Starting /dee2/code/volunteer_pipeline.sh SRR7168865 current disk space = 3091821297664 free memory = 1579060000 SRR7168865 SRAfilesize cf3324a1d13376c3ed7523d070c85006 SRR7168865.sra SRR7168865.sra file validated SRR7168865 is paired end SRR7168865 is conventional basespace SRR7168865 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.97225 34.0 33.0 34.0 32.0 34.0 2 33.1235 34.0 33.0 34.0 32.0 34.0 3 33.2505 34.0 33.0 34.0 32.0 34.0 4 33.3445 34.0 33.0 34.0 33.0 34.0 5 33.33625 34.0 33.0 34.0 33.0 34.0 6 37.138 38.0 38.0 38.0 36.0 38.0 7 37.3165 38.0 38.0 38.0 37.0 38.0 8 37.42375 38.0 38.0 38.0 37.0 38.0 9 37.46525 38.0 38.0 38.0 37.0 38.0 10-14 37.498850000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.48725 38.0 38.0 38.0 37.0 38.0 20-24 37.48445 38.0 38.0 38.0 37.0 38.0 25-29 37.411 38.0 38.0 38.0 37.0 38.0 30-34 37.4202 38.0 38.0 38.0 37.0 38.0 35-39 37.36785 38.0 38.0 38.0 37.0 38.0 40-44 37.321450000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.3221 38.0 38.0 38.0 37.0 38.0 50-54 37.24495 38.0 38.0 38.0 36.8 38.0 55-59 37.15285 38.0 38.0 38.0 36.4 38.0 60-64 37.1995 38.0 38.0 38.0 36.4 38.0 65-69 37.140499999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.10875 38.0 38.0 38.0 36.2 38.0 75-79 37.054950000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.022400000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.90070000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.7882 38.0 38.0 38.0 35.0 38.0 95-99 36.5927 38.0 38.0 38.0 34.4 38.0 100-104 36.544349999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.33865 38.0 38.0 38.0 34.0 38.0 110-114 36.21145 38.0 38.0 38.0 33.6 38.0 115-119 35.96245 38.0 37.0 38.0 32.2 38.0 120-124 35.78675 38.0 37.0 38.0 31.4 38.0 125-129 35.47865 38.0 36.2 38.0 31.0 38.0 130-134 35.1085 38.0 35.8 38.0 29.4 38.0 135-139 34.7386 38.0 35.2 38.0 27.6 38.0 140-144 34.0598 38.0 33.2 38.0 24.8 38.0 145-149 32.92515 38.0 33.0 38.0 17.2 38.0 150-151 27.660125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 2.0 20 5.0 21 3.0 22 3.0 23 5.0 24 9.0 25 18.0 26 7.0 27 20.0 28 24.0 29 35.0 30 51.0 31 53.0 32 76.0 33 102.0 34 186.0 35 264.0 36 683.0 37 2444.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.34640522875817 11.92156862745098 12.549019607843137 40.18300653594771 2 21.95 17.349999999999998 34.35 26.35 3 21.55 22.15 24.95 31.35 4 23.025000000000002 30.675 21.95 24.349999999999998 5 22.325 34.575 23.3 19.8 6 18.875 35.175 25.2 20.75 7 14.374999999999998 25.0 42.65 17.974999999999998 8 19.1 24.45 31.2 25.25 9 17.275 25.55 33.25 23.925 10-14 20.035 29.365000000000002 26.735 23.865 15-19 19.950000000000003 28.53 27.765 23.755000000000003 20-24 19.96 27.68 27.794999999999998 24.565 25-29 20.16 28.645 26.995 24.2 30-34 19.13 28.865000000000002 27.665 24.34 35-39 20.195 28.315 27.6 23.89 40-44 19.985 28.299999999999997 27.595 24.12 45-49 19.869999999999997 28.485 27.62 24.025 50-54 20.424999999999997 28.685 27.334999999999997 23.555 55-59 20.235 28.435 27.700000000000003 23.630000000000003 60-64 20.48 28.015 27.415 24.09 65-69 20.125 28.435 27.08 24.36 70-74 19.875 28.59 27.994999999999997 23.54 75-79 20.24 28.395 27.245 24.12 80-84 19.88 28.435 27.615000000000002 24.07 85-89 19.725 28.525 27.07 24.68 90-94 20.22 28.675 26.96 24.145 95-99 20.645 27.29 27.994999999999997 24.07 100-104 20.87 28.645 26.895000000000003 23.59 105-109 20.29 28.275 27.52 23.915 110-114 20.87 