Starting /dee2/code/volunteer_pipeline.sh SRR7168863 current disk space = 3092424159232 free memory = 1449704936 SRR7168863 SRAfilesize 45bd915da9029ec666690596a755460c SRR7168863.sra SRR7168863.sra file validated SRR7168863 is paired end SRR7168863 is conventional basespace SRR7168863 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2145 34.0 33.0 34.0 32.0 34.0 2 33.251 34.0 33.0 34.0 32.0 34.0 3 33.365 34.0 33.0 34.0 32.0 34.0 4 33.42925 34.0 33.0 34.0 33.0 34.0 5 33.45575 34.0 34.0 34.0 33.0 34.0 6 37.21325 38.0 38.0 38.0 36.0 38.0 7 37.44 38.0 38.0 38.0 37.0 38.0 8 37.50475 38.0 38.0 38.0 37.0 38.0 9 37.511 38.0 38.0 38.0 37.0 38.0 10-14 37.53189999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.5244 38.0 38.0 38.0 37.6 38.0 20-24 37.442949999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.38525 38.0 38.0 38.0 37.0 38.0 30-34 37.46165 38.0 38.0 38.0 37.4 38.0 35-39 37.44199999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.445299999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.385200000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.41940000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.3367 38.0 38.0 38.0 37.0 38.0 60-64 37.300200000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.253 38.0 38.0 38.0 36.8 38.0 70-74 37.1383 38.0 38.0 38.0 36.2 38.0 75-79 37.09439999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.991 38.0 38.0 38.0 36.0 38.0 85-89 37.0009 38.0 38.0 38.0 36.0 38.0 90-94 36.8482 38.0 38.0 38.0 35.6 38.0 95-99 36.771300000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.72425 38.0 38.0 38.0 34.8 38.0 105-109 36.63195 38.0 38.0 38.0 34.2 38.0 110-114 36.489250000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.28060000000001 38.0 38.0 38.0 33.8 38.0 120-124 36.08645 38.0 37.2 38.0 33.0 38.0 125-129 35.908500000000004 38.0 37.0 38.0 32.4 38.0 130-134 35.45805 38.0 36.2 38.0 30.0 38.0 135-139 35.36765 38.0 36.0 38.0 31.0 38.0 140-144 34.774 38.0 35.4 38.0 28.0 38.0 145-149 33.91175 38.0 33.0 38.0 24.4 38.0 150-151 29.36025 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 4.0 19 2.0 20 3.0 21 3.0 22 5.0 23 5.0 24 9.0 25 13.0 26 19.0 27 15.0 28 24.0 29 27.0 30 33.0 31 54.0 32 51.0 33 114.0 34 127.0 35 216.0 36 577.0 37 2698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.50325775345322 12.32733906697941 11.102423768569194 39.06697941099818 2 21.375 18.224999999999998 34.25 26.150000000000002 3 19.2 23.45 25.025 32.324999999999996 4 22.6 32.800000000000004 21.725 22.875 5 22.241681260945708 35.326494871153365 23.767825869402053 18.663997998498875 6 17.825 36.4 25.4 20.375 7 14.000000000000002 23.549999999999997 44.15 18.3 8 17.299999999999997 24.349999999999998 31.674999999999997 26.674999999999997 9 15.8 25.45 33.675 25.074999999999996 10-14 19.545 29.985 26.855 23.615 15-19 19.585 28.744999999999997 28.355000000000004 23.315 20-24 19.139999999999997 29.255 28.21 23.395 25-29 19.97 28.825 28.07 23.135 30-34 19.425 28.925 28.189999999999998 23.46 35-39 20.16 28.845 27.725 23.27 40-44 20.265 29.294999999999998 27.605 22.835 45-49 19.685 28.83 28.335 23.150000000000002 50-54 19.985 29.544999999999998 27.474999999999998 22.994999999999997 55-59 19.82 28.675 27.839999999999996 23.665 60-64 20.495 28.655 27.88 22.97 65-69 19.81 28.895 27.91 23.385 70-74 19.935 29.42 27.439999999999998 23.205000000000002 75-79 19.765 28.525 27.97 23.74 80-84 19.78 28.860000000000003 27.865000000000002 23.494999999999997 85-89 20.65 28.395 27.839999999999996 