Starting /dee2/code/volunteer_pipeline.sh SRR7168859 current disk space = 3092038156288 free memory = 1577642076 SRR7168859 SRAfilesize d583d7facb814b6262f6bb4c9b3ce7a7 SRR7168859.sra SRR7168859.sra file validated SRR7168859 is paired end SRR7168859 is conventional basespace SRR7168859 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.16225 34.0 33.0 34.0 32.0 34.0 2 33.112 34.0 33.0 34.0 32.0 34.0 3 33.1575 34.0 33.0 34.0 32.0 34.0 4 33.29925 34.0 33.0 34.0 32.0 34.0 5 33.24775 34.0 33.0 34.0 33.0 34.0 6 36.97925 38.0 37.0 38.0 36.0 38.0 7 37.1735 38.0 38.0 38.0 36.0 38.0 8 37.38075 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.422450000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.4686 38.0 38.0 38.0 37.0 38.0 20-24 37.41625 38.0 38.0 38.0 37.0 38.0 25-29 37.3541 38.0 38.0 38.0 37.0 38.0 30-34 37.307300000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.30884999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.287400000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.20905 38.0 38.0 38.0 36.6 38.0 50-54 37.103500000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.077149999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.8839 38.0 38.0 38.0 35.8 38.0 65-69 36.881499999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.94115000000001 38.0 38.0 38.0 35.8 38.0 75-79 36.7907 38.0 38.0 38.0 35.2 38.0 80-84 36.6019 38.0 38.0 38.0 34.2 38.0 85-89 36.41674999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.36065000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.04025 38.0 37.0 38.0 32.6 38.0 100-104 35.99875 38.0 37.2 38.0 32.8 38.0 105-109 36.0021 38.0 37.0 38.0 33.0 38.0 110-114 35.64489999999999 38.0 37.0 38.0 30.2 38.0 115-119 35.3628 38.0 36.0 38.0 29.4 38.0 120-124 35.0372 38.0 35.8 38.0 28.0 38.0 125-129 34.55025 38.0 35.0 38.0 24.8 38.0 130-134 34.09755 38.0 34.8 38.0 23.2 38.0 135-139 33.46565 38.0 33.6 38.0 19.8 38.0 140-144 32.8456 38.0 33.0 38.0 15.4 38.0 145-149 31.3984 38.0 31.0 38.0 10.8 38.0 150-151 27.1425 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 4.0 19 3.0 20 0.0 21 7.0 22 8.0 23 16.0 24 19.0 25 23.0 26 26.0 27 44.0 28 41.0 29 47.0 30 69.0 31 78.0 32 83.0 33 117.0 34 181.0 35 296.0 36 739.0 37 2190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.733992712129094 13.196251952108277 11.634565330557002 34.43519000520563 2 22.825 18.175 33.25 25.75 3 20.175 24.85 25.25 29.725 4 23.474999999999998 30.975 22.1 23.45 5 21.75 36.975 23.25 18.025 6 17.4 37.625 25.4 19.575 7 14.524999999999999 23.625 42.699999999999996 19.15 8 17.5 25.275 31.574999999999996 25.650000000000002 9 17.974999999999998 24.325 32.5 25.2 10-14 20.73 29.185 26.740000000000002 23.345 15-19 20.93 27.345000000000002 27.889999999999997 23.835 20-24 20.395 28.785 27.57 23.25 25-29 20.525 28.46 27.85 23.165 30-34 20.075000000000003 28.815 27.839999999999996 23.27 35-39 19.85 28.865000000000002 28.005000000000003 23.28 40-44 20.365 28.375 28.035 23.225 45-49 20.585 28.92 27.205000000000002 23.29 50-54 20.4 28.095 27.825 23.68 55-59 20.5 28.810000000000002 27.01 23.68 60-64 20.669999999999998 28.485 26.965 23.880000000000003 65-69 20.495 28.16 27.839999999999996 23.505000000000003 70-74 20.26 28.794999999999998 27.515 23.43 75-79 19.86 28.935 27.229999999999997 23.974999999999998 80-84 20.65 28.16 27.500000000000004 23.69 85-89 20.669999999999998 28.775000000000002 27.195000000000004 23.36 90-94 20.515 28.444999999999997 27.33 23.71 95-99 21.085 28.23 27.52 23.165 100-104 20.93 28.389999999999997 27.134999999999998 23.544999999999998 105-109 20.845 28.38 27.755000000000003 23.02 110-114 21.295 27.87 27.439999999999998 23.395 115-119 21.11 28.325 27.0 23.565 120-124 21.185000000000002 28.299999999999997 26.484999999999996 24.03 125-129 21.224999999999998 28.005000000000003 26.919999999999998 23.849999999999998 130-134 