28.065 27.189999999999998 23.875 115-119 20.7 28.720000000000002 26.919999999999998 23.66 120-124 20.645 28.53 26.72 24.104999999999997 125-129 20.345 28.825 26.900000000000002 23.93 130-134 20.51 28.255000000000003 27.250000000000004 23.985 135-139 20.755000000000003 27.99 27.01 24.245 140-144 20.68 28.505000000000003 26.05 24.765 145-149 20.995 28.65 26.575 23.78 150-151 20.925 27.5625 26.950000000000003 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 3.0 26 6.0 27 7.0 28 10.0 29 12.5 30 14.0 31 21.5 32 29.5 33 43.5 34 61.5 35 72.0 36 89.5 37 112.5 38 128.0 39 143.0 40 167.0 41 199.5 42 234.5 43 254.0 44 257.0 45 262.0 46 264.5 47 261.0 48 243.0 49 211.5 50 186.0 51 155.0 52 121.0 53 101.0 54 81.5 55 61.0 56 50.5 57 39.5 58 27.5 59 22.5 60 14.5 61 7.0 62 6.0 63 5.5 64 3.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.025 0.0 0.0 0.0 84-85 0.3625 0.025 0.0 0.0 0.0 86-87 0.3875 0.025 0.0 0.0 0.0 88-89 0.5 0.025 0.0 0.0 0.0 90-91 0.6125 0.025 0.0 0.0 0.0 92-93 0.675 0.025 0.0 0.0 0.0 94-95 0.7625 0.025 0.0 0.0 0.0 96-97 0.875 0.025 0.0 0.0 0.0 98-99 0.9875 0.025 0.0 0.0 0.0 100-101 1.1875 0.025 0.0 0.0 0.0 102-103 1.3125 0.025 0.0 0.0 0.0 104-105 1.5375 0.025 0.0 0.0 0.0 106-107 1.8250000000000002 0.025 0.0 0.0 0.0 108-109 2.3625 0.025 0.0 0.0 0.0 110-111 2.7125 0.025 0.0 0.0 0.0 112-113 2.9749999999999996 0.025 0.0 0.0 0.0 114-115 3.1500000000000004 0.025 0.0 0.0 0.0 116-117 3.675 0.025 0.0 0.0 0.0 118-119 4.25 0.025 0.0 0.0 0.0 120-121 4.775 0.025 0.0 0.0 0.0 122-123 5.0625 0.025 0.0 0.0 0.0 124-125 5.475 0.025 0.0 0.0 0.0 126-127 5.7875 0.025 0.0 0.0 0.0 128-129 6.5375 0.025 0.0 0.0 0.0 130-131 6.9625 0.025 0.0 0.0 0.0 132-133 7.4 0.025 0.0 0.0 0.0 134-135 7.9 0.025 0.0 0.0 0.0 136-137 8.4375 0.025 0.0 0.0 0.0 138-139 9.0625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTT 10 0.006841402 144.925 4 >>END_MODULE SRR7168865 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168865_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7595 33.0 33.0 34.0 32.0 34.0 2 32.90625 33.0 33.0 34.0 32.0 34.0 3 32.88175 34.0 33.0 34.0 32.0 34.0 4 32.89175 33.0 33.0 34.0 32.0 34.0 5 32.8735 33.0 33.0 34.0 32.0 34.0 6 37.11025 38.0 38.0 38.0 37.0 38.0 7 37.17075 38.0 38.0 38.0 37.0 38.0 8 37.1465 38.0 38.0 38.0 37.0 38.0 9 37.11925 38.0 38.0 38.0 37.0 38.0 10-14 37.11965 38.0 38.0 38.0 37.0 38.0 15-19 37.08325000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.07475 38.0 38.0 38.0 37.0 38.0 25-29 37.03145 38.0 38.0 38.0 37.0 38.0 30-34 37.04915 38.0 38.0 38.0 36.6 38.0 35-39 37.03125 38.0 38.0 38.0 36.8 38.0 40-44 37.015249999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.97775 38.0 38.0 38.0 36.2 38.0 50-54 36.96625 38.0 38.0 38.0 36.0 38.0 55-59 36.9125 38.0 38.0 38.0 36.0 38.0 60-64 36.87225 38.0 38.0 38.0 36.0 38.0 65-69 36.79785 38.0 38.0 38.0 36.0 38.0 70-74 36.678900000000006 38.0 38.0 38.0 35.6 38.0 75-79 36.63605 38.0 38.0 38.0 35.2 38.0 80-84 36.528800000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.37329999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.35915 38.0 38.0 38.0 34.0 38.0 95-99 36.2995 38.0 38.0 38.0 34.0 38.0 100-104 36.2556 38.0 38.0 38.0 34.0 38.0 105-109 36.11755 38.0 38.0 38.0 33.8 38.0 110-114 35.9053 38.0 37.8 38.0 33.4 38.0 115-119 35.71875 38.0 37.0 38.0 31.8 38.0 120-124 35.4001 38.0 37.0 38.0 30.6 38.0 125-129 35.261250000000004 38.0 36.2 38.0 30.2 38.0 130-134 34.732150000000004 