Starting /dee2/code/volunteer_pipeline.sh SRR7168861 current disk space = 3092343447552 free memory = 1497905304 SRR7168861 SRAfilesize a328eec2621f0a6c762c2ec8f155540b SRR7168861.sra SRR7168861.sra file validated SRR7168861 is paired end SRR7168861 is conventional basespace SRR7168861 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33425 34.0 33.0 34.0 32.0 34.0 2 33.25975 34.0 33.0 34.0 32.0 34.0 3 33.2875 34.0 33.0 34.0 32.0 34.0 4 33.41375 34.0 33.0 34.0 33.0 34.0 5 33.43175 34.0 33.0 34.0 33.0 34.0 6 37.17125 38.0 38.0 38.0 36.0 38.0 7 37.42725 38.0 38.0 38.0 37.0 38.0 8 37.494 38.0 38.0 38.0 37.0 38.0 9 37.51925 38.0 38.0 38.0 38.0 38.0 10-14 37.567899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.574250000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.49885 38.0 38.0 38.0 37.8 38.0 25-29 37.5144 38.0 38.0 38.0 38.0 38.0 30-34 37.4804 38.0 38.0 38.0 37.4 38.0 35-39 37.43645 38.0 38.0 38.0 37.0 38.0 40-44 37.41305 38.0 38.0 38.0 37.4 38.0 45-49 37.35745 38.0 38.0 38.0 37.0 38.0 50-54 37.34305 38.0 38.0 38.0 37.0 38.0 55-59 37.2802 38.0 38.0 38.0 37.0 38.0 60-64 37.2346 38.0 38.0 38.0 37.0 38.0 65-69 37.182900000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.119550000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.0133 38.0 38.0 38.0 36.0 38.0 80-84 36.952 38.0 38.0 38.0 36.0 38.0 85-89 36.87330000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.70235 38.0 38.0 38.0 35.2 38.0 95-99 36.63445 38.0 38.0 38.0 35.0 38.0 100-104 36.532349999999994 38.0 38.0 38.0 34.8 38.0 105-109 36.4196 38.0 38.0 38.0 34.0 38.0 110-114 36.18299999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.07275 38.0 37.6 38.0 33.6 38.0 120-124 35.815999999999995 38.0 37.0 38.0 32.0 38.0 125-129 35.525 38.0 36.2 38.0 31.0 38.0 130-134 35.153 38.0 36.0 38.0 29.8 38.0 135-139 34.546800000000005 38.0 34.8 38.0 27.0 38.0 140-144 34.19885 38.0 33.6 38.0 25.2 38.0 145-149 33.33385 38.0 33.0 38.0 20.2 38.0 150-151 28.615250000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 4.0 18 5.0 19 8.0 20 8.0 21 3.0 22 3.0 23 9.0 24 8.0 25 9.0 26 15.0 27 26.0 28 24.0 29 20.0 30 57.0 31 48.0 32 65.0 33 83.0 34 127.0 35 210.0 36 669.0 37 2594.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.64587108464924 13.176287859176805 11.77841056173958 39.39943049443438 2 22.411205602801402 18.90945472736368 33.56678339169585 25.11255627813907 3 21.2 22.275 24.275 32.25 4 22.275 32.05 22.5 23.175 5 22.875 35.475 23.425 18.224999999999998 6 18.125 37.125 24.675 20.075000000000003 7 13.4 26.125 43.175000000000004 17.299999999999997 8 17.625 24.425 31.974999999999998 25.974999999999998 9 18.8 23.525 33.275 24.4 10-14 20.044999999999998 30.37 26.490000000000002 23.095 15-19 19.82 29.01 27.544999999999998 23.625 20-24 19.994999999999997 29.17 27.965 22.869999999999997 25-29 19.755 29.080000000000002 27.560000000000002 23.605 30-34 19.919999999999998 29.220000000000002 27.91 22.95 35-39 19.595000000000002 29.465000000000003 27.485 23.455000000000002 40-44 19.365 29.075 28.13 23.43 45-49 20.349999999999998 28.535 27.735 23.380000000000003 50-54 19.74 29.15 27.32 23.79 55-59 19.515 29.025000000000002 28.199999999999996 23.26 