Starting /dee2/code/volunteer_pipeline.sh SRR7168864 current disk space = 3092129021952 free memory = 1479865876 SRR7168864 SRAfilesize af386785de9e5c966993176e4a092e3c SRR7168864.sra SRR7168864.sra file validated SRR7168864 is paired end SRR7168864 is conventional basespace SRR7168864 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.032 34.0 33.0 34.0 32.0 34.0 2 33.10925 34.0 33.0 34.0 32.0 34.0 3 33.2315 34.0 33.0 34.0 32.0 34.0 4 33.35 34.0 33.0 34.0 33.0 34.0 5 33.3695 34.0 33.0 34.0 33.0 34.0 6 37.13325 38.0 38.0 38.0 36.0 38.0 7 37.3305 38.0 38.0 38.0 36.0 38.0 8 37.423 38.0 38.0 38.0 37.0 38.0 9 37.44325 38.0 38.0 38.0 37.0 38.0 10-14 37.46665 38.0 38.0 38.0 37.0 38.0 15-19 37.4621 38.0 38.0 38.0 37.0 38.0 20-24 37.43545 38.0 38.0 38.0 37.0 38.0 25-29 37.38845 38.0 38.0 38.0 37.0 38.0 30-34 37.3851 38.0 38.0 38.0 37.0 38.0 35-39 37.34705 38.0 38.0 38.0 37.0 38.0 40-44 37.3396 38.0 38.0 38.0 37.0 38.0 45-49 37.28875000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.28035 38.0 38.0 38.0 37.0 38.0 55-59 37.1751 38.0 38.0 38.0 36.4 38.0 60-64 37.155950000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.1357 38.0 38.0 38.0 36.2 38.0 70-74 37.09355 38.0 38.0 38.0 36.0 38.0 75-79 37.08005 38.0 38.0 38.0 36.0 38.0 80-84 36.9637 38.0 38.0 38.0 36.0 38.0 85-89 36.891600000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.7324 38.0 38.0 38.0 35.0 38.0 95-99 36.5574 38.0 38.0 38.0 34.4 38.0 100-104 36.49250000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.317 38.0 38.0 38.0 34.0 38.0 110-114 36.27075 38.0 37.8 38.0 34.0 38.0 115-119 35.93605 38.0 37.0 38.0 32.2 38.0 120-124 35.73035 38.0 37.0 38.0 31.0 38.0 125-129 35.49905 38.0 36.2 38.0 31.0 38.0 130-134 35.169250000000005 38.0 36.0 38.0 29.6 38.0 135-139 34.735749999999996 38.0 35.6 38.0 28.0 38.0 140-144 34.12425 38.0 33.8 38.0 25.4 38.0 145-149 32.96175 38.0 33.0 38.0 16.8 38.0 150-151 27.935125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 1.0 17 2.0 18 2.0 19 2.0 20 3.0 21 6.0 22 7.0 23 8.0 24 12.0 25 16.0 26 15.0 27 22.0 28 30.0 29 32.0 30 48.0 31 52.0 32 73.0 33 95.0 34 152.0 35 249.0 36 678.0 37 2490.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.4367666232073 12.88135593220339 12.099087353324641 39.58279009126467 2 21.45 16.825000000000003 34.949999999999996 26.775 3 19.05 22.225 25.2 33.525 4 23.325000000000003 31.474999999999998 21.349999999999998 23.849999999999998 5 22.2 34.9 23.45 19.45 6 17.8 36.35 25.775 20.075000000000003 7 14.025000000000002 24.4 43.9 17.675 8 17.549999999999997 25.0 30.75 26.700000000000003 9 16.25 26.200000000000003 32.775 24.775 10-14 20.145 29.465000000000003 26.56 23.830000000000002 15-19 19.605 28.065 27.875 24.455 20-24 19.485 28.685 27.91 23.919999999999998 25-29 19.564999999999998 28.62 28.32 23.494999999999997 30-34 19.74 28.28 28.54 23.44 35-39 19.415 29.37 27.279999999999998 23.935000000000002 40-44 20.22 28.785 27.595 23.400000000000002 45-49 20.19 28.525 27.639999999999997 23.645 50-54 19.82 28.485 28.084999999999997 23.61 55-59 19.85 28.615000000000002 28.060000000000002 23.474999999999998 60-64 19.78 28.115000000000002 28.285 23.82 65-69 20.380000000000003 28.29 27.87 23.46 70-74 20.45 