Starting /dee2/code/volunteer_pipeline.sh SRR7168862 current disk space = 3091377188864 free memory = 1579239880 SRR7168862 SRAfilesize fa4445be0112de89c6f1787fbee7b57b SRR7168862.sra SRR7168862.sra file validated SRR7168862 is paired end SRR7168862 is conventional basespace SRR7168862 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3515 34.0 33.0 34.0 32.0 34.0 2 33.08025 34.0 33.0 34.0 32.0 34.0 3 33.11725 34.0 33.0 34.0 32.0 34.0 4 33.18825 34.0 33.0 34.0 32.0 34.0 5 33.28775 34.0 33.0 34.0 32.0 34.0 6 37.02225 38.0 37.0 38.0 36.0 38.0 7 37.30075 38.0 38.0 38.0 37.0 38.0 8 37.3735 38.0 38.0 38.0 37.0 38.0 9 37.3745 38.0 38.0 38.0 37.0 38.0 10-14 37.43325 38.0 38.0 38.0 37.0 38.0 15-19 37.42895 38.0 38.0 38.0 37.0 38.0 20-24 37.41015 38.0 38.0 38.0 37.0 38.0 25-29 37.3509 38.0 38.0 38.0 37.0 38.0 30-34 37.368849999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.32835 38.0 38.0 38.0 37.0 38.0 40-44 37.257600000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.26505 38.0 38.0 38.0 37.0 38.0 50-54 37.2111 38.0 38.0 38.0 37.0 38.0 55-59 37.11595 38.0 38.0 38.0 36.0 38.0 60-64 37.030950000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.065749999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.96265 38.0 38.0 38.0 36.0 38.0 75-79 36.84105 38.0 38.0 38.0 35.2 38.0 80-84 36.849000000000004 38.0 38.0 38.0 35.2 38.0 85-89 36.69199999999999 38.0 38.0 38.0 34.6 38.0 90-94 36.68365 38.0 38.0 38.0 34.6 38.0 95-99 36.53959999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.33595 38.0 38.0 38.0 34.0 38.0 105-109 36.142849999999996 38.0 37.8 38.0 33.4 38.0 110-114 35.999700000000004 38.0 37.2 38.0 33.0 38.0 115-119 35.7598 38.0 37.0 38.0 31.6 38.0 120-124 35.50085 38.0 36.4 38.0 30.2 38.0 125-129 35.143449999999994 38.0 36.0 38.0 28.0 38.0 130-134 35.092 38.0 35.8 38.0 28.4 38.0 135-139 34.6798 38.0 35.0 38.0 27.2 38.0 140-144 34.31095 38.0 34.2 38.0 26.0 38.0 145-149 33.265 38.0 33.0 38.0 18.8 38.0 150-151 29.300124999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 1.0 19 3.0 20 8.0 21 8.0 22 5.0 23 10.0 24 13.0 25 11.0 26 15.0 27 27.0 28 24.0 29 41.0 30 47.0 31 48.0 32 91.0 33 102.0 34 179.0 35 254.0 36 663.0 37 2443.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.53038105046344 12.281153450051493 12.590113285272913 39.59835221421215 2 23.0 17.599999999999998 32.75 26.650000000000002 3 19.5 22.8 24.474999999999998 33.225 4 23.175 31.05 21.3 24.474999999999998 5 22.775000000000002 34.949999999999996 23.7 18.575 6 18.85 36.575 24.975 19.6 7 13.450000000000001 24.349999999999998 44.074999999999996 18.125 8 18.575 23.974999999999998 32.2 25.25 9 16.55 24.55 33.275 25.624999999999996 10-14 19.71 29.335 27.029999999999998 23.925 15-19 19.74 27.87 28.725 23.665 20-24 19.6 28.83 28.08 23.49 25-29 19.245 28.599999999999998 28.43 23.724999999999998 30-34 19.875 28.335 28.08 23.71 35-39 19.445 29.115000000000002 28.065 23.375 40-44 19.555 29.065 27.665 23.715 45-49 19.794999999999998 28.62 27.72 23.865 50-54 19.86 28.7 28.299999999999997 23.14 55-59 19.794999999999998 28.685 27.805000000000003 23.715 60-64 20.125 28.1 28.139999999999997 23.635 65-69 19.8 28.505000000000003 27.93 23.765 70-74 20.57 28.42 27.24 23.77 75-79 