38.0 35.8 38.0 27.4 38.0 135-139 34.06615 38.0 34.4 38.0 23.8 38.0 140-144 33.472449999999995 38.0 33.0 38.0 20.6 38.0 145-149 32.15665 38.0 33.0 38.0 10.4 38.0 150-151 27.076125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 3.0 5 2.0 6 0.0 7 0.0 8 3.0 9 3.0 10 0.0 11 0.0 12 0.0 13 2.0 14 6.0 15 6.0 16 4.0 17 6.0 18 2.0 19 5.0 20 10.0 21 5.0 22 11.0 23 12.0 24 16.0 25 19.0 26 26.0 27 30.0 28 32.0 29 26.0 30 51.0 31 49.0 32 71.0 33 108.0 34 145.0 35 264.0 36 596.0 37 2478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 17.575 18.15 28.325 2 27.175 25.05 31.7 16.075 3 21.075 28.725 29.5 20.7 4 24.675 35.75 21.349999999999998 18.224999999999998 5 24.675 36.225 22.375 16.725 6 20.040030022516888 36.202151613710285 24.468351263447584 19.289467100325243 7 18.0 19.2 42.1 20.7 8 22.1 25.074999999999996 27.075 25.75 9 21.75 26.424999999999997 28.925 22.900000000000002 10-14 23.815 28.565 26.369999999999997 21.25 15-19 23.356167808390417 27.951397569878495 27.751387569378466 20.94104705235262 20-24 23.179635927185437 28.040608121624327 27.735547109421884 21.044208841768352 25-29 23.393187615665482 27.934777172010207 27.40959335767519 21.26244185464913 30-34 22.909581916383274 28.055611122224445 27.61052210442088 21.424284856971397 35-39 23.09770373705538 27.425083796087847 27.965380959527742 21.51183150732903 40-44 23.4593837535014 28.49139655862345 27.490996398559425 20.558223289315727 45-49 23.568535280292043 27.714157123568533 27.71915787368105 20.99814972245837 50-54 23.29 28.165000000000003 26.979999999999997 21.565 55-59 23.625631534190386 27.972587664449 27.84753138912511 20.554249412235507 60-64 23.52 27.384999999999998 28.055000000000003 21.04 65-69 23.49527192675239 27.497873617851603 27.848101265822784 21.158753189573222 70-74 23.965577625456547 27.447841096712867 27.417821584029618 21.168759693800972 75-79 23.426398478935255 27.524266986890822 27.98959271490043 21.05974181927349 80-84 23.446723361680842 27.838919459729865 27.973986993496748 20.740370185092548 85-89 23.903903903903903 27.402402402402405 27.847847847847845 20.845845845845844 90-94 23.52234622891747 27.596216405585306 28.02662529402933 20.854812071467897 95-99 23.89247634779997 28.252490363918508 27.066126044951694 20.78890724332983 100-104 24.426984285857273 27.644880392353116 27.744970473426083 20.18316484836353 105-109 23.977778889945448 28.086682348230816 27.511135578799863 20.424403183023873 110-114 23.686317685917327 27.860074066659994 27.744970473426083 20.708637773996596 115-119 24.16053645598759 27.7485862983536 27.54841615373067 20.54246109192814 120-124 24.046641977780002 27.48473626263637 27.960164147732957 20.508457611850666 125-129 24.99624680978832 28.07386278336586 26.862833408397137 20.06705699844868 130-134 25.276540367385753 27.368737174032738 27.38875819610591 19.965964262475598 135-139 25.222745019521476 28.11092201421564 26.974672139353288 19.6916608269096 140-144 25.29776799119207 27.950155139625664 27.19947953157842 19.552597337603846 145-149 25.763186868181364 28.215393854469024 26.67400660594535 19.347412671404264 150-151 26.310521706493184 27.849368197172524 26.923558113349184 18.916551982985112 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 2.5 26 4.0 27 5.0 28 6.5 29 7.5 30 11.5 31 14.5 32 19.5 33 33.0 34 44.0 35 54.0 36 69.0 37 103.0 38 135.5 39 153.5 40 194.5 41 238.5 42 257.0 43 252.0 44 259.0 45 268.5 46 264.0 47 264.5 48 