Starting /dee2/code/volunteer_pipeline.sh SRR7168860 current disk space = 3091863560192 free memory = 1582535260 SRR7168860 SRAfilesize bd3d94301117ebad6d140232dbd05a08 SRR7168860.sra SRR7168860.sra file validated SRR7168860 is paired end SRR7168860 is conventional basespace SRR7168860 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71575 34.0 33.0 34.0 32.0 34.0 2 33.2495 34.0 33.0 34.0 32.0 34.0 3 33.40525 34.0 34.0 34.0 33.0 34.0 4 33.384 34.0 34.0 34.0 33.0 34.0 5 33.42225 34.0 34.0 34.0 33.0 34.0 6 37.15325 38.0 38.0 38.0 36.0 38.0 7 37.37175 38.0 38.0 38.0 37.0 38.0 8 37.56925 38.0 38.0 38.0 37.0 38.0 9 37.51825 38.0 38.0 38.0 38.0 38.0 10-14 37.598349999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.6009 38.0 38.0 38.0 38.0 38.0 20-24 37.5434 38.0 38.0 38.0 37.8 38.0 25-29 37.560500000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5284 38.0 38.0 38.0 37.8 38.0 35-39 37.492000000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.442899999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.48445 38.0 38.0 38.0 37.0 38.0 50-54 37.41475 38.0 38.0 38.0 37.0 38.0 55-59 37.3616 38.0 38.0 38.0 37.0 38.0 60-64 37.35665 38.0 38.0 38.0 37.0 38.0 65-69 37.30665 38.0 38.0 38.0 37.0 38.0 70-74 37.24395 38.0 38.0 38.0 37.0 38.0 75-79 37.050799999999995 38.0 38.0 38.0 36.4 38.0 80-84 36.94605 38.0 38.0 38.0 36.0 38.0 85-89 36.882600000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.78960000000001 38.0 38.0 38.0 35.6 38.0 95-99 36.69735000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.59725 38.0 38.0 38.0 35.0 38.0 105-109 36.5718 38.0 38.0 38.0 34.8 38.0 110-114 36.3743 38.0 38.0 38.0 34.0 38.0 115-119 36.2982 38.0 38.0 38.0 34.0 38.0 120-124 35.978300000000004 38.0 37.4 38.0 33.2 38.0 125-129 35.752300000000005 38.0 37.0 38.0 32.0 38.0 130-134 35.44175 38.0 36.0 38.0 31.0 38.0 135-139 35.2108 38.0 36.0 38.0 31.0 38.0 140-144 34.7239 38.0 35.6 38.0 28.0 38.0 145-149 34.14925000000001 38.0 34.0 38.0 26.4 38.0 150-151 29.470000000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 11.0 19 11.0 20 1.0 21 1.0 22 4.0 23 0.0 24 7.0 25 7.0 26 14.0 27 11.0 28 23.0 29 27.0 30 31.0 31 38.0 32 59.0 33 91.0 34 132.0 35 221.0 36 573.0 37 2729.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.193251533742334 12.039877300613497 12.295501022494888 38.47137014314929 2 20.575 17.95 34.25 27.224999999999998 3 20.200000000000003 22.425 25.124999999999996 32.25 4 21.875 29.975 22.7 25.45 5 22.225 33.975 23.150000000000002 20.65 6 20.0 33.525 26.0 20.474999999999998 7 15.0 24.7 40.849999999999994 19.45 8 18.25 24.5 30.275000000000002 26.974999999999998 9 16.475 24.425 32.4 26.700000000000003 10-14 19.855 29.54 26.355 24.25 15-19 20.29 27.88 27.43 24.4 20-24 19.84 28.04 27.900000000000002 24.22 25-29 19.925 28.255000000000003 27.534999999999997 24.285 30-34 19.695 28.335 27.48 24.490000000000002 35-39 19.93 27.87 27.785 24.415 40-44 20.080000000000002 27.72 27.884999999999998 24.315 45-49 20.560000000000002 28.005000000000003 26.950000000000003 24.485 50-54 20.28 27.474999999999998 27.689999999999998 24.555 55-59 20.965 27.650000000000002 27.425 23.96 60-64 20.424999999999997 26.99 27.694999999999997 24.89 65-69 20.385 28.175 26.91 24.529999999999998 70-74 20.31 27.82 27.36 24.51 75-79 20.365 27.315 27.76 24.560000000000002 80-84 20.39 26.895000000000003 27.860000000000003 24.855 85-89 20.195 27.735 27.02 25.05 90-94 20.7 28.084999999999997 