27.900000000000002 28.38 23.27 75-79 20.24 28.665000000000003 27.435 23.66 80-84 19.88 28.675 27.860000000000003 23.585 85-89 19.895 28.985 27.544999999999998 23.575 90-94 19.86 28.675 28.125 23.34 95-99 20.165 28.349999999999998 27.450000000000003 24.035 100-104 20.28 29.110000000000003 27.395000000000003 23.215 105-109 20.45 28.895 27.389999999999997 23.265 110-114 20.625 28.33 27.505000000000003 23.54 115-119 20.61 29.330000000000002 26.945000000000004 23.115 120-124 20.455000000000002 28.575 26.979999999999997 23.990000000000002 125-129 20.555 28.804999999999996 27.084999999999997 23.555 130-134 20.615 28.71 26.66 24.015 135-139 20.415 29.110000000000003 26.6 23.875 140-144 20.665 28.939999999999998 26.77 23.625 145-149 20.979999999999997 29.270000000000003 25.82 23.93 150-151 20.3625 29.5875 26.0625 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 1.5 22 1.0 23 4.0 24 4.0 25 2.5 26 3.5 27 5.0 28 8.0 29 12.5 30 16.5 31 19.0 32 28.5 33 52.0 34 67.0 35 78.0 36 96.5 37 119.5 38 153.0 39 181.5 40 200.0 41 212.5 42 238.5 43 263.5 44 263.0 45 269.5 46 270.5 47 248.0 48 226.0 49 189.5 50 154.0 51 134.0 52 103.5 53 84.5 54 73.0 55 57.0 56 41.5 57 30.0 58 26.0 59 20.0 60 12.0 61 6.0 62 6.0 63 7.0 64 5.5 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69871955812202 99.275 2 0.22596033140848606 0.44999999999999996 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.4 0.0 0.0 0.0 0.0 112-113 3.9124999999999996 0.0 0.0 0.0 0.0 114-115 4.3625 0.0 0.0 0.0 0.0 116-117 5.0125 0.0 0.0 0.0 0.0 118-119 5.3375 0.0 0.0 0.0 0.0 120-121 5.800000000000001 0.0 0.0 0.0 0.0 122-123 6.275 0.0 0.0 0.0 0.0 124-125 6.7375 0.0 0.0 0.0 0.0 126-127 7.1875 0.0 0.0 0.0 0.0 128-129 7.8375 0.0 0.0 0.0 0.0 130-131 8.35 0.0 0.0 0.0 0.0 132-133 8.75 0.0 0.0 0.0 0.0 134-135 9.2375 0.0 0.0 0.0 0.0 136-137 9.9125 0.0 0.0 0.0 0.0 138-139 10.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGTT 10 0.006843168 144.91249 7 GAAATCA 10 0.006843168 144.91249 3 AAATCAT 10 0.006843168 144.91249 4 >>END_MODULE SRR7168864 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.798 33.0 33.0 34.0 32.0 34.0 2 32.90675 33.0 33.0 34.0 32.0 34.0 3 32.92225 33.0 33.0 34.0 32.0 34.0 4 32.867 33.0 33.0 34.0 32.0 34.0 5 32.8735 33.0 33.0 34.0 32.0 34.0 6 37.104 38.0 38.0 38.0 37.0 38.0 7 37.151 38.0 38.0 38.0 37.0 38.0 8 37.1625 38.0 38.0 38.0 37.0 38.0 9 37.168 38.0 38.0 38.0 37.0 38.0 10-14 37.10745 38.0 38.0 38.0 37.0 38.0 15-19 37.13475 38.0 38.0 38.0 37.0 38.0 20-24 37.1062 38.0 38.0 38.0 37.0 38.0 25-29 37.0658 38.0 38.0 38.0 37.0 38.0 30-34 37.00975 38.0 38.0 38.0 36.8 38.0 35-39 37.0573 38.0 38.0 38.0 37.0 38.0 40-44 37.046200000000006 38.0 38.0 38.0 37.0 38.0 45-49 36.980199999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.9482 38.0 38.0 38.0 36.2 38.0 55-59 36.88835 38.0 38.0 38.0 36.0 38.0 60-64 36.9072 38.0 38.0 38.0 36.0 38.0 65-69 36.8652 38.0 38.0 38.0 36.0 38.0 70-74 36.759100000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.693149999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.597500000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.50915 38.0 38.0 38.0 35.0 38.0 90-94 36.411199999999994 38.0 38.0 38.0 34.4 38.0 95-99 