60-64 20.515 27.97 28.144999999999996 23.369999999999997 65-69 20.185 28.67 27.82 23.325000000000003 70-74 20.39 28.804999999999996 27.51 23.294999999999998 75-79 19.73 28.455000000000002 28.15 23.665 80-84 20.49 28.765 27.435 23.31 85-89 19.994999999999997 28.68 27.6 23.724999999999998 90-94 20.21 27.779999999999998 28.249999999999996 23.76 95-99 20.31 28.595 27.63 23.465 100-104 20.185 28.515 27.560000000000002 23.74 105-109 21.085 28.349999999999998 27.639999999999997 22.925 110-114 20.61 27.845 27.435 24.11 115-119 20.745 28.515 27.36 23.380000000000003 120-124 20.225 28.42 27.54 23.815 125-129 20.635 27.944999999999997 27.284999999999997 24.135 130-134 20.965 28.625 26.784999999999997 23.625 135-139 20.630000000000003 28.27 27.134999999999998 23.965 140-144 20.785 28.384999999999998 26.57 24.26 145-149 20.39 28.96 26.705000000000002 23.945 150-151 21.275 29.299999999999997 26.637499999999996 22.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 4.0 24 2.5 25 2.0 26 3.0 27 8.5 28 12.0 29 12.0 30 22.0 31 30.0 32 32.0 33 51.5 34 65.5 35 79.0 36 102.5 37 120.0 38 151.5 39 170.5 40 191.0 41 224.0 42 249.5 43 262.5 44 271.5 45 272.5 46 253.0 47 228.5 48 224.0 49 207.0 50 171.0 51 142.5 52 101.0 53 70.5 54 65.5 55 51.5 56 33.5 57 32.0 58 24.5 59 16.0 60 9.5 61 8.0 62 7.0 63 3.0 64 2.0 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01240820460876 97.75 2 0.8609774626487718 1.7000000000000002 3 0.05064573309698658 0.15 4 0.02532286654849329 0.1 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.02532286654849329 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 50bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.5750000000000002 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.1625 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.512499999999999 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.8875 0.0 0.0 0.0 0.0 126-127 6.3125 0.0 0.0 0.0 0.0 128-129 6.825 0.0 0.0 0.0 0.0 130-131 7.3625 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.3375 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGAG 10 0.0068343505 144.975 145 GATGAAA 10 0.0068343505 144.975 5 >>END_MODULE SRR7168861 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95575 33.0 33.0 34.0 32.0 34.0 2 33.09625 34.0 33.0 34.0 32.0 34.0 3 33.12975 34.0 33.0 34.0 33.0 34.0 4 33.06075 34.0 33.0 34.0 33.0 34.0 5 33.13875 34.0 33.0 34.0 33.0 34.0 6 37.32275 38.0 38.0 38.0 37.0 38.0 7 37.377 38.0 38.0 38.0 37.0 38.0 8 37.323 38.0 38.0 38.0 37.0 38.0 9 37.253 38.0 38.0 38.0 37.0 38.0 10-14 37.24395 38.0 38.0 38.0 37.0 38.0 15-19 37.22945 38.0 38.0 38.0 37.0 38.0 20-24 37.188599999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.2195 38.0 38.0 38.0 37.0 38.0 30-34 37.186 38.0 38.0 38.0 37.0 38.0 35-39 37.1991 38.0 38.0 38.0 37.0 38.0 40-44 37.22865 38.0 38.0 38.0 37.0 38.0 45-49 37.1644 38.0 38.0 38.0 37.0 38.0 50-54 37.08695 38.0 38.0 38.0 37.0 38.0 55-59 37.075100000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.07525 38.0 38.0 38.0 37.0 38.0 65-69 37.009299999999996 38.0 38.0 38.0 36.8 38.0 70-74 36.89684999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.81955 38.0 38.0 38.0 36.0 38.0 80-84 36.6464 