27.275 23.94 95-99 20.635 27.169999999999998 27.51 24.685000000000002 100-104 20.57 27.72 27.089999999999996 24.62 105-109 21.285 26.924999999999997 27.13 24.66 110-114 20.849999999999998 27.589999999999996 27.0 24.560000000000002 115-119 21.275 28.08 26.279999999999998 24.365000000000002 120-124 21.235 26.995 26.840000000000003 24.93 125-129 21.455 27.334999999999997 27.02 24.19 130-134 21.335 27.805000000000003 26.584999999999997 24.275 135-139 21.305 27.85 25.990000000000002 24.855 140-144 21.575 27.794999999999998 26.224999999999998 24.404999999999998 145-149 20.674999999999997 28.18 25.990000000000002 25.155 150-151 20.1 27.500000000000004 26.224999999999998 26.174999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.5 26 5.0 27 6.0 28 9.0 29 13.5 30 15.5 31 20.0 32 30.0 33 42.0 34 55.5 35 69.0 36 75.5 37 89.5 38 122.0 39 137.0 40 162.5 41 206.0 42 226.0 43 236.5 44 233.5 45 233.5 46 259.5 47 267.0 48 234.5 49 198.5 50 171.0 51 147.5 52 132.5 53 127.5 54 116.0 55 87.5 56 66.5 57 54.5 58 38.0 59 29.0 60 23.0 61 14.0 62 7.0 63 6.0 64 5.0 65 3.5 66 5.0 67 4.0 68 1.5 69 0.0 70 0.5 71 1.0 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00864260294865 97.375 2 0.7371631926792069 1.4500000000000002 3 0.1779359430604982 0.525 4 0.02541942043721403 0.1 5 0.02541942043721403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGC 17 0.42500000000000004 TruSeq Adapter, Index 2 (97% over 37bp) CGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGCCGT 5 0.125 TruSeq Adapter, Index 2 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.15 0.0 0.0 0.0 0.0 108-109 3.5250000000000004 0.0 0.0 0.0 0.0 110-111 3.975 0.0 0.0 0.0 0.0 112-113 4.425000000000001 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.25 0.0 0.0 0.0 0.0 118-119 5.7875 0.0 0.0 0.0 0.0 120-121 6.4 0.0 0.0 0.0 0.0 122-123 7.0375 0.0 0.0 0.0 0.0 124-125 7.8125 0.0 0.0 0.0 0.0 126-127 8.5625 0.0 0.0 0.0 0.0 128-129 9.287500000000001 0.0 0.0 0.0 0.0 130-131 10.037500000000001 0.0 0.0 0.0 0.0 132-133 10.6375 0.0 0.0 0.0 0.0 134-135 11.45 0.0 0.0 0.0 0.0 136-137 12.3 0.0 0.0 0.0 0.0 138-139 13.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168860 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69375 33.0 33.0 34.0 32.0 34.0 2 32.738 34.0 33.0 34.0 32.0 34.0 3 32.799 34.0 33.0 34.0 32.0 34.0 4 32.7325 34.0 33.0 34.0 32.0 34.0 5 32.7135 34.0 33.0 34.0 32.0 34.0 6 36.9165 38.0 38.0 38.0 37.0 38.0 7 36.853 38.0 38.0 38.0 37.0 38.0 8 36.88375 38.0 38.0 38.0 37.0 38.0 9 36.8095 38.0 38.0 38.0 36.0 38.0 10-14 36.80795 38.0 38.0 38.0 36.6 38.0 15-19 36.82465 38.0 38.0 38.0 37.0 38.0 20-24 36.7629 38.0 38.0 38.0 37.0 38.0 25-29 36.77445 38.0 38.0 38.0 37.0 38.0 30-34 36.7175 38.0 38.0 38.0 36.6 38.0 35-39 36.773700000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.696549999999995 38.0 38.0 38.0 36.8 38.0 45-49 36.650549999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.6459 38.0 38.0 38.0 36.0 38.0 55-59 36.5971 38.0 38.0 38.0 36.2 38.0 60-64 36.6107 38.0 38.0 38.0 36.0 38.0 65-69 36.5229 38.0 38.0 38.0 36.0 38.0 70-74 36.377449999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.239599999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.164 38.0 38.0 38.0 34.8 38.0 85-89 36.064049999999995 38.0 38.0 38.0 34.8 38.0 90-94 35.976350000000004 38.0 38.0 38.0 34.0 38.0 95-99 35.979699999999994 38.0 38.0 38.0 34.0 38.0 100-104 