36.36919999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.260949999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.166 38.0 38.0 38.0 33.8 38.0 110-114 35.900150000000004 38.0 37.8 38.0 33.2 38.0 115-119 35.794650000000004 38.0 37.6 38.0 32.8 38.0 120-124 35.45739999999999 38.0 37.0 38.0 31.0 38.0 125-129 35.26135000000001 38.0 36.6 38.0 30.4 38.0 130-134 34.8333 38.0 36.0 38.0 27.4 38.0 135-139 34.2155 38.0 34.6 38.0 24.6 38.0 140-144 33.5831 38.0 33.0 38.0 21.2 38.0 145-149 32.233700000000006 38.0 33.0 38.0 10.4 38.0 150-151 27.079375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 0.0 5 3.0 6 1.0 7 1.0 8 2.0 9 2.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 1.0 16 5.0 17 5.0 18 6.0 19 14.0 20 5.0 21 4.0 22 13.0 23 18.0 24 8.0 25 14.0 26 27.0 27 23.0 28 35.0 29 33.0 30 34.0 31 47.0 32 75.0 33 105.0 34 128.0 35 266.0 36 615.0 37 2491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.525 17.675 17.75 30.049999999999997 2 24.875 26.55 32.925 15.65 3 20.724999999999998 28.9 30.599999999999998 19.775000000000002 4 23.5 34.9 23.325000000000003 18.275 5 23.95 35.9 22.8 17.349999999999998 6 20.150000000000002 37.65 24.375 17.825 7 20.1 19.725 41.325 18.85 8 21.5 24.6 28.075 25.825 9 21.575 24.875 30.8 22.75 10-14 23.43 28.815 26.724999999999998 21.029999999999998 15-19 23.105 28.255000000000003 27.755000000000003 20.885 20-24 23.244999999999997 27.615000000000002 28.585 20.555 25-29 23.5 27.794999999999998 28.28 20.424999999999997 30-34 23.03 28.315 28.12 20.535 35-39 23.205000000000002 28.134999999999998 27.894999999999996 20.765 40-44 23.135 28.754999999999995 27.79 20.32 45-49 23.325000000000003 28.425 27.889999999999997 20.36 50-54 22.84 28.52 27.884999999999998 20.755000000000003 55-59 23.555 28.244999999999997 28.050000000000004 20.150000000000002 60-64 22.54 28.084999999999997 28.249999999999996 21.125 65-69 23.305 28.58 27.950000000000003 20.165 70-74 23.845 27.92 27.944999999999997 20.29 75-79 23.345 28.09 27.985 20.580000000000002 80-84 23.805 27.445000000000004 28.125 20.625 85-89 23.022302230223023 27.93779377937794 28.402840284028404 20.637063706370636 90-94 23.60118005900295 27.83639181959098 28.086404320216012 20.47602380119006 95-99 23.402340234023402 28.192819281928195 28.03780378037804 20.367036703670365 100-104 23.986199309965496 27.87139356967848 27.986399319965997 20.156007800390018 105-109 23.605 28.9 27.195000000000004 20.3 110-114 24.063609541431212 28.10921638245737 27.94919237885683 19.877981697254587 115-119 24.375 28.18 27.455000000000002 19.99 120-124 24.48 27.889999999999997 28.005000000000003 19.625 125-129 24.88 28.165000000000003 27.169999999999998 19.785 130-134 24.953743061459218 28.039205880882136 27.729159373906086 19.277891683752564 135-139 25.522552255225524 27.8977897789779 27.257725772577256 19.32193219321932 140-144 25.525 28.244999999999997 27.275 18.955 145-149 25.83129156457823 28.576428821441073 26.851342567128356 18.740937046852345 150-151 26.56582072759095 27.65345668208526 26.553319164895612 19.22740342542818 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 3.5 27 5.5 28 7.5 29 10.5 30 16.5 31 21.0 32 29.0 33 42.0 34 51.5 35 58.5 36 92.0 37 135.5 38 148.0 39 176.0 40 