Starting /dee2/code/volunteer_pipeline.sh SRR7168858 current disk space = 3092741996544 free memory = 1460786452 SRR7168858 SRAfilesize 1fb1a2f28cba22867b313e4c1b0fe411 SRR7168858.sra SRR7168858.sra file validated SRR7168858 is paired end SRR7168858 is conventional basespace SRR7168858 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.247 34.0 33.0 34.0 32.0 34.0 2 33.02425 34.0 33.0 34.0 32.0 34.0 3 33.02175 34.0 33.0 34.0 32.0 34.0 4 33.14525 34.0 33.0 34.0 32.0 34.0 5 33.21375 34.0 33.0 34.0 33.0 34.0 6 36.9505 38.0 37.0 38.0 36.0 38.0 7 37.282 38.0 38.0 38.0 36.0 38.0 8 37.3725 38.0 38.0 38.0 37.0 38.0 9 37.45525 38.0 38.0 38.0 37.0 38.0 10-14 37.3958 38.0 38.0 38.0 37.0 38.0 15-19 37.39575 38.0 38.0 38.0 37.0 38.0 20-24 37.39785 38.0 38.0 38.0 37.0 38.0 25-29 37.358900000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.307249999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.3112 38.0 38.0 38.0 37.0 38.0 40-44 37.216750000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.2044 38.0 38.0 38.0 36.2 38.0 50-54 37.16665 38.0 38.0 38.0 36.4 38.0 55-59 37.16525 38.0 38.0 38.0 36.2 38.0 60-64 37.1101 38.0 38.0 38.0 36.0 38.0 65-69 37.029250000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.9529 38.0 38.0 38.0 36.0 38.0 75-79 36.7971 38.0 38.0 38.0 35.0 38.0 80-84 36.759249999999994 38.0 38.0 38.0 34.8 38.0 85-89 36.67315 38.0 38.0 38.0 34.8 38.0 90-94 36.62485 38.0 38.0 38.0 34.6 38.0 95-99 36.416199999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.355450000000005 38.0 37.8 38.0 34.0 38.0 105-109 36.254549999999995 38.0 37.8 38.0 33.6 38.0 110-114 35.9519 38.0 37.0 38.0 33.0 38.0 115-119 35.7342 38.0 36.8 38.0 31.4 38.0 120-124 35.5116 38.0 36.4 38.0 30.6 38.0 125-129 35.173500000000004 38.0 36.0 38.0 28.2 38.0 130-134 34.954750000000004 38.0 35.0 38.0 28.0 38.0 135-139 34.623400000000004 38.0 34.8 38.0 27.0 38.0 140-144 34.140550000000005 38.0 33.8 38.0 24.6 38.0 145-149 33.01945 38.0 33.0 38.0 17.0 38.0 150-151 28.965249999999997 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 4.0 19 3.0 20 3.0 21 3.0 22 4.0 23 6.0 24 11.0 25 16.0 26 25.0 27 27.0 28 29.0 29 32.0 30 47.0 31 71.0 32 91.0 33 95.0 34 164.0 35 311.0 36 688.0 37 2363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.49240278135462 12.825135204738606 12.361576100952872 38.3208859129539 2 21.15 17.224999999999998 35.15 26.474999999999998 3 20.225 23.0 25.45 31.324999999999996 4 22.650000000000002 31.474999999999998 22.375 23.5 5 22.125 35.199999999999996 23.799999999999997 18.875 6 17.5 36.975 25.5 20.025000000000002 7 13.65 24.275 43.824999999999996 18.25 8 17.125 24.025 32.275 26.575 9 17.224999999999998 23.9 34.0 24.875 10-14 19.845 28.765 27.29 24.099999999999998 15-19 19.634999999999998 28.48 27.894999999999996 23.990000000000002 20-24 19.78 28.725 28.115000000000002 23.380000000000003 25-29 19.965 28.22 27.905 23.91 30-34 19.665 28.23 28.134999999999998 23.97 35-39 19.509999999999998 28.34 27.76 24.39 40-44 19.68 29.485 27.26 23.575 45-49 19.89 28.970000000000002 27.935 23.205000000000002 50-54 19.765 28.595 28.18 23.46 55-59 19.82 28.76 27.785 23.635 60-64 19.8 28.735 27.705000000000002 23.76 65-69 19.57 28.895 28.23 23.305 70-74 19.55 29.015 27.860000000000003 23.575 75-79 19.634999999999998 28.754999999999995 27.48 24.13 80-84 19.869999999999997 28.585 28.349999999999998 23.195 85-89 19.915 28.860000000000003 28.01 23.215 90-94 20.79 29.104999999999997 27.224999999999998 22.88 95-99 20.54 28.294999999999998 27.505000000000003 23.66 100-104 20.369999999999997 28.744999999999997 27.560000000000002 23.325000000000003 105-109 20.445 28.294999999999998 27.99 23.27 110-114 20.835 28.360000000000003 27.855 22.95 