38.0 38.0 38.0 35.8 38.0 85-89 36.60305 38.0 38.0 38.0 35.2 38.0 90-94 36.5937 38.0 38.0 38.0 35.2 38.0 95-99 36.49544999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.35875 38.0 38.0 38.0 34.2 38.0 105-109 36.368750000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.15325 38.0 38.0 38.0 34.0 38.0 115-119 35.909000000000006 38.0 38.0 38.0 33.2 38.0 120-124 35.798899999999996 38.0 37.6 38.0 33.0 38.0 125-129 35.5837 38.0 37.0 38.0 31.6 38.0 130-134 35.266000000000005 38.0 36.2 38.0 30.6 38.0 135-139 34.60795 38.0 35.8 38.0 27.2 38.0 140-144 34.2069 38.0 35.0 38.0 25.8 38.0 145-149 33.21405 38.0 33.0 38.0 17.4 38.0 150-151 28.3365 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 5.0 14 2.0 15 4.0 16 1.0 17 13.0 18 3.0 19 8.0 20 8.0 21 5.0 22 11.0 23 9.0 24 14.0 25 21.0 26 17.0 27 25.0 28 25.0 29 41.0 30 42.0 31 44.0 32 53.0 33 60.0 34 104.0 35 221.0 36 518.0 37 2733.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.825 17.0 18.475 28.7 2 26.900000000000002 24.45 32.6 16.05 3 21.425 27.750000000000004 30.425 20.4 4 25.2 34.275 21.349999999999998 19.175 5 25.474999999999998 36.199999999999996 21.5 16.825000000000003 6 19.8 38.074999999999996 25.074999999999996 17.05 7 19.875 18.75 40.825 20.549999999999997 8 22.275 24.15 28.075 25.5 9 22.025 24.875 30.125 22.975 10-14 23.625 29.185 26.029999999999998 21.16 15-19 23.47 27.834999999999997 28.205000000000002 20.49 20-24 22.91 27.82 28.360000000000003 20.91 25-29 22.595000000000002 29.025000000000002 27.705000000000002 20.674999999999997 30-34 22.945 28.03 28.18 20.845 35-39 23.21 28.449999999999996 27.74 20.599999999999998 40-44 23.419999999999998 27.889999999999997 27.495000000000005 21.195 45-49 22.6 27.950000000000003 28.544999999999998 20.905 50-54 23.325000000000003 28.475 27.615000000000002 20.585 55-59 23.125 27.85 28.705000000000002 20.32 60-64 22.86 28.599999999999998 28.065 20.474999999999998 65-69 23.715 27.85 27.900000000000002 20.535 70-74 23.36 28.18 27.425 21.035 75-79 23.125 28.325 28.075 20.474999999999998 80-84 22.875 28.54 27.860000000000003 20.724999999999998 85-89 23.86 27.66 28.310000000000002 20.169999999999998 90-94 23.82 28.21 27.865000000000002 20.105 95-99 23.685000000000002 28.42 27.51 20.385 100-104 23.885 27.91 28.275 19.93 105-109 24.005000000000003 28.1 27.48 20.415 110-114 24.255 28.775000000000002 27.305 19.665 115-119 23.62 28.185 28.03 20.165 120-124 24.12 28.13 27.455000000000002 20.294999999999998 125-129 24.735 27.779999999999998 27.465 20.02 130-134 24.745 27.97 27.639999999999997 19.645000000000003 135-139 24.535 28.615000000000002 27.21 19.64 140-144 24.865000000000002 28.175 27.189999999999998 19.77 145-149 24.8 27.775 27.36 20.064999999999998 150-151 24.975 28.0625 27.3375 19.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 4.0 28 8.0 29 10.0 30 13.0 31 20.0 32 29.5 33 46.0 34 60.0 35 64.5 36 74.0 37 105.0 38 141.5 39 169.0 40 194.5 41 229.0 42 257.5 43 289.0 44 307.0 45 281.5 46 264.0 47 252.5 48 228.5 49 206.0 50 171.0 51 121.5 52 95.0 53 84.0 54 74.0 55 56.5 56 36.0 57 24.5 58 17.5 59 18.5 60 11.5 61 6.0 62 7.0 63 7.5 64 5.