20.805 28.375 26.36 24.46 135-139 21.65 27.975 26.534999999999997 23.84 140-144 20.73 28.305000000000003 26.83 24.135 145-149 21.255 27.560000000000002 26.52 24.665 150-151 21.349999999999998 28.375 26.637499999999996 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 4.5 26 7.0 27 8.5 28 10.5 29 14.5 30 17.0 31 21.5 32 27.0 33 32.5 34 57.0 35 74.5 36 86.5 37 108.0 38 135.5 39 176.5 40 190.5 41 203.0 42 232.0 43 246.5 44 255.5 45 266.0 46 272.5 47 258.5 48 235.5 49 208.5 50 178.5 51 146.0 52 116.0 53 96.0 54 75.5 55 56.5 56 45.5 57 40.5 58 29.0 59 18.0 60 13.5 61 9.5 62 6.0 63 5.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 3.9749999999999996 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.7625 0.0 0.0 0.0 0.0 122-123 5.275 0.0 0.0 0.0 0.0 124-125 5.7125 0.0 0.0 0.0 0.0 126-127 6.05 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.7125 0.0 0.0 0.0 0.0 134-135 8.225 0.0 0.0 0.0 0.0 136-137 8.675 0.0 0.0 0.0 0.0 138-139 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCAA 10 0.0068343505 144.975 5 >>END_MODULE SRR7168859 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77575 33.0 33.0 34.0 32.0 34.0 2 32.872 33.0 33.0 34.0 32.0 34.0 3 32.888 34.0 33.0 34.0 32.0 34.0 4 32.77475 34.0 33.0 34.0 32.0 34.0 5 32.789 34.0 33.0 34.0 32.0 34.0 6 36.93075 38.0 38.0 38.0 36.0 38.0 7 36.93275 38.0 38.0 38.0 36.0 38.0 8 36.95025 38.0 38.0 38.0 36.0 38.0 9 36.932 38.0 38.0 38.0 36.0 38.0 10-14 36.921549999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.939449999999994 38.0 38.0 38.0 36.2 38.0 20-24 36.90675 38.0 38.0 38.0 36.2 38.0 25-29 36.92655 38.0 38.0 38.0 36.2 38.0 30-34 36.87405 38.0 38.0 38.0 36.0 38.0 35-39 36.7907 38.0 38.0 38.0 35.8 38.0 40-44 36.6742 38.0 38.0 38.0 35.4 38.0 45-49 36.7151 38.0 38.0 38.0 36.0 38.0 50-54 36.5215 38.0 38.0 38.0 34.8 38.0 55-59 36.521300000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.499849999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.4412 38.0 38.0 38.0 34.4 38.0 70-74 36.3325 38.0 38.0 38.0 34.2 38.0 75-79 36.2902 38.0 38.0 38.0 34.0 38.0 80-84 36.238350000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.08215 38.0 38.0 38.0 33.4 38.0 90-94 35.9932 38.0 38.0 38.0 33.2 38.0 95-99 35.885000000000005 38.0 38.0 38.0 33.0 38.0 100-104 35.597350000000006 38.0 37.6 38.0 31.0 38.0 105-109 35.27825 38.0 37.0 38.0 29.0 38.0 110-114 35.23445 38.0 37.0 38.0 28.8 38.0 115-119 35.04765 38.0 36.8 38.0 28.0 38.0 120-124 34.7581 38.0 36.2 38.0 26.8 38.0 125-129 34.54215000000001 38.0 36.0 38.0 25.2 38.0 130-134 33.83415 38.0 34.6 38.0 20.6 38.0 135-139 33.242000000000004 38.0 33.4 38.0 17.0 38.0 140-144 32.6317 38.0 33.0 38.0 13.0 38.0 145-149 31.1971 38.0 32.4 38.0 4.2 38.0 150-151 25.970625 33.5 16.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 3.0 5 2.0 6 3.0 7 2.0 8 2.0 9 2.0 10 3.0 11 2.0 12 3.0 13 4.0 14 2.0 15 7.0 16 10.0 17 11.0 18 9.0 19 8.0 20 13.0 21 11.0 22 22.0 23 21.0 24 19.0 25 27.0 26 36.0 27 34.0 28 33.0 29 46.0 30 46.0 31 68.0 32 92.0 33 112.0 34 146.0 35 249.0 36 578.0 37 2363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.175 20.825 15.25 25.75 2 25.575 25.724999999999998 31.825 16.875 3 22.175 27.175 31.324999999999996 19.325 4 23.599999999999998 34.35 23.925 18.125 5 25.124999999999996 35.85 22.7 16.325 6 20.575 37.35 23.9 18.175 7 18.525 19.45 38.875 23.150000000000002 8 21.4 25.674999999999997 27.500000000000004 25.424999999999997 9 22.3 24.325 29.175 24.2 10-14 23.015 28.655 26.625 21.705 15-19 23.56 27.77 28.000000000000004 20.669999999999998 20-24 23.175 27.96 27.694999999999997 21.17 25-29 23.0 27.834999999999997 27.925 21.240000000000002 30-34 23.405 28.065 27.72 20.810000000000002 35-39 22.81 27.639999999999997 27.744999999999997 21.805 40-44 22.61 28.439999999999998 27.785 21.165 45-49 22.845 27.134999999999998 28.42 21.6 50-54 23.31 27.99 