23.115 90-94 20.169999999999998 28.975 27.534999999999997 23.32 95-99 20.68 28.360000000000003 27.98 22.98 100-104 20.25 28.765 28.415000000000003 22.57 105-109 20.51 28.48 27.415 23.595 110-114 20.365 28.98 27.775 22.88 115-119 20.22 28.505000000000003 27.74 23.535 120-124 20.405 28.585 27.229999999999997 23.78 125-129 20.64 28.205000000000002 27.529999999999998 23.625 130-134 20.035 28.73 27.165 24.07 135-139 20.325 28.499999999999996 27.400000000000002 23.775 140-144 20.830000000000002 28.27 27.139999999999997 23.76 145-149 20.825 28.465 26.8 23.91 150-151 19.371399949912345 28.261958427247684 27.73603806661658 24.63060355622339 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 3.5 24 3.5 25 4.5 26 7.0 27 8.0 28 13.5 29 18.5 30 23.5 31 28.5 32 35.5 33 50.5 34 69.0 35 83.0 36 95.5 37 129.5 38 151.5 39 161.5 40 197.5 41 235.0 42 255.0 43 268.0 44 274.5 45 263.5 46 257.0 47 233.0 48 210.5 49 198.0 50 163.5 51 125.5 52 97.0 53 76.5 54 58.5 55 56.0 56 42.5 57 25.5 58 19.5 59 12.5 60 9.0 61 6.5 62 5.5 63 4.0 64 2.5 65 1.5 66 1.5 67 2.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.1 0.0 0.0 0.0 0.0 106-107 2.4625000000000004 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.4125 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.45 0.0 0.0 0.0 0.0 124-125 5.775 0.0 0.0 0.0 0.0 126-127 6.15 0.0 0.0 0.0 0.0 128-129 6.65 0.0 0.0 0.0 0.0 130-131 7.0 0.0 0.0 0.0 0.0 132-133 7.637499999999999 0.0 0.0 0.0 0.0 134-135 8.287500000000001 0.0 0.0 0.0 0.0 136-137 8.975000000000001 0.0 0.0 0.0 0.0 138-139 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATGC 10 0.006090368 150.5974 1 ATATGGA 10 0.006582306 146.7848 145 CCAGCTC 10 0.0068378756 144.95 8 >>END_MODULE SRR7168863 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.883 33.0 33.0 34.0 32.0 34.0 2 32.955 34.0 33.0 34.0 32.0 34.0 3 32.97475 34.0 33.0 34.0 32.0 34.0 4 32.972 34.0 33.0 34.0 32.0 34.0 5 32.98675 34.0 33.0 34.0 33.0 34.0 6 37.14025 38.0 38.0 38.0 37.0 38.0 7 37.24425 38.0 38.0 38.0 37.0 38.0 8 37.1545 38.0 38.0 38.0 37.0 38.0 9 37.1615 38.0 38.0 38.0 37.0 38.0 10-14 37.121 38.0 38.0 38.0 37.0 38.0 15-19 37.12185 38.0 38.0 38.0 37.0 38.0 20-24 37.0628 38.0 38.0 38.0 37.0 38.0 25-29 36.97965000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.019549999999995 38.0 38.0 38.0 36.8 38.0 35-39 36.961850000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.911950000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.841699999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.762 38.0 38.0 38.0 35.8 38.0 55-59 36.64465 38.0 38.0 38.0 35.4 38.0 60-64 36.540350000000004 38.0 38.0 38.0 34.6 38.0 65-69 36.5147 38.0 38.0 38.0 34.6 38.0 70-74 36.44395000000001 38.0 38.0 38.0 34.2 38.0 75-79 36.3061 38.0 38.0 38.0 34.0 38.0 80-84 36.101749999999996 38.0 38.0 38.0 33.6 38.0 85-89 35.87095000000001 38.0 38.0 38.0 32.6 38.0 90-94 35.66904999999999 38.0 37.0 38.0 31.2 38.0 95-99 35.436749999999996 38.0 37.0 38.0 29.8 38.0 100-104 35.2158 38.0 36.8 38.0 28.6 38.0 105-109 35.226 38.0 36.8 38.0 28.6 38.0 110-114 34.8831 38.0 36.2 38.0 27.0 38.0 115-119 34.464600000000004 38.0 35.2 38.0 25.2 38.0 120-124 34.033500000000004 38.0 34.8 38.0 23.0 38.0 125-129 33.75285 38.0 34.4 38.0 22.2 38.0 130-134 32.961299999999994 38.0 33.6 38.0 14.8 38.0 135-139 31.8898 38.0 31.4 38.0 13.0 38.0 140-144 31.084500000000002 38.0 30.4 38.0 10.4 38.0 145-149 29.533599999999996 36.4 27.4 38.0 2.0 38.0 150-151 24.203375 31.