35.875299999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.73315 38.0 38.0 38.0 33.4 38.0 110-114 35.7224 38.0 38.0 38.0 33.4 38.0 115-119 35.47895 38.0 38.0 38.0 32.4 38.0 120-124 35.214 38.0 37.4 38.0 30.0 38.0 125-129 35.010650000000005 38.0 36.6 38.0 29.2 38.0 130-134 34.79045 38.0 36.0 38.0 28.2 38.0 135-139 34.3009 38.0 36.0 38.0 25.4 38.0 140-144 33.870400000000004 38.0 35.2 38.0 23.0 38.0 145-149 32.7616 38.0 33.0 38.0 12.4 38.0 150-151 28.22925 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 12.0 4 6.0 5 6.0 6 2.0 7 2.0 8 3.0 9 2.0 10 2.0 11 3.0 12 2.0 13 7.0 14 6.0 15 2.0 16 5.0 17 17.0 18 2.0 19 7.0 20 4.0 21 8.0 22 6.0 23 6.0 24 13.0 25 19.0 26 21.0 27 17.0 28 26.0 29 29.0 30 36.0 31 54.0 32 54.0 33 72.0 34 123.0 35 175.0 36 510.0 37 2710.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 19.725 17.4 25.724999999999998 2 26.400000000000002 25.8 30.8 17.0 3 22.1 27.800000000000004 30.675 19.425 4 25.025 32.074999999999996 23.075000000000003 19.825 5 26.1 34.575 22.475 16.85 6 21.875 34.75 24.0 19.375 7 20.45 20.875 38.324999999999996 20.349999999999998 8 23.724999999999998 24.5 27.05 24.725 9 22.775000000000002 24.5 29.349999999999998 23.375 10-14 25.11 28.17 25.314999999999998 21.404999999999998 15-19 23.799999999999997 27.98 27.165 21.055 20-24 24.57 27.779999999999998 26.685 20.965 25-29 24.4 28.115000000000002 26.645000000000003 20.84 30-34 24.295 27.96 26.919999999999998 20.825 35-39 23.56 28.005000000000003 27.139999999999997 21.295 40-44 24.92 27.305 26.724999999999998 21.05 45-49 24.235 27.765 26.775 21.224999999999998 50-54 24.285 27.05 27.779999999999998 20.885 55-59 24.545 27.24 26.85 21.365000000000002 60-64 24.135 28.505000000000003 26.240000000000002 21.12 65-69 25.03 27.74 26.35 20.880000000000003 70-74 24.095 27.92 27.005000000000003 20.979999999999997 75-79 24.13 28.04 26.805 21.025 80-84 24.5 27.439999999999998 26.784999999999997 21.275 85-89 24.834999999999997 27.72 26.284999999999997 21.16 90-94 25.025 27.689999999999998 26.384999999999998 20.9 95-99 25.06250625062506 27.867786778677868 26.48264826482648 20.587058705870586 100-104 25.36253625362536 28.01780178017802 26.4976497649765 20.122012201220123 105-109 24.782478247824784 27.9027902790279 26.74767476747675 20.567056705670566 110-114 25.156257812890644 28.376418820941048 26.181309065453274 20.286014300715035 115-119 25.79257925792579 27.782778277827784 26.357635763576358 20.067006700670067 120-124 25.776288814440722 28.266413320666032 26.251312565628282 19.705985299264963 125-129 26.07 28.499999999999996 25.790000000000003 19.64 130-134 26.51765176517652 27.15271527152715 26.327632763276327 20.00200020002 135-139 26.65633281664083 27.816390819540977 26.266313315665784 19.26096304815241 140-144 27.21 27.565 25.6 19.625 145-149 27.575 28.189999999999998 25.6 18.634999999999998 150-151 27.150000000000002 27.987499999999997 25.7875 19.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.5 23 1.5 24 0.0 25 0.5 26 2.0 27 3.5 28 4.5 29 6.5 30 8.0 31 10.0 32 19.5 33 28.0 34 27.5 35 39.5 36 57.5 37 81.0 38 107.5 39 131.0 40 171.0 41 193.5 42 210.0 43 262.5 44 294.5 45 280.0 46 274.5 47 259.5 48 232.0 49 208.0 50 168.0 51 152.0 52 138.0 53 111.5 54 113.0 55 107.5 56 78.5 57 50.5 58 35.0 59 33.0 60 26.0 61 17.5 62 13.5 63 8.0 64 6.0 65 4.0 66 1.5 67 2.5 68 3.5 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 1.