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85873700228252 97.45 2 1.0144559979710879 2.0 3 0.0760841998478316 0.22499999999999998 4 0.025361399949277198 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025361399949277198 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4249999999999998 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8375000000000004 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 5.8625 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.8 0.0 0.0 0.0 0.0 130-131 7.35 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 9.024999999999999 0.0 0.0 0.0 0.0 138-139 9.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGTGG 10 0.006830828 145.0 6 AAAAAAA 50 2.0994885E-6 29.0 145 >>END_MODULE Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789570 spots for SRR7168861.sra Written 789570 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra Read 789566 spots for SRR7168861.sra Written 789566 spots for SRR7168861.sra SRR ids: ['SRR7168861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e9d8l7vz SRR7168861.sra spots: 15791324 blocks: [[1, 789566], [789567, 1579132], [1579133, 2368698], [2368699, 3158264], [3158265, 3947830], [3947831, 4737396], [4737397, 5526962], [5526963, 6316528], [6316529, 7106094], [7106095, 7895660], [7895661, 8685226], [8685227, 9474792], [9474793, 10264358], [10264359, 11053924], [11053925, 11843490], [11843491, 12633056], [12633057, 13422622], [13422623, 14212188], [14212189, 15001754], [15001755, 15791324]] SRR7168861 file size 5329461 SRR7168861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168861 SRR7168861_1.fastq SRR7168861_2.fastq Input file: SRR7168861_1.fastq Paired file: SRR7168861_2.fastq trimmed: SRR7168861-trimmed-pair1.fastq, SRR7168861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 09:30:23 2025 >> started Sat Feb 15 09:30:40 2025 >> done (17.210s) 15791324 read pairs processed; of these: 13373 ( 0.08%) short read pairs filtered out after trimming by size control 32409 ( 0.21%) empty read pairs filtered out after trimming by size control 15745542 (99.71%) read pairs available; of these: 8096391 (51.42%) trimmed read pairs available after processing 7649151 (48.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 6 0.00% 21 8 0.00% 22 6 0.00% 23 7 0.00% 24 4 0.00% 25 10 0.00% 26 9 0.00% 27 10 0.00% 28 9 0.00% 29 7 0.00% 30 9 0.00% 31 12 0.00% 32 15 0.00% 33 9 0.00% 34 19 0.00% 35 13 0.00% 36 14 0.00% 37 24 0.00% 38 32 0.00% 39 32 0.00% 40 30 0.00% 41 35 0.00% 42 38 0.00% 43 49 0.00% 44 65 0.00% 45 88 0.00% 46 60 0.00% 47 92 0.00% 48 93 0.00% 49 112 0.00% 50 100 0.00% 51 139 0.00% 52 176 0.00% 53 191 0.00% 54 205 0.00% 55 220 0.00% 56 267 0.00% 57 291 0.00% 58 356 0.00% 59 351 0.00% 60 476 0.00% 61 575 0.00% 62 584 0.00% 63 635 0.00% 64 719 0.00% 65 803 0.01% 66 912 0.01% 67 1091 0.01% 68 1361 0.01% 69 2963 0.02% 70 2795 0.02% 71 1955 0.01% 72 2137 0.01% 73 2322 0.01% 74 2438 0.02% 75 2804 0.02% 76 3107 0.02% 77 3428 0.02% 78 3784 0.02% 79 4308 0.03% 80 4960 0.03% 81 5401 0.03% 82 6159 0.04% 83 6802 0.04% 84 8149 0.05% 85 8918 0.06% 86 9324 0.06% 87 10411 0.07% 88 11148 0.07% 89 11674 0.07% 90 12871 0.08% 91 13677 0.09% 92 14539 0.09% 93 16387 0.10% 94 17116 0.11% 95 18267 0.12% 96 19252 