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 3.0 5 1.0 6 0.0 7 1.0 8 0.0 9 3.0 10 1.0 11 0.0 12 5.0 13 5.0 14 5.0 15 7.0 16 7.0 17 7.0 18 11.0 19 12.0 20 18.0 21 18.0 22 20.0 23 18.0 24 22.0 25 27.0 26 31.0 27 34.0 28 36.0 29 60.0 30 58.0 31 71.0 32 98.0 33 143.0 34 221.0 35 356.0 36 780.0 37 1911.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.6720901126408 18.873591989987485 15.519399249061328 27.934918648310386 2 26.114171256885328 26.114171256885328 32.198297446169256 15.573360040060091 3 20.630946419629446 29.29394091136705 30.020030045067603 20.055082623935906 4 24.161241862794192 35.327991987981974 22.658988482724084 17.85177766649975 5 24.887330996494743 36.429644466700054 21.507260891337005 17.175763645468205 6 18.798498122653317 38.44806007509386 24.58072590738423 18.172715894868585 7 18.172715894868585 19.924906132665832 41.32665832290363 20.575719649561954 8 20.575719649561954 25.33166458072591 28.46057571964956 25.632040050062578 9 21.952440550688358 24.705882352941178 30.387984981226534 22.95369211514393 10-14 22.82510761838022 28.89178095905496 26.79947942737011 21.483631995194713 15-19 22.257822277847307 29.141426783479353 27.939924906132667 20.660826032540676 20-24 22.585490412056274 28.623641916587395 28.03785109898363 20.753016572372704 25-29 22.625544485054824 28.30320933259901 28.643668953086664 20.4275772292595 30-34 22.57047013468182 27.89766184348871 28.984128573574324 20.547739448255147 35-39 22.62393590385578 28.532799198798198 27.936905358037055 20.906359539308962 40-44 22.98027830613675 27.725498047852636 28.93182500750826 20.362398638502352 45-49 22.3868642370845 27.77332799359231 29.275130156187423 20.564677613135764 50-54 23.04149772238074 27.892075887270362 28.512789708164387 20.55363668218451 55-59 23.175127665965757 27.69099829778712 28.467007109242015 20.666866927005106 60-64 23.090399439383322 27.79557513264591 28.31614776253879 20.797877665431976 65-69 23.27491236855283 28.27240861291938 28.402603905858786 20.050075112669003 70-74 22.922090927298218 28.049268976567195 28.52994191868616 20.498698177448425 75-79 22.843122527665113 27.670121676430824 28.87186420309449 20.614891592809574 80-84 22.95328225927595 27.529918381653395 28.566421310900807 20.950378048169846 85-89 23.296108968901798 28.399018478641896 28.223746807551702 20.0811257449046 90-94 23.42044658055472 27.831180534695104 28.366876940022028 20.381495944728147 95-99 23.60979027979378 28.640072075679463 27.969367836228038 19.780769808298714 100-104 23.671038141956153 27.720492541795977 28.35118630493543 20.257283011312445 105-109 23.577113680732843 28.472743655203487 28.012214046153076 19.937928617910597 110-114 24.00620807049164 28.00640833083008 27.986382296986083 20.0010013016922 115-119 23.44164622240024 28.65868923046112 27.96775647123617 19.93190807590247 120-124 24.350307946522456 28.541385008261983 27.474838515847978 19.633468529367583 125-129 24.175053828050675 28.586450353011866 27.61003455009764 19.628461268839818 130-134 24.611917876815223 28.00701051577366 27.896845267901853 19.484226339509263 135-139 24.59689534301452 28.382573860791187 27.29594391587381 19.72458688032048 140-144 24.591969560428556 28.792430159206965 26.95003504555923 19.665565234805246 145-149 24.67584480600751 28.570713391739677 27.3441802252816 19.409261576971215 150-151 25.64102564102564 27.604752970606626 26.91682301438399 19.83739837398374 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 2.5 23 2.5 24 1.0 25 0.5 26 4.0 27 5.5 28 13.0 29 18.5 30 17.5 31 23.5 32 38.0 33 48.0 34 58.5 35 73.0 36 88.5 37 123.0 38 154.5 39 183.5 40 220.0 41 246.0 42 264.0 43 278.5 44 272.0 45 257.0 46 238.5 47 222.5 48 208.5 49 191.5 50 171.5 51 133.0 52 101.5 53 80.5 54 68.0 55 53.0 56 31.0 57 27.5 58 23.5 59 14.0 60 11.0 61 7.5 62 5.5 63 3.