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.01 105-109 0.01 110-114 0.005 115-119 0.01 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00889453621346 97.39999999999999 2 0.8132147395171537 1.6 3 0.07623888182973317 0.22499999999999998 4 0.05082592121982211 0.2 5 0.025412960609911054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025412960609911054 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 18 0.44999999999999996 Illumina Single End PCR Primer 1 (100% over 50bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.0875000000000004 0.0 0.0 0.0 0.0 102-103 2.4124999999999996 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.5875 0.0 0.0 0.0 0.0 110-111 4.025 0.0 0.0 0.0 0.0 112-113 4.5 0.0 0.0 0.0 0.0 114-115 4.925 0.0 0.0 0.0 0.0 116-117 5.5 0.0 0.0 0.0 0.0 118-119 6.075 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.3125 0.0 0.0 0.0 0.0 124-125 8.075 0.0 0.0 0.0 0.0 126-127 8.8 0.0 0.0 0.0 0.0 128-129 9.625 0.0 0.0 0.0 0.0 130-131 10.3875 0.0 0.0 0.0 0.0 132-133 10.9875 0.0 0.0 0.0 0.0 134-135 11.837499999999999 0.0 0.0 0.0 0.0 136-137 12.662500000000001 0.0 0.0 0.0 0.0 138-139 13.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 165 0.0053690304 7.909091 20-24 >>END_MODULE Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731820 spots for SRR7168860.sra Written 731820 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra Read 731814 spots for SRR7168860.sra Written 731814 spots for SRR7168860.sra SRR ids: ['SRR7168860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xnb_2k25 SRR7168860.sra spots: 14636286 blocks: [[1, 731814], [731815, 1463628], [1463629, 2195442], [2195443, 2927256], [2927257, 3659070], [3659071, 4390884], [4390885, 5122698], [5122699, 5854512], [5854513, 6586326], [6586327, 7318140], [7318141, 8049954], [8049955, 8781768], [8781769, 9513582], [9513583, 10245396], [10245397, 10977210], [10977211, 11709024], [11709025, 12440838], [12440839, 13172652], [13172653, 13904466], [13904467, 14636286]] SRR7168860 file size 4938056 SRR7168860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168860 SRR7168860_1.fastq SRR7168860_2.fastq Input file: SRR7168860_1.fastq Paired file: SRR7168860_2.fastq trimmed: SRR7168860-trimmed-pair1.fastq, SRR7168860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 10:03:42 2025 >> started Sat Feb 15 10:04:05 2025 >> done (23.339s) 14636286 read pairs processed; of these: 48440 ( 0.33%) short read pairs filtered out after trimming by size control 148811 ( 1.02%) empty read pairs filtered out after trimming by size control 14439035 (98.65%) read pairs available; of these: 7991382 (55.35%) trimmed read pairs available after processing 6447653 (44.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 11 0.00% 22 13 0.00% 23 16 0.00% 24 17 0.00% 25 14 0.00% 26 14 0.00% 27 26 0.00% 28 16 0.00% 29 13 0.00% 30 23 0.00% 31 25 0.00% 32 34 0.00% 33 18 0.00% 34 25 0.00% 35 26 0.00% 36 34 0.00% 37 40 0.00% 38 38 0.00% 39 45 0.00% 40 53 0.00% 41 51 0.00% 42 57 0.00% 43 63 0.00% 44 100 0.00% 45 134 0.00% 46 130 0.00% 47 134 0.00% 48 112 0.00% 49 136 0.00% 50 178 0.00% 51 212 0.00% 52 219 0.00% 53 221 0.00% 54 227 0.00% 55 263 0.00% 56 274 0.00% 57 307 0.00% 58 355 0.00% 59 389 0.00% 60 458 0.00% 61 493 0.00% 62 584 0.00% 63 650 0.00% 64 838 0.01% 65 1821 0.01% 66 1143 0.01% 67 1156 0.01% 68 1585 0.01% 69 5148 0.04% 70 4347 0.03% 71 2105 0.01% 72 2039 0.01% 73 2200 0.02% 74 2529 0.02% 75 2726 0.02% 76 2958 0.02% 77 3235 0.02% 78 3550 0.02% 