19.645000000000003 28.310000000000002 28.12 23.925 80-84 19.29 28.64 27.665 24.404999999999998 85-89 20.305 28.689999999999998 27.27 23.735 90-94 20.16 28.65 27.405 23.785 95-99 19.96 28.185 28.15 23.705000000000002 100-104 19.98 28.27 28.134999999999998 23.615 105-109 20.474999999999998 28.53 27.505000000000003 23.49 110-114 20.355 28.435 27.935 23.275000000000002 115-119 20.115 28.470000000000002 27.534999999999997 23.880000000000003 120-124 20.82 28.494999999999997 27.095000000000002 23.59 125-129 20.515 28.255000000000003 27.315 23.915 130-134 20.990000000000002 28.88 26.279999999999998 23.849999999999998 135-139 20.785 28.705000000000002 26.69 23.82 140-144 21.235 28.67 26.525 23.57 145-149 20.905 29.104999999999997 26.369999999999997 23.62 150-151 20.1875 28.237499999999997 26.387500000000003 25.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 2.5 25 4.5 26 2.5 27 3.5 28 8.0 29 13.0 30 16.5 31 23.5 32 35.5 33 48.5 34 59.5 35 66.5 36 83.5 37 113.5 38 149.5 39 193.0 40 205.0 41 207.0 42 241.5 43 270.5 44 274.0 45 261.0 46 264.0 47 258.5 48 232.5 49 202.5 50 172.0 51 143.5 52 103.5 53 77.5 54 69.5 55 56.5 56 39.5 57 26.5 58 16.5 59 12.5 60 11.0 61 7.0 62 6.0 63 4.0 64 1.0 65 2.0 66 2.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.0875 0.0 0.0 0.025 0.0 84-85 0.1375 0.0 0.0 0.025 0.0 86-87 0.225 0.0 0.0 0.025 0.0 88-89 0.30000000000000004 0.0 0.0 0.025 0.0 90-91 0.35 0.0 0.0 0.025 0.0 92-93 0.42500000000000004 0.0 0.0 0.025 0.0 94-95 0.5875 0.0 0.0 0.025 0.0 96-97 0.7250000000000001 0.0 0.0 0.025 0.0 98-99 0.9875 0.0 0.0 0.025 0.0 100-101 1.1124999999999998 0.0 0.0 0.025 0.0 102-103 1.3 0.0 0.0 0.025 0.0 104-105 1.675 0.0 0.0 0.025 0.0 106-107 2.0875 0.0 0.0 0.025 0.0 108-109 2.45 0.0 0.0 0.025 0.0 110-111 2.8 0.0 0.0 0.025 0.0 112-113 3.1500000000000004 0.0 0.0 0.025 0.0 114-115 3.5 0.0 0.0 0.025 0.0 116-117 3.875 0.0 0.0 0.025 0.0 118-119 4.4875 0.0 0.0 0.025 0.0 120-121 5.075 0.0 0.0 0.025 0.0 122-123 5.5125 0.0 0.0 0.025 0.0 124-125 6.1 0.0 0.0 0.025 0.0 126-127 6.525 0.0 0.0 0.025 0.0 128-129 7.0375 0.0 0.0 0.025 0.0 130-131 7.625 0.0 0.0 0.025 0.0 132-133 8.0875 0.0 0.0 0.025 0.0 134-135 8.7125 0.0 0.0 0.025 0.0 136-137 9.3125 0.0 0.0 0.025 0.0 138-139 9.975 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCCA 10 0.0068343505 144.975 4 CTGGATC 10 0.0068343505 144.975 2 ATTAAAG 10 0.0068343505 144.975 6 >>END_MODULE SRR7168862 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67425 33.0 33.0 34.0 32.0 34.0 2 32.7945 33.0 33.0 34.0 32.0 34.0 3 32.806 33.0 33.0 34.0 31.0 34.0 4 32.808 34.0 33.0 34.0 32.0 34.0 5 32.739 33.0 33.0 34.0 32.0 34.0 6 36.954 38.0 38.0 38.0 36.0 38.0 7 36.93725 38.0 38.0 38.0 36.0 38.0 8 36.9165 38.0 38.0 38.0 36.0 38.0 9 36.98025 38.0 38.0 38.0 36.0 38.0 10-14 36.93045000000001 38.0 38.0 38.0 36.4 38.0 15-19 36.90005 38.0 38.0 38.0 36.0 38.0 20-24 36.93555 38.0 38.0 38.0 36.2 38.0 25-29 36.90335 38.0 38.0 38.0 36.0 38.0 30-34 36.901149999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.878699999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.86445 38.0 38.0 38.0 36.2 38.0 45-49 36.74490000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.7046 38.0 38.0 38.0 36.0 38.0 55-59 36.6019 38.0 38.0 