115-119 20.544999999999998 29.104999999999997 27.37 22.98 120-124 20.085 29.285 27.175 23.455000000000002 125-129 21.175 28.075 27.334999999999997 23.415 130-134 20.75 28.34 27.72 23.189999999999998 135-139 20.605 28.525 26.96 23.91 140-144 20.505000000000003 29.154999999999998 26.75 23.59 145-149 20.235 28.93 27.36 23.474999999999998 150-151 20.0625 27.6125 28.512500000000003 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.5 27 5.5 28 10.0 29 16.0 30 22.0 31 29.0 32 36.5 33 47.0 34 68.0 35 83.5 36 91.5 37 109.0 38 134.0 39 173.5 40 206.5 41 234.5 42 256.5 43 272.0 44 288.5 45 264.0 46 252.5 47 249.5 48 214.0 49 175.5 50 157.0 51 136.0 52 105.0 53 85.5 54 68.0 55 51.5 56 41.0 57 31.5 58 20.5 59 19.0 60 14.5 61 7.0 62 3.5 63 1.5 64 3.0 65 3.0 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.6125 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATA 10 0.006832588 144.9875 5 >>END_MODULE SRR7168858 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65025 33.0 33.0 34.0 32.0 34.0 2 32.8115 33.0 33.0 34.0 32.0 34.0 3 32.8 33.0 33.0 34.0 31.0 34.0 4 32.81875 33.0 33.0 34.0 32.0 34.0 5 32.7805 33.0 33.0 34.0 32.0 34.0 6 36.995 38.0 38.0 38.0 36.0 38.0 7 37.008 38.0 38.0 38.0 36.0 38.0 8 36.98425 38.0 38.0 38.0 36.0 38.0 9 37.00275 38.0 38.0 38.0 36.0 38.0 10-14 36.92845 38.0 38.0 38.0 36.0 38.0 15-19 36.93585 38.0 38.0 38.0 36.0 38.0 20-24 36.91725 38.0 38.0 38.0 36.0 38.0 25-29 36.92815 38.0 38.0 38.0 36.0 38.0 30-34 36.90225 38.0 38.0 38.0 36.0 38.0 35-39 36.85575 38.0 38.0 38.0 36.0 38.0 40-44 36.84445000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.78995 38.0 38.0 38.0 36.0 38.0 50-54 36.77695 38.0 38.0 38.0 36.0 38.0 55-59 36.72935 38.0 38.0 38.0 35.8 38.0 60-64 36.67075 38.0 38.0 38.0 35.2 38.0 65-69 36.6428 38.0 38.0 38.0 35.4 38.0 70-74 36.554500000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.46325 38.0 38.0 38.0 34.4 38.0 80-84 36.2744 38.0 38.0 38.0 34.0 38.0 85-89 36.2411 38.0 38.0 38.0 34.0 38.0 90-94 36.08485 38.0 38.0 38.0 33.8 38.0 95-99 36.0084 38.0 38.0 38.0 33.0 38.0 100-104 35.94029999999999 38.0 38.0 38.0 33.0 38.0 105-109 35.8305 38.0 37.8 38.0 33.0 38.0 110-114 35.6536 38.0 37.0 38.0 31.8 38.0 115-119 35.4406 38.0 37.0 38.0 31.0 38.0 120-124 35.1852 38.0 36.0 38.0 28.8 38.0 125-129 34.95235 38.0 36.0 38.0 27.8 38.0 130-134 34.498999999999995 38.0 35.4 38.0 24.8 38.0 135-139 33.925200000000004 38.0 34.6 38.0 22.8 38.0 140-144 33.47515 38.0 33.4 38.0 20.6 38.0 145-149 32.2481 38.0 33.0 38.0 8.6 38.0 150-151 27.134999999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 5.0 5 0.0 6 1.0 7 0.0 8 3.0 9 2.0 10 2.0 11 3.0 12 3.0 13 3.0 14 6.0 15 7.0 16 4.0 17 2.0 18 7.0 19 7.0 20 5.0 21 10.0 22 10.0 23 12.0 24 26.0 25 21.0 26 23.0 27 24.0 28 33.0 29 40.0 30 42.0 31 55.0 32 88.0 33 104.0 34 151.0 35 276.0 36 638.0 37 2374.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.35 17.8 17.7 27.150000000000002 2 26.1 26.25 31.724999999999998 15.925 3 20.175 28.499999999999996 31.424999999999997 19.900000000000002 4 23.400000000000002 35.0 23.724999999999998 17.875 5 25.55 36.975 21.8 15.675 6 20.150000000000002 39.050000000000004 22.55 18.25 7 19.3 20.974999999999998 40.625 19.1 8 21.65 25.35 27.775 25.224999999999998 9 22.25 25.55 29.425 22.775000000000002 10-14 23.21 29.13 26.33 21.33 15-19 22.91 28.07 28.225 20.794999999999998 20-24 22.81 28.705000000000002 27.655 20.830000000000002 25-29 23.119999999999997 28.349999999999998 28.205000000000002 20.325 30-34 22.295 28.53 28.17 21.005 35-39 22.73 28.000000000000004 28.005000000000003 21.265 40-44 22.32 27.785 28.655 21.240000000000002 45-49 23.0 28.04 28.205000000000002 20.755000000000003 50-54 22.865 28.425 