216.5 41 245.0 42 255.0 43 254.0 44 268.0 45 270.5 46 260.5 47 233.5 48 216.0 49 198.5 50 173.0 51 148.5 52 109.5 53 82.5 54 68.0 55 52.0 56 35.0 57 27.0 58 23.0 59 20.5 60 13.5 61 7.5 62 7.0 63 3.0 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.005 95-99 0.01 100-104 0.005 105-109 0.0 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.01 140-144 0.0 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.9 0.0 0.0 0.0 0.0 114-115 4.3625 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.85 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.25 0.0 0.0 0.0 0.0 128-129 7.8875 0.0 0.0 0.0 0.0 130-131 8.4 0.0 0.0 0.0 0.0 132-133 8.774999999999999 0.0 0.0 0.0 0.0 134-135 9.2625 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839613 spots for SRR7168864.sra Written 839613 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra Read 839606 spots for SRR7168864.sra Written 839606 spots for SRR7168864.sra SRR ids: ['SRR7168864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zpajjdn SRR7168864.sra spots: 16792127 blocks: [[1, 839606], [839607, 1679212], [1679213, 2518818], [2518819, 3358424], [3358425, 4198030], [4198031, 5037636], [5037637, 5877242], [5877243, 6716848], [6716849, 7556454], [7556455, 8396060], [8396061, 9235666], [9235667, 10075272], [10075273, 10914878], [10914879, 11754484], [11754485, 12594090], [12594091, 13433696], [13433697, 14273302], [14273303, 15112908], [15112909, 15952514], [15952515, 16792127]] SRR7168864 file size 5668600 SRR7168864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168864 SRR7168864_1.fastq SRR7168864_2.fastq Input file: SRR7168864_1.fastq Paired file: SRR7168864_2.fastq trimmed: SRR7168864-trimmed-pair1.fastq, SRR7168864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 09:42:20 2025 >> started Sat Feb 15 09:42:42 2025 >> done (21.996s) 16792127 read pairs processed; of these: 24023 ( 0.14%) short read pairs filtered out after trimming by size control 22145 ( 0.13%) empty read pairs filtered out after trimming by size control 16745959 (99.73%) read pairs available; of these: 9358127 (55.88%) trimmed read pairs available after processing 7387832 (44.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 1 0.00% 24 9 0.00% 25 4 0.00% 26 5 0.00% 27 9 0.00% 28 6 0.00% 29 4 0.00% 30 8 0.00% 31 7 0.00% 32 14 0.00% 33 13 0.00% 34 4 0.00% 35 18 0.00% 36 21 0.00% 37 22 0.00% 38 20 0.00% 39 23 0.00% 40 25 0.00% 41 22 0.00% 42 36 0.00% 43 27 0.00% 44 52 0.00% 45 42 0.00% 46 61 0.00% 47 72 0.00% 48 53 0.00% 49 82 0.00% 50 75 0.00% 51 121 0.00% 52 132 0.00% 53 162 0.00% 54 140 0.00% 55 171 0.00% 56 228 0.00% 57 287 0.00% 58 249 0.00% 59 312 0.00% 60 365 0.00% 61 380 0.00% 62 448 0.00% 63 519 0.00% 64 621 0.00% 65 699 0.00% 66 827 0.00% 67 860 0.01% 68 1094 0.01% 69 2109 0.01% 70 1852 0.01% 71 1557 0.01% 72 1768 0.01% 73 1957 0.01% 74 2149 0.01% 75 2464 0.01% 76 2693 0.02% 77 2991 0.02% 78 3507 0.02% 79 3734 0.02% 80 4263 0.03% 81 4727 0.03% 82 5385 0.03% 83 6022 0.04% 84 7479 0.04% 85 8200 0.05% 86 8966 0.05% 87 9834 0.06% 88 10707 0.06% 89 11063 0.07% 90 11972 0.07% 91 12968 0.08% 92 14015 0.08% 93 15456 0.09% 94 16308 0.10% 95 17744 0.11% 96 18672 0.11% 97 19918 0.12% 98 20871 