27.894999999999996 20.805 55-59 22.93 27.6 27.6 21.87 60-64 22.845 27.965 27.965 21.224999999999998 65-69 23.03 27.425 28.585 20.96 70-74 22.63 28.189999999999998 27.655 21.525 75-79 23.09 26.695 28.38 21.834999999999997 80-84 22.770000000000003 27.544999999999998 27.884999999999998 21.8 85-89 23.015 27.915 27.705000000000002 21.365000000000002 90-94 23.015 27.644999999999996 28.144999999999996 21.195 95-99 23.82 28.365000000000002 27.195000000000004 20.62 100-104 23.925 27.215 27.389999999999997 21.47 105-109 24.035 27.985 27.46 20.52 110-114 23.335 28.15 28.07 20.445 115-119 23.845 27.715 27.68 20.76 120-124 24.104999999999997 27.845 27.339999999999996 20.71 125-129 24.990000000000002 27.0 27.415 20.595 130-134 25.135 27.915 26.545 20.405 135-139 24.955 27.750000000000004 27.37 19.925 140-144 24.675 28.01 27.3 20.015 145-149 25.915 27.384999999999998 27.01 19.689999999999998 150-151 25.687500000000004 28.0875 26.900000000000002 19.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 1.5 23 1.0 24 0.5 25 3.0 26 4.0 27 3.0 28 8.0 29 11.5 30 12.5 31 15.5 32 21.0 33 39.0 34 58.0 35 69.0 36 90.0 37 109.5 38 122.5 39 147.0 40 188.5 41 210.5 42 241.5 43 284.0 44 269.5 45 255.5 46 260.0 47 246.0 48 235.5 49 217.5 50 185.0 51 147.5 52 113.0 53 90.0 54 76.5 55 67.5 56 51.5 57 34.0 58 23.5 59 25.0 60 23.5 61 11.0 62 7.0 63 6.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.503651473180559 1.0 3 0.07554772097708386 0.22499999999999998 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4249999999999998 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.8625 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 7.025 0.0 0.0 0.0 0.0 132-133 7.512499999999999 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.475000000000001 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGAA 10 0.006830828 145.0 3 AGCAATG 10 0.006830828 145.0 4 TGAGCAG 10 0.006830828 145.0 145 >>END_MODULE Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765047 spots for SRR7168859.sra Written 765047 spots for SRR7168859.sra Read 765049 spots for SRR7168859.sra Written 765049 spots for SRR7168859.sra SRR ids: ['SRR7168859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1qhu_xi7 SRR7168859.sra spots: 15300942 blocks: [[1, 765047], [765048, 1530094], [1530095, 2295141], [2295142, 3060188], [3060189, 3825235], [3825236, 4590282], [4590283, 5355329], [5355330, 6120376], [6120377, 6885423], [6885424, 7650470], [7650471, 8415517], [8415518, 9180564], [9180565, 9945611], [9945612, 10710658], [10710659, 11475705], [11475706, 12240752], [12240753, 13005799], [13005800, 13770846], [13770847, 14535893], [14535894, 15300942]] SRR7168859 file size 5163286 SRR7168859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168859 SRR7168859_1.fastq SRR7168859_2.fastq Input file: SRR7168859_1.fastq Paired file: SRR7168859_2.fastq trimmed: SRR7168859-trimmed-pair1.fastq, SRR7168859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 09:55:44 2025 >> started Sat Feb 15 09:56:04 2025 >> done (20.574s) 15300942 read pairs processed; of these: 19246 ( 0.13%) short read pairs filtered out after trimming by size control 28738 ( 0.19%) empty read pairs filtered out after trimming by size control 15252958 (99.69%) read pairs available; of these: 8208912 (53.82%) trimmed read pairs available after processing 7044046 (46.