28.055000000000003 20.655 55-59 23.405 27.794999999999998 27.925 20.875 60-64 23.400000000000002 27.63 28.605000000000004 20.365 65-69 23.04 27.48 28.425 21.055 70-74 22.49 28.49 27.83 21.19 75-79 22.73 28.415000000000003 28.055000000000003 20.8 80-84 22.89 28.51 28.095 20.505000000000003 85-89 23.275000000000002 28.345 27.79 20.59 90-94 23.47 27.884999999999998 28.22 20.424999999999997 95-99 23.294999999999998 28.13 28.310000000000002 20.265 100-104 23.765 27.98 28.050000000000004 20.205000000000002 105-109 23.73 28.395 27.825 20.05 110-114 24.685000000000002 28.09 27.57 19.655 115-119 23.825 27.950000000000003 28.32 19.905 120-124 24.099999999999998 27.415 28.465 20.02 125-129 24.16 28.225 27.715 19.900000000000002 130-134 24.40622031101555 28.356417820891046 27.76138806940347 19.475973798689935 135-139 24.625 28.185 27.605 19.585 140-144 24.815 28.410000000000004 27.3 19.475 145-149 25.424999999999997 28.299999999999997 27.389999999999997 18.884999999999998 150-151 26.125 27.425 28.1875 18.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 3.5 26 5.0 27 5.0 28 6.5 29 12.5 30 13.5 31 16.5 32 27.0 33 39.5 34 54.0 35 75.5 36 95.0 37 107.5 38 139.5 39 179.5 40 210.5 41 253.0 42 263.0 43 272.0 44 288.0 45 269.0 46 258.5 47 252.0 48 232.0 49 190.5 50 150.5 51 128.5 52 119.0 53 94.5 54 56.0 55 40.0 56 35.0 57 27.5 58 26.0 59 18.5 60 8.0 61 5.0 62 4.5 63 4.0 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.47822803926503904 0.95 3 0.025169896803423106 0.075 4 0.05033979360684621 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.1125 0.0 0.0 0.0 0.0 130-131 6.637499999999999 0.0 0.0 0.0 0.0 132-133 7.175 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.225 0.0 0.0 0.0 0.0 138-139 8.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949101 spots for SRR7168858.sra Written 949101 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra Read 949089 spots for SRR7168858.sra Written 949089 spots for SRR7168858.sra SRR ids: ['SRR7168858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jvjpnvrk SRR7168858.sra spots: 18981792 blocks: [[1, 949089], [949090, 1898178], [1898179, 2847267], [2847268, 3796356], [3796357, 4745445], [4745446, 5694534], [5694535, 6643623], [6643624, 7592712], [7592713, 8541801], [8541802, 9490890], [9490891, 10439979], [10439980, 11389068], [11389069, 12338157], [12338158, 13287246], [13287247, 14236335], [14236336, 15185424], [15185425, 16134513], [16134514, 17083602], [17083603, 18032691], [18032692, 18981792]] SRR7168858 file size 6410606 SRR7168858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168858 SRR7168858_1.fastq SRR7168858_2.fastq Input file: SRR7168858_1.fastq Paired file: SRR7168858_2.fastq trimmed: SRR7168858-trimmed-pair1.fastq, SRR7168858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 08:24:54 2025 >> started Sat Feb 15 08:25:18 2025 >> done (23.582s) 18981792 read pairs processed; of these: 29039 ( 0.15%) short read pairs filtered out after trimming by size control 33575 ( 0.18%) empty read pairs filtered out after trimming by size control 18919178 (99.67%) read pairs available; of these: 10869421 (57.45%) trimmed read pairs available after processing 8049757 (42.