0.12% 97 20147 0.13% 98 20683 0.13% 99 21703 0.14% 100 23355 0.15% 101 24231 0.15% 102 25586 0.16% 103 26598 0.17% 104 27890 0.18% 105 29496 0.19% 106 30315 0.19% 107 31410 0.20% 108 32125 0.20% 109 33654 0.21% 110 34433 0.22% 111 36050 0.23% 112 37084 0.24% 113 38757 0.25% 114 39957 0.25% 115 41515 0.26% 116 42871 0.27% 117 43475 0.28% 118 44242 0.28% 119 45402 0.29% 120 46638 0.30% 121 48005 0.30% 122 48863 0.31% 123 51058 0.32% 124 52910 0.34% 125 53807 0.34% 126 55838 0.35% 127 57461 0.36% 128 58801 0.37% 129 59953 0.38% 130 61517 0.39% 131 63434 0.40% 132 65268 0.41% 133 67772 0.43% 134 70284 0.45% 135 73617 0.47% 136 75953 0.48% 137 80155 0.51% 138 83058 0.53% 139 88142 0.56% 140 92385 0.59% 141 98722 0.63% 142 106396 0.68% 143 116675 0.74% 144 132287 0.84% 145 153742 0.98% 146 186558 1.18% 147 244885 1.56% 148 366963 2.33% 149 706897 4.49% 150 3639894 23.12% 151 7649151 48.58% 15745542 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=2.0 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=48.31 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=23 prefix-density=0.79 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=13.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7168861 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 09:32:18 Started mapping on | Feb 15 09:32:18 Finished on | Feb 15 09:34:05 Mapping speed, Million of reads per hour | 529.76 Number of input reads | 15745542 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14656721 Uniquely mapped reads % | 93.08% Average mapped length | 290.53 Number of splices: Total | 13383941 Number of splices: Annotated (sjdb) | 13076019 Number of splices: GT/AG | 13131994 Number of splices: GC/AG | 200686 Number of splices: AT/AC | 9086 Number of splices: Non-canonical | 42175 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443514 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 112689 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656272 656272 656272 N_multimapping 443514 443514 443514 N_noFeature 585432 14254448 824567 N_ambiguous 266449 1838 101827 UnstrandedReadsAssigned:13804840 PositiveStrandReadsAssigned:400435 NegativeStrandReadsAssigned:13730327 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168861-trimmed-pair1.fastq SRR7168861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,745,542 reads, 13,771,106 reads pseudoaligned [quant] estimated average fragment length: 230.628 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7168861.ke.tsv 34699 SRR7168861.se.tsv 87100 total ==> SRR7168861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.37 676 25.1627 Potri.005G024800.1.v4.1 1035 805.372 225 18.5975 Potri.004G059700.1.v4.1 961 731.413 3 0.273041 Potri.007G009000.2.v4.1 1416 1186.37 0 0 Potri.003G141000.2.v4.1 2943 2713.37 789.904 19.3791 Potri.016G087400.1.v4.1 270 89.9522 1001.73 741.324 Potri.015G069301.1.v4.1 564 339.306 0 0 Potri.010G195200.1.v4.1 1773 1543.37 146 6.29724 Potri.012G127500.1.v4.1 977 747.382 128 11.4008 ==> SRR7168861.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 764 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7168861 completed mapping pipeline successfully