38.0 35.4 38.0 60-64 36.668099999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.56035 38.0 38.0 38.0 35.2 38.0 70-74 36.46685000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.2971 38.0 38.0 38.0 34.0 38.0 80-84 36.22935 38.0 38.0 38.0 34.0 38.0 85-89 36.137649999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.1179 38.0 38.0 38.0 34.0 38.0 95-99 35.96755 38.0 38.0 38.0 33.6 38.0 100-104 35.9458 38.0 38.0 38.0 33.2 38.0 105-109 35.77139999999999 38.0 37.6 38.0 32.6 38.0 110-114 35.6512 38.0 37.0 38.0 31.4 38.0 115-119 35.429199999999994 38.0 37.0 38.0 30.6 38.0 120-124 35.201649999999994 38.0 36.4 38.0 29.6 38.0 125-129 34.987899999999996 38.0 36.0 38.0 28.0 38.0 130-134 34.4851 38.0 35.4 38.0 25.6 38.0 135-139 33.83175 38.0 34.6 38.0 21.8 38.0 140-144 33.164899999999996 38.0 33.4 38.0 14.6 38.0 145-149 32.10855 38.0 32.8 38.0 8.6 38.0 150-151 26.968875 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 4.0 5 2.0 6 4.0 7 2.0 8 2.0 9 3.0 10 4.0 11 3.0 12 4.0 13 4.0 14 4.0 15 2.0 16 1.0 17 7.0 18 2.0 19 8.0 20 9.0 21 17.0 22 11.0 23 14.0 24 19.0 25 17.0 26 22.0 27 25.0 28 30.0 29 46.0 30 42.0 31 82.0 32 70.0 33 86.0 34 160.0 35 258.0 36 589.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2 19.650000000000002 17.224999999999998 28.925 2 27.150000000000002 25.775 31.525 15.55 3 21.8 28.675 29.875 19.650000000000002 4 23.35 35.725 23.025000000000002 17.9 5 25.124999999999996 35.925000000000004 22.175 16.775000000000002 6 19.125 38.1 25.025 17.75 7 19.0 19.525000000000002 41.875 19.6 8 23.425 23.724999999999998 28.225 24.625 9 23.400000000000002 24.8 29.75 22.05 10-14 23.845 28.95 26.479999999999997 20.724999999999998 15-19 23.1 28.355000000000004 27.77 20.775 20-24 23.195 27.62 28.49 20.695 25-29 22.98 28.225 27.644999999999996 21.15 30-34 22.275 28.860000000000003 27.93 20.935000000000002 35-39 23.015 27.994999999999997 28.194999999999997 20.794999999999998 40-44 23.265 27.779999999999998 28.025 20.93 45-49 23.29 27.77 27.435 21.505 50-54 23.115 28.189999999999998 27.825 20.87 55-59 23.86 27.05 28.23 20.86 60-64 23.445 28.03 28.015 20.51 65-69 23.330000000000002 27.66 27.61 21.4 70-74 23.72 27.24 28.165000000000003 20.875 75-79 23.53 27.42 28.32 20.73 80-84 23.28 28.439999999999998 27.744999999999997 20.535 85-89 23.575 27.355 28.51 20.560000000000002 90-94 23.630000000000003 28.07 28.060000000000002 20.24 95-99 23.57 27.735 27.51 21.185000000000002 100-104 23.82 27.694999999999997 28.095 20.39 105-109 24.104999999999997 27.950000000000003 28.12 19.825 110-114 24.055 28.07 28.08 19.794999999999998 115-119 24.815 27.575 27.310000000000002 20.3 120-124 24.310000000000002 27.96 27.794999999999998 19.935 125-129 25.624999999999996 27.944999999999997 27.139999999999997 19.29 130-134 24.803720558083715 27.909186377956697 27.60914137120568 19.677951692753915 135-139 25.430000000000003 27.560000000000002 27.400000000000002 19.61 140-144 25.485000000000003 27.855 27.08 19.580000000000002 145-149 25.72 28.03 27.205000000000002 19.045 150-151 26.2875 28.225 26.5 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 0.5 18 1.5 19 2.0 20 1.0 21 2.0 22 1.5 23 0.5 24 1.0 25 1.0 26 1.0 27 3.0 28 6.5 29 11.5 30 17.5 31 20.5 32 22.0 33 29.5 34 40.0 35 55.5 36 81.0 37 111.5 38 132.5 39 156.5 40 200.5 41 237.0 42 255.5 43 265.5 44 286.5 45 295.0 46 274.0 47 239.0 48 224.0 49 212.5 50 172.5 51 150.5 52 122.0 53 90.5 54 75.0 55 59.5 56 36.5 57 20.0 58 21.5 59 19.5 60 11.0 61 6.5 62 8.5 63 5.5 64 1.5 65 0.