79 3997 0.03% 80 4570 0.03% 81 5203 0.04% 82 5857 0.04% 83 6716 0.05% 84 9301 0.06% 85 10738 0.07% 86 11453 0.08% 87 12300 0.09% 88 12526 0.09% 89 13208 0.09% 90 14235 0.10% 91 14838 0.10% 92 15822 0.11% 93 17556 0.12% 94 18812 0.13% 95 20241 0.14% 96 21034 0.15% 97 21575 0.15% 98 22320 0.15% 99 22908 0.16% 100 24542 0.17% 101 25121 0.17% 102 26872 0.19% 103 28787 0.20% 104 30380 0.21% 105 32752 0.23% 106 33680 0.23% 107 34583 0.24% 108 35754 0.25% 109 37770 0.26% 110 38872 0.27% 111 38802 0.27% 112 40846 0.28% 113 43595 0.30% 114 44654 0.31% 115 46914 0.32% 116 48651 0.34% 117 49123 0.34% 118 50083 0.35% 119 50817 0.35% 120 52192 0.36% 121 52455 0.36% 122 53981 0.37% 123 57154 0.40% 124 59455 0.41% 125 60565 0.42% 126 63164 0.44% 127 64410 0.45% 128 66016 0.46% 129 67165 0.47% 130 68546 0.47% 131 69204 0.48% 132 71398 0.49% 133 74863 0.52% 134 77202 0.53% 135 82257 0.57% 136 84608 0.59% 137 88807 0.62% 138 91945 0.64% 139 95421 0.66% 140 99105 0.69% 141 105559 0.73% 142 112355 0.78% 143 123062 0.85% 144 138800 0.96% 145 159380 1.10% 146 191323 1.33% 147 249018 1.72% 148 358276 2.48% 149 685851 4.75% 150 3276388 22.69% 151 6447653 44.65% 14439035 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=47.21 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=34.79 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7168860 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 10:05:14 Started mapping on | Feb 15 10:05:14 Finished on | Feb 15 10:07:39 Mapping speed, Million of reads per hour | 358.49 Number of input reads | 14439035 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12573843 Uniquely mapped reads % | 87.08% Average mapped length | 289.00 Number of splices: Total | 12076160 Number of splices: Annotated (sjdb) | 11795513 Number of splices: GT/AG | 11852285 Number of splices: GC/AG | 181694 Number of splices: AT/AC | 6978 Number of splices: Non-canonical | 35203 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411750 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 238744 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.08% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1487193 1487193 1487193 N_multimapping 411750 411750 411750 N_noFeature 384189 12293951 508807 N_ambiguous 248909 1266 92891 UnstrandedReadsAssigned:11940745 PositiveStrandReadsAssigned:278626 NegativeStrandReadsAssigned:11972145 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7168860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168860-trimmed-pair1.fastq SRR7168860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,439,035 reads, 12,169,679 reads pseudoaligned [quant] estimated average fragment length: 209.634 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7168860.ke.tsv 34699 SRR7168860.se.tsv 87100 total ==> SRR7168860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.37 1153 42.5902 Potri.005G024800.1.v4.1 1035 826.366 400 32.3515 Potri.004G059700.1.v4.1 961 752.371 2 0.177666 Potri.007G009000.2.v4.1 1416 1207.37 0 0 Potri.003G141000.2.v4.1 2943 2734.37 804.437 19.6626 Potri.016G087400.1.v4.1 270 92.6362 1022 737.355 Potri.015G069301.1.v4.1 564 357.023 0 0 Potri.010G195200.1.v4.1 1773 1564.37 552 23.5834 Potri.012G127500.1.v4.1 977 768.366 102 8.87235 ==> SRR7168860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 317 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7168860 completed mapping pipeline successfully