000000000003 105-109 24.884999999999998 28.110000000000003 26.75 20.255000000000003 110-114 26.119999999999997 27.255000000000003 26.565 20.06 115-119 26.035000000000004 28.050000000000004 26.3 19.615 120-124 26.095000000000002 27.715 26.3 19.89 125-129 26.919999999999998 28.055000000000003 25.7 19.325 130-134 27.189999999999998 27.67 25.415 19.725 135-139 27.105 27.339999999999996 26.41 19.145 140-144 26.99 27.725 26.26 19.025 145-149 27.735 28.12 25.21 18.935 150-151 27.075 28.775000000000002 25.137500000000003 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.0 27 2.0 28 4.0 29 5.0 30 6.0 31 13.0 32 17.5 33 20.0 34 27.0 35 40.0 36 56.0 37 74.5 38 97.5 39 120.5 40 161.0 41 195.5 42 211.0 43 242.5 44 255.0 45 244.0 46 253.0 47 254.0 48 230.0 49 209.5 50 193.0 51 160.0 52 143.0 53 138.5 54 124.0 55 110.0 56 93.0 57 67.5 58 45.5 59 34.5 60 26.0 61 26.5 62 30.0 63 23.5 64 10.5 65 4.0 66 3.5 67 4.5 68 4.0 69 2.5 70 2.5 71 2.5 72 1.5 73 1.5 74 1.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.47658688865765 93.675 2 2.0551508844953172 3.95 3 0.3902185223725286 1.125 4 0.052029136316337155 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026014568158168577 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 42 1.05 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.3250000000000002 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.825 0.0 0.0 0.0 0.0 106-107 3.2125 0.0 0.0 0.0 0.0 108-109 3.7125000000000004 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.75 0.0 0.0 0.0 0.0 114-115 5.35 0.0 0.0 0.0 0.0 116-117 6.0 0.0 0.0 0.0 0.0 118-119 6.625 0.0 0.0 0.0 0.0 120-121 7.2875 0.0 0.0 0.0 0.0 122-123 7.925 0.0 0.0 0.0 0.0 124-125 8.7 0.0 0.0 0.0 0.0 126-127 9.275 0.0 0.0 0.0 0.0 128-129 10.0375 0.0 0.0 0.0 0.0 130-131 10.65 0.0 0.0 0.0 0.0 132-133 11.399999999999999 0.0 0.0 0.0 0.0 134-135 12.275 0.0 0.0 0.0 0.0 136-137 13.2 0.0 0.0 0.0 0.0 138-139 13.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 100 7.9452863E-4 11.599999 60-64 >>END_MODULE Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609060 spots for SRR7168857.sra Written 609060 spots for SRR7168857.sra Read 609075 spots for SRR7168857.sra Written 609075 spots for SRR7168857.sra SRR ids: ['SRR7168857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e0w3al9a SRR7168857.sra spots: 12181215 blocks: [[1, 609060], [609061, 1218120], [1218121, 1827180], [1827181, 2436240], [2436241, 3045300], [3045301, 3654360], [3654361, 4263420], [4263421, 4872480], [4872481, 5481540], [5481541, 6090600], [6090601, 6699660], [6699661, 7308720], [7308721, 7917780], [7917781, 8526840], [8526841, 9135900], [9135901, 9744960], [9744961, 10354020], [10354021, 10963080], [10963081, 11572140], [11572141, 12181215]] SRR7168857 file size 4106113 SRR7168857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168857 SRR7168857_1.fastq SRR7168857_2.fastq Input file: SRR7168857_1.fastq Paired file: SRR7168857_2.fastq trimmed: SRR7168857-trimmed-pair1.fastq, SRR7168857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 09:49:12 2025 >> started Sat Feb 15 09:49:27 2025 >> done (15.215s) 12181215 read pairs processed; of these: 26996 ( 0.22%) short read pairs filtered out after trimming by size control 131286 ( 1.08%) empty read pairs filtered out after trimming by size control 12022933 (98.70%) read pairs available; of these: 6540855 (54.40%) trimmed read pairs available after processing 5482078 (45.