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.725 0.0 0.0 0.0 0.0 112-113 3.0999999999999996 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.9625 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.887499999999999 0.0 0.0 0.0 0.0 126-127 6.3 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.35 0.0 0.0 0.0 0.0 132-133 7.825 0.0 0.0 0.0 0.0 134-135 8.425 0.0 0.0 0.0 0.0 136-137 9.05 0.0 0.0 0.0 0.0 138-139 9.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873801 spots for SRR7168862.sra Written 873801 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra Read 873795 spots for SRR7168862.sra Written 873795 spots for SRR7168862.sra SRR ids: ['SRR7168862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__bmudo1h SRR7168862.sra spots: 17475906 blocks: [[1, 873795], [873796, 1747590], [1747591, 2621385], [2621386, 3495180], [3495181, 4368975], [4368976, 5242770], [5242771, 6116565], [6116566, 6990360], [6990361, 7864155], [7864156, 8737950], [8737951, 9611745], [9611746, 10485540], [10485541, 11359335], [11359336, 12233130], [12233131, 13106925], [13106926, 13980720], [13980721, 14854515], [14854516, 15728310], [15728311, 16602105], [16602106, 17475906]] SRR7168862 file size 5900310 SRR7168862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168862 SRR7168862_1.fastq SRR7168862_2.fastq Input file: SRR7168862_1.fastq Paired file: SRR7168862_2.fastq trimmed: SRR7168862-trimmed-pair1.fastq, SRR7168862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 13:08:15 2025 >> started Sat Feb 15 13:15:59 2025 >> done (463.662s) 17475906 read pairs processed; of these: 25586 ( 0.15%) short read pairs filtered out after trimming by size control 30996 ( 0.18%) empty read pairs filtered out after trimming by size control 17419324 (99.68%) read pairs available; of these: 10077206 (57.85%) trimmed read pairs available after processing 7342118 (42.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 16 0.00% 25 4 0.00% 26 10 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 18 0.00% 31 7 0.00% 32 15 0.00% 33 13 0.00% 34 10 0.00% 35 21 0.00% 36 14 0.00% 37 18 0.00% 38 23 0.00% 39 28 0.00% 40 23 0.00% 41 38 0.00% 42 38 0.00% 43 49 0.00% 44 48 0.00% 45 50 0.00% 46 52 0.00% 47 79 0.00% 48 93 0.00% 49 101 0.00% 50 100 0.00% 51 151 0.00% 52 142 0.00% 53 144 0.00% 54 202 0.00% 55 187 0.00% 56 244 0.00% 57 241 0.00% 58 290 0.00% 59 308 0.00% 60 345 0.00% 61 433 0.00% 62 476 0.00% 63 543 0.00% 64 621 0.00% 65 738 0.00% 66 809 0.00% 67 937 0.01% 68 1058 0.01% 69 1875 0.01% 70 1881 0.01% 71 1524 0.01% 72 1681 0.01% 73 1794 0.01% 74 2136 0.01% 75 2448 0.01% 76 2673 0.02% 77 2968 0.02% 78 3215 0.02% 79 3778 0.02% 80 4142 0.02% 81 4743 0.03% 82 5317 0.03% 83 6248 0.04% 84 7516 0.04% 85 8657 0.05% 86 9354 0.05% 87 10111 0.06% 88 11213 0.06% 89 11499 0.07% 90 12259 0.07% 91 13245 0.08% 92 14556 0.08% 93 15791 0.09% 94 16501 0.09% 95 18007 0.10% 96 19045 0.11% 97 20431 0.12% 98 20996 0.12% 99 