249.0 49 214.5 50 176.5 51 145.0 52 116.5 53 97.0 54 84.5 55 63.5 56 47.5 57 41.5 58 27.5 59 16.5 60 14.5 61 12.0 62 9.0 63 6.0 64 3.5 65 2.0 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.02 25-29 0.034999999999999996 30-34 0.02 35-39 0.055 40-44 0.04 45-49 0.015 50-54 0.0 55-59 0.045 60-64 0.0 65-69 0.065 70-74 0.065 75-79 0.06999999999999999 80-84 0.05 85-89 0.1 90-94 0.095 95-99 0.11499999999999999 100-104 0.09 105-109 0.095 110-114 0.09 115-119 0.08499999999999999 120-124 0.09 125-129 0.08499999999999999 130-134 0.105 135-139 0.11 140-144 0.09 145-149 0.09 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26860025220681 98.4 2 0.6305170239596469 1.25 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.725 0.0 0.0 0.0 0.0 118-119 4.2875 0.0 0.0 0.0 0.0 120-121 4.8375 0.0 0.0 0.0 0.0 122-123 5.1375 0.0 0.0 0.0 0.0 124-125 5.55 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.612500000000001 0.0 0.0 0.0 0.0 130-131 7.05 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 7.975 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887333 spots for SRR7168865.sra Written 887333 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra Read 887320 spots for SRR7168865.sra Written 887320 spots for SRR7168865.sra SRR ids: ['SRR7168865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dunm0v16 SRR7168865.sra spots: 17746413 blocks: [[1, 887320], [887321, 1774640], [1774641, 2661960], [2661961, 3549280], [3549281, 4436600], [4436601, 5323920], [5323921, 6211240], [6211241, 7098560], [7098561, 7985880], [7985881, 8873200], [8873201, 9760520], [9760521, 10647840], [10647841, 11535160], [11535161, 12422480], [12422481, 13309800], [13309801, 14197120], [14197121, 15084440], [15084441, 15971760], [15971761, 16859080], [16859081, 17746413]] SRR7168865 file size 5991976 SRR7168865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168865 SRR7168865_1.fastq SRR7168865_2.fastq Input file: SRR7168865_1.fastq Paired file: SRR7168865_2.fastq trimmed: SRR7168865-trimmed-pair1.fastq, SRR7168865-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 10:09:06 2025 >> started Sat Feb 15 10:09:31 2025 >> done (25.036s) 17746413 read pairs processed; of these: 27412 ( 0.15%) short read pairs filtered out after trimming by size control 30584 ( 0.17%) empty read pairs filtered out after trimming by size control 17688417 (99.67%) read pairs available; of these: 9868891 (55.79%) trimmed read pairs available after processing 7819526 (44.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 13 0.00% 28 11 0.00% 29 5 0.00% 30 6 0.00% 31 12 0.00% 32 11 0.00% 33 5 0.00% 34 18 0.00% 35 15 0.00% 36 19 0.00% 37 13 0.00% 38 19 0.00% 39 15 0.00% 40 34 0.00% 41 49 0.00% 42 45 0.00% 43 50 0.00% 44 66 0.00% 45 59 0.00% 46 67 0.00% 47 82 0.00% 48 94 0.00% 49 107 0.00% 50 100 0.00% 51 133 0.00% 52 156 0.00% 53 149 0.00% 54 206 0.00% 55 181 0.00% 56 221 0.00% 57 250 0.00% 58 303 0.00% 59 322 0.00% 60 339 0.00% 61 407 0.00% 62 452 0.00% 63 557 0.00% 64 586 0.00% 65 669 0.00% 66 708 0.00% 67 896 0.01% 68 1152 0.01% 69 2416 0.01% 70 1975 0.01% 71 1500 0.01% 72 1627 0.01% 73 1798 0.01% 74 2046 0.01% 75 2226 0.01% 76 2472 0.01% 77 2844 0.02% 78 3092 0.02% 79 3540 0.02% 80 3967 0.02% 81 4464 0.03% 82 4967 0.03% 83 5649 0.03% 84 6849 0.04% 85 8132 0.05% 86 8534 0.05% 87 9437 0.05% 88 10221 0.06% 89 10591 0.06% 90 11350 0.06% 91 12251 0.07% 92 13045 0.07% 93 14620 0.08% 94 