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 1 0.00% 24 9 0.00% 25 8 0.00% 26 11 0.00% 27 16 0.00% 28 19 0.00% 29 22 0.00% 30 19 0.00% 31 21 0.00% 32 21 0.00% 33 32 0.00% 34 26 0.00% 35 21 0.00% 36 33 0.00% 37 24 0.00% 38 31 0.00% 39 43 0.00% 40 40 0.00% 41 58 0.00% 42 61 0.00% 43 54 0.00% 44 71 0.00% 45 107 0.00% 46 97 0.00% 47 141 0.00% 48 136 0.00% 49 143 0.00% 50 149 0.00% 51 207 0.00% 52 232 0.00% 53 241 0.00% 54 260 0.00% 55 301 0.00% 56 298 0.00% 57 348 0.00% 58 356 0.00% 59 430 0.00% 60 508 0.00% 61 591 0.00% 62 617 0.01% 63 770 0.01% 64 807 0.01% 65 1069 0.01% 66 1142 0.01% 67 1444 0.01% 68 2784 0.02% 69 14432 0.12% 70 11094 0.09% 71 3470 0.03% 72 2734 0.02% 73 2907 0.02% 74 3065 0.03% 75 3313 0.03% 76 3554 0.03% 77 3724 0.03% 78 4047 0.03% 79 4777 0.04% 80 5250 0.04% 81 5776 0.05% 82 6400 0.05% 83 7458 0.06% 84 9227 0.08% 85 10588 0.09% 86 11120 0.09% 87 12001 0.10% 88 13144 0.11% 89 13756 0.11% 90 14169 0.12% 91 15021 0.12% 92 16070 0.13% 93 17807 0.15% 94 18975 0.16% 95 20629 0.17% 96 21372 0.18% 97 22176 0.18% 98 22946 0.19% 99 23171 0.19% 100 24772 0.21% 101 25528 0.21% 102 26898 0.22% 103 27890 0.23% 104 29610 0.25% 105 31417 0.26% 106 32079 0.27% 107 32596 0.27% 108 33473 0.28% 109 35940 0.30% 110 37123 0.31% 111 37224 0.31% 112 38392 0.32% 113 40837 0.34% 114 40964 0.34% 115 43389 0.36% 116 44071 0.37% 117 44374 0.37% 118 44825 0.37% 119 45724 0.38% 120 47261 0.39% 121 47457 0.39% 122 48909 0.41% 123 50859 0.42% 124 52459 0.44% 125 53715 0.45% 126 55116 0.46% 127 56325 0.47% 128 57292 0.48% 129 57939 0.48% 130 59644 0.50% 131 60179 0.50% 132 62099 0.52% 133 64302 0.53% 134 66340 0.55% 135 68167 0.57% 136 70209 0.58% 137 73492 0.61% 138 75399 0.63% 139 78767 0.66% 140 81056 0.67% 141 85261 0.71% 142 90135 0.75% 143 97261 0.81% 144 108173 0.90% 145 123200 1.02% 146 144193 1.20% 147 183294 1.52% 148 264536 2.20% 149 498061 4.14% 150 2584609 21.50% 151 5482078 45.60% 12022933 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=26 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=26.89 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=3.6 sequence=TTATTTATTTTTCTCACATAAATAGTTCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=2.2 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=53.23 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168857 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 09:51:36 Started mapping on | Feb 15 09:51:36 Finished on | Feb 15 09:54:21 Mapping speed, Million of reads per hour | 262.32 Number of input reads | 12022933 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 9712761 Uniquely mapped reads % | 80.79% Average mapped length | 288.15 Number of splices: Total | 8286064 Number of splices: Annotated (sjdb) | 8083608 Number of splices: GT/AG | 8123611 Number of splices: GC/AG | 126591 Number of splices: AT/AC | 5752 Number of splices: Non-canonical | 30110 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360734 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 519106 % of reads mapped to too many loci | 4.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.15% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1966847 1966847 1966847 N_multimapping 360734 360734 360734 N_noFeature 415967 9444260 519557 N_ambiguous 242207 1214 76580 UnstrandedReadsAssigned:9054587 PositiveStrandReadsAssigned:267287 NegativeStrandReadsAssigned:9116624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7168857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168857-trimmed-pair1.fastq SRR7168857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,022,933 reads, 9,522,358 reads pseudoaligned [quant] estimated average fragment length: 205.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,300 rounds 52401 SRR7168857.ke.tsv 34699 SRR7168857.se.tsv 87100 total ==> SRR7168857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.35 575 24.18 Potri.005G024800.1.v4.1 1035 830.355 280 25.7138 Potri.004G059700.1.v4.1 961 756.355 9 0.907379 Potri.007G009000.2.v4.1 1416 1211.35 0 0 Potri.003G141000.2.v4.1 2943 2738.35 508 14.1464 Potri.016G087400.1.v4.1 270 93.9599 728 590.827 Potri.015G069301.1.v4.1 564 360.591 0 0 Potri.010G195200.1.v4.1 1773 1568.35 154.787 7.52597 Potri.012G127500.1.v4.1 977 772.355 236 23.3006 ==> SRR7168857.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 340 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 55 SRR7168857 completed mapping pipeline successfully