22292 0.13% 100 23663 0.14% 101 24780 0.14% 102 26328 0.15% 103 27711 0.16% 104 29193 0.17% 105 31436 0.18% 106 32689 0.19% 107 33969 0.20% 108 34485 0.20% 109 36680 0.21% 110 37483 0.22% 111 39086 0.22% 112 40579 0.23% 113 42649 0.24% 114 44625 0.26% 115 46159 0.26% 116 47796 0.27% 117 49521 0.28% 118 51159 0.29% 119 51851 0.30% 120 54128 0.31% 121 55458 0.32% 122 57270 0.33% 123 59805 0.34% 124 62164 0.36% 125 64836 0.37% 126 67080 0.39% 127 69392 0.40% 128 71348 0.41% 129 73902 0.42% 130 75883 0.44% 131 78828 0.45% 132 81558 0.47% 133 86264 0.50% 134 90225 0.52% 135 94721 0.54% 136 100169 0.58% 137 105402 0.61% 138 111832 0.64% 139 119078 0.68% 140 126831 0.73% 141 137613 0.79% 142 150586 0.86% 143 166827 0.96% 144 190518 1.09% 145 223352 1.28% 146 276373 1.59% 147 365183 2.10% 148 531418 3.05% 149 1006927 5.78% 150 4283707 24.59% 151 7342118 42.15% 17419324 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=2.2 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=51.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=16 prefix-density=0.41 prefix-fanout=2.9 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=37.24 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR7168862 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 14:13:38 Started mapping on | Feb 15 14:13:56 Finished on | Feb 15 15:56:43 Mapping speed, Million of reads per hour | 10.17 Number of input reads | 17419324 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16149170 Uniquely mapped reads % | 92.71% Average mapped length | 290.11 Number of splices: Total | 15530013 Number of splices: Annotated (sjdb) | 15143129 Number of splices: GT/AG | 15246456 Number of splices: GC/AG | 222725 Number of splices: AT/AC | 9835 Number of splices: Non-canonical | 50997 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480671 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 67099 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811855 811855 811855 N_multimapping 480671 480671 480671 N_noFeature 550723 15804758 731131 N_ambiguous 294147 1773 128936 UnstrandedReadsAssigned:15304300 PositiveStrandReadsAssigned:342639 NegativeStrandReadsAssigned:15289103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168862-trimmed-pair1.fastq SRR7168862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,419,324 reads, 15,295,200 reads pseudoaligned [quant] estimated average fragment length: 226.677 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7168862.ke.tsv 34699 SRR7168862.se.tsv 87100 total ==> SRR7168862.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.32 1522 51.6652 Potri.005G024800.1.v4.1 1035 809.323 376 28.2661 Potri.004G059700.1.v4.1 961 735.37 11 0.910094 Potri.007G009000.2.v4.1 1416 1190.32 0 0 Potri.003G141000.2.v4.1 2943 2717.32 891.398 19.9586 Potri.016G087400.1.v4.1 270 89.1145 1084 740.082 Potri.015G069301.1.v4.1 564 342.683 0 0 Potri.010G195200.1.v4.1 1773 1547.32 527.933 20.7586 Potri.012G127500.1.v4.1 977 751.339 131 10.608 ==> SRR7168862.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 323 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 88 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7168862 completed mapping pipeline successfully