15650 0.09% 95 16912 0.10% 96 17831 0.10% 97 18980 0.11% 98 19813 0.11% 99 20887 0.12% 100 22197 0.13% 101 22956 0.13% 102 24719 0.14% 103 26038 0.15% 104 27751 0.16% 105 29572 0.17% 106 30627 0.17% 107 32095 0.18% 108 33321 0.19% 109 34816 0.20% 110 35619 0.20% 111 36785 0.21% 112 38473 0.22% 113 40159 0.23% 114 41946 0.24% 115 43911 0.25% 116 45801 0.26% 117 47011 0.27% 118 48535 0.27% 119 49573 0.28% 120 50941 0.29% 121 52557 0.30% 122 54404 0.31% 123 56760 0.32% 124 58677 0.33% 125 61052 0.35% 126 63173 0.36% 127 66022 0.37% 128 68164 0.39% 129 70723 0.40% 130 72645 0.41% 131 74200 0.42% 132 77837 0.44% 133 80820 0.46% 134 85028 0.48% 135 89021 0.50% 136 94261 0.53% 137 99001 0.56% 138 105546 0.60% 139 111880 0.63% 140 118921 0.67% 141 128805 0.73% 142 140623 0.80% 143 157069 0.89% 144 182026 1.03% 145 213917 1.21% 146 264706 1.50% 147 349780 1.98% 148 518737 2.93% 149 991062 5.60% 150 4330298 24.48% 151 7819526 44.21% 17688417 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=346.97 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=12 prefix-density=0.54 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=43.47 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.4 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168865 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 10:10:39 Started mapping on | Feb 15 10:10:43 Finished on | Feb 15 10:12:43 Mapping speed, Million of reads per hour | 530.65 Number of input reads | 17688417 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16546906 Uniquely mapped reads % | 93.55% Average mapped length | 291.06 Number of splices: Total | 15703420 Number of splices: Annotated (sjdb) | 15350109 Number of splices: GT/AG | 15408408 Number of splices: GC/AG | 246694 Number of splices: AT/AC | 9900 Number of splices: Non-canonical | 38418 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426896 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 111989 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.27% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733356 733356 733356 N_multimapping 426896 426896 426896 N_noFeature 611920 16222807 780643 N_ambiguous 254456 1501 97968 UnstrandedReadsAssigned:15680530 PositiveStrandReadsAssigned:322598 NegativeStrandReadsAssigned:15668295 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168865 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168865-trimmed-pair1.fastq SRR7168865-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,688,417 reads, 15,728,739 reads pseudoaligned [quant] estimated average fragment length: 228.095 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR7168865.ke.tsv 34699 SRR7168865.se.tsv 87100 total ==> SRR7168865.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.91 783 27.152 Potri.005G024800.1.v4.1 1035 807.905 109 8.37874 Potri.004G059700.1.v4.1 961 733.934 6 0.5077 Potri.007G009000.2.v4.1 1416 1188.91 0 0 Potri.003G141000.2.v4.1 2943 2715.91 1024.34 23.4231 Potri.016G087400.1.v4.1 270 87.6503 658.283 466.414 Potri.015G069301.1.v4.1 564 340.787 0 0 Potri.010G195200.1.v4.1 1773 1545.91 17 0.682934 Potri.012G127500.1.v4.1 977 749.923 87 7.20469 ==> SRR7168865.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1156 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 332 Potri.001G212900.v4.1 91 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7168865 completed mapping pipeline successfully