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 9 0.00% 23 10 0.00% 24 10 0.00% 25 6 0.00% 26 12 0.00% 27 9 0.00% 28 11 0.00% 29 14 0.00% 30 10 0.00% 31 13 0.00% 32 19 0.00% 33 16 0.00% 34 22 0.00% 35 22 0.00% 36 18 0.00% 37 26 0.00% 38 25 0.00% 39 30 0.00% 40 42 0.00% 41 47 0.00% 42 63 0.00% 43 51 0.00% 44 75 0.00% 45 100 0.00% 46 100 0.00% 47 96 0.00% 48 142 0.00% 49 117 0.00% 50 141 0.00% 51 185 0.00% 52 164 0.00% 53 226 0.00% 54 232 0.00% 55 246 0.00% 56 289 0.00% 57 277 0.00% 58 368 0.00% 59 461 0.00% 60 502 0.00% 61 563 0.00% 62 669 0.00% 63 696 0.00% 64 788 0.01% 65 893 0.01% 66 979 0.01% 67 1147 0.01% 68 1415 0.01% 69 2362 0.02% 70 2130 0.01% 71 1884 0.01% 72 2100 0.01% 73 2433 0.02% 74 2718 0.02% 75 2947 0.02% 76 3212 0.02% 77 3493 0.02% 78 3838 0.03% 79 4225 0.03% 80 4946 0.03% 81 5529 0.04% 82 6232 0.04% 83 7020 0.05% 84 8246 0.05% 85 9317 0.06% 86 9687 0.06% 87 10144 0.07% 88 10841 0.07% 89 11501 0.08% 90 12552 0.08% 91 13526 0.09% 92 14323 0.09% 93 15693 0.10% 94 16924 0.11% 95 17768 0.12% 96 18200 0.12% 97 18383 0.12% 98 19411 0.13% 99 19951 0.13% 100 21117 0.14% 101 22277 0.15% 102 23781 0.16% 103 25550 0.17% 104 26222 0.17% 105 27356 0.18% 106 28133 0.18% 107 28619 0.19% 108 29308 0.19% 109 30321 0.20% 110 31160 0.20% 111 32532 0.21% 112 34053 0.22% 113 35124 0.23% 114 36843 0.24% 115 37777 0.25% 116 39309 0.26% 117 39809 0.26% 118 40332 0.26% 119 41150 0.27% 120 42123 0.28% 121 43479 0.29% 122 45090 0.30% 123 47099 0.31% 124 49026 0.32% 125 51140 0.34% 126 52747 0.35% 127 53616 0.35% 128 55233 0.36% 129 56443 0.37% 130 58497 0.38% 131 60321 0.40% 132 63006 0.41% 133 66374 0.44% 134 68619 0.45% 135 72688 0.48% 136 76282 0.50% 137 79877 0.52% 138 83755 0.55% 139 89127 0.58% 140 94092 0.62% 141 101697 0.67% 142 111210 0.73% 143 124675 0.82% 144 143092 0.94% 145 168983 1.11% 146 208300 1.37% 147 277189 1.82% 148 415472 2.72% 149 797158 5.23% 150 3628821 23.79% 151 7044046 46.18% 15252958 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=15 prefix-density=0.62 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=307.66 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCAC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=11 prefix-density=0.87 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=72.15 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7168859 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 09:57:41 Started mapping on | Feb 15 09:57:41 Finished on | Feb 15 09:59:42 Mapping speed, Million of reads per hour | 453.81 Number of input reads | 15252958 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14123929 Uniquely mapped reads % | 92.60% Average mapped length | 290.49 Number of splices: Total | 13152626 Number of splices: Annotated (sjdb) | 12884176 Number of splices: GT/AG | 12888977 Number of splices: GC/AG | 221555 Number of splices: AT/AC | 6456 Number of splices: Non-canonical | 35638 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443031 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 77081 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706150 706150 706150 N_multimapping 443031 443031 443031 N_noFeature 503846 13779940 718675 N_ambiguous 230571 1445 100325 UnstrandedReadsAssigned:13389512 PositiveStrandReadsAssigned:342544 NegativeStrandReadsAssigned:13304929 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168859-trimmed-pair1.fastq SRR7168859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,252,958 reads, 13,404,671 reads pseudoaligned [quant] estimated average fragment length: 239.827 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7168859.ke.tsv 34699 SRR7168859.se.tsv 87100 total ==> SRR7168859.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.17 420 17.4935 Potri.005G024800.1.v4.1 1035 796.173 244 22.7106 Potri.004G059700.1.v4.1 961 722.233 8 0.820842 Potri.007G009000.2.v4.1 1416 1177.17 0 0 Potri.003G141000.2.v4.1 2943 2704.17 791.402 21.6875 Potri.016G087400.1.v4.1 270 89.0932 598 497.397 Potri.015G069301.1.v4.1 564 332.199 0 0 Potri.010G195200.1.v4.1 1773 1534.17 11.934 0.576447 Potri.012G127500.1.v4.1 977 738.193 158 15.8611 ==> SRR7168859.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 447 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 169 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168859 completed mapping pipeline successfully