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.15 4 0.15 5 0.15 6 0.125 7 0.125 8 0.125 9 0.125 10-14 0.11 15-19 0.125 20-24 0.135 25-29 0.135 30-34 0.135 35-39 0.15 40-44 0.11 45-49 0.12 50-54 0.11499999999999999 55-59 0.13 60-64 0.11 65-69 0.15 70-74 0.13999999999999999 75-79 0.145 80-84 0.145 85-89 0.155 90-94 0.13 95-99 0.105 100-104 0.11 105-109 0.11499999999999999 110-114 0.13 115-119 0.135 120-124 0.145 125-129 0.145 130-134 0.15 135-139 0.15 140-144 0.13 145-149 0.125 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.17574692442882248 0.35000000000000003 3 0.05021340697966357 0.15 4 0.05021340697966357 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.5875 0.0 0.0 0.0 0.0 114-115 4.0375 0.0 0.0 0.0 0.0 116-117 4.512499999999999 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.2125 0.0 0.0 0.0 0.0 122-123 5.6 0.0 0.0 0.0 0.0 124-125 5.875 0.0 0.0 0.0 0.0 126-127 6.225 0.0 0.0 0.0 0.0 128-129 6.737500000000001 0.0 0.0 0.0 0.0 130-131 7.025 0.0 0.0 0.0 0.0 132-133 7.65 0.0 0.0 0.0 0.0 134-135 8.287500000000001 0.0 0.0 0.0 0.0 136-137 8.9625 0.0 0.0 0.0 0.0 138-139 9.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777178 spots for SRR7168863.sra Written 777178 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra Read 777177 spots for SRR7168863.sra Written 777177 spots for SRR7168863.sra SRR ids: ['SRR7168863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gwmcdvcw SRR7168863.sra spots: 15543541 blocks: [[1, 777177], [777178, 1554354], [1554355, 2331531], [2331532, 3108708], [3108709, 3885885], [3885886, 4663062], [4663063, 5440239], [5440240, 6217416], [6217417, 6994593], [6994594, 7771770], [7771771, 8548947], [8548948, 9326124], [9326125, 10103301], [10103302, 10880478], [10880479, 11657655], [11657656, 12434832], [12434833, 13212009], [13212010, 13989186], [13989187, 14766363], [14766364, 15543541]] SRR7168863 file size 5245495 SRR7168863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168863 SRR7168863_1.fastq SRR7168863_2.fastq Input file: SRR7168863_1.fastq Paired file: SRR7168863_2.fastq trimmed: SRR7168863-trimmed-pair1.fastq, SRR7168863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 09:25:32 2025 >> started Sat Feb 15 09:25:58 2025 >> done (26.751s) 15543541 read pairs processed; of these: 16161 ( 0.10%) short read pairs filtered out after trimming by size control 36852 ( 0.24%) empty read pairs filtered out after trimming by size control 15490528 (99.66%) read pairs available; of these: 8769848 (56.61%) trimmed read pairs available after processing 6720680 (43.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 6 0.00% 21 5 0.00% 22 3 0.00% 23 7 0.00% 24 5 0.00% 25 10 0.00% 26 7 0.00% 27 8 0.00% 28 1 0.00% 29 10 0.00% 30 11 0.00% 31 13 0.00% 32 16 0.00% 33 8 0.00% 34 23 0.00% 35 15 0.00% 36 24 0.00% 37 22 0.00% 38 18 0.00% 39 26 0.00% 40 30 0.00% 41 44 0.00% 42 54 0.00% 43 52 0.00% 44 57 0.00% 45 68 0.00% 46 81 0.00% 47 100 0.00% 48 109 0.00% 49 115 0.00% 50 129 0.00% 51 162 0.00% 52 191 0.00% 53 237 0.00% 54 249 0.00% 55 257 0.00% 56 281 0.00% 57 330 0.00% 58 352 0.00% 59 434 0.00% 60 438 0.00% 61 544 0.00% 62 611 0.00% 63 726 0.00% 64 782 0.01% 65 909 0.01% 66 943 0.01% 67 1177 0.01% 68 1470 0.01% 69 