0.12% 99 21868 0.13% 100 23220 0.14% 101 24327 0.15% 102 26013 0.16% 103 27614 0.16% 104 28743 0.17% 105 30671 0.18% 106 32087 0.19% 107 33531 0.20% 108 34848 0.21% 109 36089 0.22% 110 37141 0.22% 111 37948 0.23% 112 39971 0.24% 113 41511 0.25% 114 43284 0.26% 115 44908 0.27% 116 46998 0.28% 117 48270 0.29% 118 49747 0.30% 119 51032 0.30% 120 51915 0.31% 121 53018 0.32% 122 55265 0.33% 123 57838 0.35% 124 59927 0.36% 125 61706 0.37% 126 64291 0.38% 127 66575 0.40% 128 69054 0.41% 129 70371 0.42% 130 72834 0.43% 131 74575 0.45% 132 76963 0.46% 133 80672 0.48% 134 83639 0.50% 135 88297 0.53% 136 92724 0.55% 137 97128 0.58% 138 102304 0.61% 139 109354 0.65% 140 114969 0.69% 141 123792 0.74% 142 134707 0.80% 143 148087 0.88% 144 169162 1.01% 145 197565 1.18% 146 244115 1.46% 147 319381 1.91% 148 469655 2.80% 149 897621 5.36% 150 4031087 24.07% 151 7387832 44.12% 16745959 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=367.88 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.67 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=31.09 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7168864 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 09:43:55 Started mapping on | Feb 15 09:44:09 Finished on | Feb 15 09:46:15 Mapping speed, Million of reads per hour | 478.46 Number of input reads | 16745959 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15746063 Uniquely mapped reads % | 94.03% Average mapped length | 290.24 Number of splices: Total | 15188026 Number of splices: Annotated (sjdb) | 14815344 Number of splices: GT/AG | 14905449 Number of splices: GC/AG | 230788 Number of splices: AT/AC | 8744 Number of splices: Non-canonical | 43045 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462590 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 60934 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 553405 553405 553405 N_multimapping 462590 462590 462590 N_noFeature 587925 15411313 782285 N_ambiguous 249068 1403 107642 UnstrandedReadsAssigned:14909070 PositiveStrandReadsAssigned:333347 NegativeStrandReadsAssigned:14856136 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7168864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168864-trimmed-pair1.fastq SRR7168864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,745,959 reads, 14,852,548 reads pseudoaligned [quant] estimated average fragment length: 222.456 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7168864.ke.tsv 34699 SRR7168864.se.tsv 87100 total ==> SRR7168864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.54 1107 40.7933 Potri.005G024800.1.v4.1 1035 813.544 385 31.3299 Potri.004G059700.1.v4.1 961 739.574 9 0.805639 Potri.007G009000.2.v4.1 1416 1194.54 0 0 Potri.003G141000.2.v4.1 2943 2721.54 936.91 22.7909 Potri.016G087400.1.v4.1 270 90.1539 1134 832.737 Potri.015G069301.1.v4.1 564 346.323 0 0 Potri.010G195200.1.v4.1 1773 1551.54 445 18.9878 Potri.012G127500.1.v4.1 977 755.562 164 14.3699 ==> SRR7168864.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 585 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 46 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 7 SRR7168864 completed mapping pipeline successfully