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 8 0.00% 24 1 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 9 0.00% 29 6 0.00% 30 15 0.00% 31 10 0.00% 32 15 0.00% 33 14 0.00% 34 16 0.00% 35 13 0.00% 36 19 0.00% 37 13 0.00% 38 18 0.00% 39 21 0.00% 40 24 0.00% 41 45 0.00% 42 31 0.00% 43 47 0.00% 44 38 0.00% 45 43 0.00% 46 63 0.00% 47 76 0.00% 48 70 0.00% 49 91 0.00% 50 83 0.00% 51 105 0.00% 52 115 0.00% 53 144 0.00% 54 160 0.00% 55 201 0.00% 56 196 0.00% 57 223 0.00% 58 283 0.00% 59 305 0.00% 60 332 0.00% 61 348 0.00% 62 407 0.00% 63 488 0.00% 64 574 0.00% 65 659 0.00% 66 713 0.00% 67 835 0.00% 68 1060 0.01% 69 2016 0.01% 70 1825 0.01% 71 1449 0.01% 72 1570 0.01% 73 1737 0.01% 74 1964 0.01% 75 2297 0.01% 76 2402 0.01% 77 2677 0.01% 78 2967 0.02% 79 3490 0.02% 80 3785 0.02% 81 4318 0.02% 82 4903 0.03% 83 5544 0.03% 84 7156 0.04% 85 8350 0.04% 86 8683 0.05% 87 9414 0.05% 88 10217 0.05% 89 10827 0.06% 90 11503 0.06% 91 12176 0.06% 92 13302 0.07% 93 14866 0.08% 94 15643 0.08% 95 16601 0.09% 96 17521 0.09% 97 18227 0.10% 98 19210 0.10% 99 20433 0.11% 100 21975 0.12% 101 22659 0.12% 102 24139 0.13% 103 25743 0.14% 104 26607 0.14% 105 28886 0.15% 106 30238 0.16% 107 31163 0.16% 108 31929 0.17% 109 33398 0.18% 110 34362 0.18% 111 36014 0.19% 112 37902 0.20% 113 39714 0.21% 114 41292 0.22% 115 43487 0.23% 116 44902 0.24% 117 46004 0.24% 118 47250 0.25% 119 48844 0.26% 120 50322 0.27% 121 52359 0.28% 122 54449 0.29% 123 56901 0.30% 124 59559 0.31% 125 62132 0.33% 126 65279 0.35% 127 67367 0.36% 128 69905 0.37% 129 72013 0.38% 130 74715 0.39% 131 77304 0.41% 132 81072 0.43% 133 86239 0.46% 134 89679 0.47% 135 95512 0.50% 136 101895 0.54% 137 108068 0.57% 138 114841 0.61% 139 124021 0.66% 140 132732 0.70% 141 145159 0.77% 142 159408 0.84% 143 179234 0.95% 144 206782 1.09% 145 245844 1.30% 146 306852 1.62% 147 409454 2.16% 148 602087 3.18% 149 1148489 6.07% 150 4808194 25.41% 151 8049757 42.55% 18919178 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=345.11 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=0.31 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=106.03 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.1 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168858 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 08:26:51 Started mapping on | Feb 15 08:26:51 Finished on | Feb 15 08:29:12 Mapping speed, Million of reads per hour | 483.04 Number of input reads | 18919178 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17781376 Uniquely mapped reads % | 93.99% Average mapped length | 291.25 Number of splices: Total | 16834666 Number of splices: Annotated (sjdb) | 16421455 Number of splices: GT/AG | 16516701 Number of splices: GC/AG | 258933 Number of splices: AT/AC | 9733 Number of splices: Non-canonical | 49299 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484064 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 56590 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 681228 681228 681228 N_multimapping 484064 484064 484064 N_noFeature 762043 17407363 980785 N_ambiguous 278690 1912 121949 UnstrandedReadsAssigned:16740643 PositiveStrandReadsAssigned:372101 NegativeStrandReadsAssigned:16678642 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168858-trimmed-pair1.fastq SRR7168858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,919,178 reads, 16,639,138 reads pseudoaligned [quant] estimated average fragment length: 237.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR7168858.ke.tsv 34699 SRR7168858.se.tsv 87100 total ==> SRR7168858.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.46 1675 57.0974 Potri.005G024800.1.v4.1 1035 798.458 239 18.177 Potri.004G059700.1.v4.1 961 724.486 10 0.838199 Potri.007G009000.2.v4.1 1416 1179.46 0 0 Potri.003G141000.2.v4.1 2943 2706.46 969.203 21.7466 Potri.016G087400.1.v4.1 270 85.1712 806.508 575.033 Potri.015G069301.1.v4.1 564 332.981 0 0 Potri.010G195200.1.v4.1 1773 1536.46 77 3.04332 Potri.012G127500.1.v4.1 977 740.469 72 5.90477 ==> SRR7168858.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 721 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 47 SRR7168858 completed mapping pipeline successfully