2397 0.02% 70 2317 0.01% 71 2018 0.01% 72 2134 0.01% 73 2432 0.02% 74 2664 0.02% 75 2933 0.02% 76 3248 0.02% 77 3574 0.02% 78 3951 0.03% 79 4397 0.03% 80 4975 0.03% 81 5564 0.04% 82 6202 0.04% 83 6899 0.04% 84 8111 0.05% 85 8788 0.06% 86 9465 0.06% 87 10180 0.07% 88 11076 0.07% 89 11726 0.08% 90 12612 0.08% 91 13807 0.09% 92 14708 0.09% 93 16047 0.10% 94 17023 0.11% 95 18352 0.12% 96 18731 0.12% 97 20100 0.13% 98 20830 0.13% 99 21698 0.14% 100 22989 0.15% 101 24167 0.16% 102 25565 0.17% 103 26814 0.17% 104 27814 0.18% 105 29821 0.19% 106 30846 0.20% 107 31365 0.20% 108 31967 0.21% 109 33503 0.22% 110 34618 0.22% 111 36041 0.23% 112 37532 0.24% 113 38261 0.25% 114 40060 0.26% 115 42146 0.27% 116 42659 0.28% 117 43722 0.28% 118 44940 0.29% 119 46221 0.30% 120 47523 0.31% 121 49164 0.32% 122 50365 0.33% 123 52947 0.34% 124 54576 0.35% 125 56524 0.36% 126 58992 0.38% 127 60239 0.39% 128 61745 0.40% 129 64774 0.42% 130 66789 0.43% 131 68515 0.44% 132 71565 0.46% 133 74833 0.48% 134 77757 0.50% 135 82325 0.53% 136 86246 0.56% 137 91200 0.59% 138 97020 0.63% 139 103217 0.67% 140 109785 0.71% 141 118015 0.76% 142 129857 0.84% 143 144730 0.93% 144 165284 1.07% 145 194004 1.25% 146 238036 1.54% 147 311795 2.01% 148 454995 2.94% 149 847402 5.47% 150 3688434 23.81% 151 6720680 43.39% 15490528 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=30.90 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=68.74 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.9 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7168863 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 09:27:41 Started mapping on | Feb 15 09:27:41 Finished on | Feb 15 09:29:55 Mapping speed, Million of reads per hour | 416.16 Number of input reads | 15490528 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14427261 Uniquely mapped reads % | 93.14% Average mapped length | 289.56 Number of splices: Total | 13396804 Number of splices: Annotated (sjdb) | 13028898 Number of splices: GT/AG | 13136736 Number of splices: GC/AG | 202588 Number of splices: AT/AC | 8542 Number of splices: Non-canonical | 48938 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415498 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 73930 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660108 660108 660108 N_multimapping 415498 415498 415498 N_noFeature 735391 14058939 966316 N_ambiguous 255842 1925 116941 UnstrandedReadsAssigned:13436028 PositiveStrandReadsAssigned:366397 NegativeStrandReadsAssigned:13344004 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168863-trimmed-pair1.fastq SRR7168863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,490,528 reads, 13,339,822 reads pseudoaligned [quant] estimated average fragment length: 228.368 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7168863.ke.tsv 34699 SRR7168863.se.tsv 87100 total ==> SRR7168863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.63 944 39.313 Potri.005G024800.1.v4.1 1035 807.632 209 19.2976 Potri.004G059700.1.v4.1 961 733.675 1 0.10164 Potri.007G009000.2.v4.1 1416 1188.63 0 0 Potri.003G141000.2.v4.1 2943 2715.63 920.707 25.2826 Potri.016G087400.1.v4.1 270 90.2941 860 710.247 Potri.015G069301.1.v4.1 564 341.284 0 0 Potri.010G195200.1.v4.1 1773 1545.63 56 2.7018 Potri.012G127500.1.v4.1 977 749.643 120 11.9371 ==> SRR7168863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 461 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 4 SRR7168863 completed mapping pipeline successfully