Starting /dee2/code/volunteer_pipeline.sh SRR7168867 current disk space = 3091354103808 free memory = 1539847184 SRR7168867 SRAfilesize 3ee9ff380b33701191625b2ca874f98a SRR7168867.sra SRR7168867.sra file validated SRR7168867 is paired end SRR7168867 is conventional basespace SRR7168867 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64175 34.0 33.0 34.0 32.0 34.0 2 33.30075 34.0 33.0 34.0 32.0 34.0 3 33.3995 34.0 34.0 34.0 33.0 34.0 4 33.44 34.0 34.0 34.0 33.0 34.0 5 33.47625 34.0 34.0 34.0 33.0 34.0 6 37.26225 38.0 38.0 38.0 36.0 38.0 7 37.475 38.0 38.0 38.0 37.0 38.0 8 37.577 38.0 38.0 38.0 37.0 38.0 9 37.54925 38.0 38.0 38.0 38.0 38.0 10-14 37.562850000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.589150000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.56295 38.0 38.0 38.0 38.0 38.0 25-29 37.54260000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.52235 38.0 38.0 38.0 37.8 38.0 35-39 37.507000000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.448150000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.4353 38.0 38.0 38.0 37.0 38.0 50-54 37.38555 38.0 38.0 38.0 37.0 38.0 55-59 37.37080000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.342 38.0 38.0 38.0 37.0 38.0 65-69 37.326750000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.25825 38.0 38.0 38.0 37.0 38.0 75-79 37.19930000000001 38.0 38.0 38.0 36.6 38.0 80-84 37.125099999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.056650000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.99550000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.87080000000001 38.0 38.0 38.0 35.6 38.0 100-104 36.80835 38.0 38.0 38.0 35.4 38.0 105-109 36.69635 38.0 38.0 38.0 35.0 38.0 110-114 36.56675 38.0 38.0 38.0 34.2 38.0 115-119 36.47835 38.0 38.0 38.0 34.4 38.0 120-124 36.20315000000001 38.0 37.8 38.0 33.8 38.0 125-129 35.9958 38.0 37.0 38.0 33.0 38.0 130-134 35.7531 38.0 36.6 38.0 32.4 38.0 135-139 35.339349999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.9841 38.0 35.8 38.0 29.4 38.0 145-149 34.4476 38.0 34.8 38.0 28.0 38.0 150-151 30.05825 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 2.0 18 3.0 19 2.0 20 2.0 21 4.0 22 6.0 23 4.0 24 6.0 25 9.0 26 16.0 27 13.0 28 15.0 29 21.0 30 28.0 31 39.0 32 47.0 33 77.0 34 133.0 35 228.0 36 522.0 37 2817.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.06454918032787 12.832991803278688 12.52561475409836 37.57684426229508 2 22.05 18.8 33.300000000000004 25.85 3 20.349999999999998 22.925 26.25 30.475 4 21.925 31.3 23.625 23.150000000000002 5 22.400000000000002 34.775 23.825 19.0 6 18.925 36.375 24.725 19.975 7 15.25 24.575 43.3 16.875 8 19.525000000000002 24.75 30.2 25.525 9 18.224999999999998 24.425 32.5 24.85 10-14 20.0 29.345 27.060000000000002 23.595 15-19 19.470000000000002 28.425 28.065 24.04 20-24 20.015 28.26 27.68 24.044999999999998 25-29 20.525 28.715000000000003 27.425 23.335 30-34 19.79 28.76 27.839999999999996 23.61 35-39 20.24 28.77 27.32 23.669999999999998 40-44 20.59 28.64 27.67 23.1 45-49 19.950000000000003 28.854999999999997 27.74 23.455000000000002 50-54 20.4 28.76 26.584999999999997 24.255 55-59 20.560000000000002 28.925 27.025 23.49 60-64 19.67 28.54 27.389999999999997 24.4 65-69 20.215 28.675 28.005000000000003 23.105 70-74 20.44 27.900000000000002 28.115000000000002 23.544999999999998 75-79 20.29 28.665000000000003 26.855 24.19 80-84 20.46 28.105000000000004 27.52 23.915 85-89 21.035 28.475 26.615 23.875 90-94 20.365 28.22 27.275 24.14 95-99 20.82 27.76 27.639999999999997 23.78 100-104 20.39 28.12 27.54 23.95 105-109 20.560000000000002 27.87 28.055000000000003 23.515 110-114 20.585 28.244999999999997 27.089999999999996 24.08 115-119 21.279999999999998 28.299999999999997 26.795 23.625 120-124 20.52 28.32 26.435 24.725 125-129 21.085 28.194999999999997 26.790000000000003 23.93 130-134 21.305 28.26 26.875 23.56 135-139 20.655 28.904999999999998 26.450000000000003 23.990000000000002 140-144 20.735 27.894999999999996 26.884999999999998 24.485 145-149 20.735 28.595 26.43 24.240000000000002 150-151 21.1625 28.525 25.75 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 0.5 26 1.0 27 4.0 28 9.5 29 13.0 30 15.0 31 24.0 32 31.5 33 38.5 34 60.5 35 76.5 36 97.0 37 121.0 38 136.5 39 152.5 40 175.5 41 209.0 42 236.0 43 241.5 44 254.5 45 273.0 46 274.5 47 264.5 48 244.5 49 202.0 50 168.5 51 142.5 52 118.0 53 98.0 54 78.0 55 61.5 56 45.5 57 38.0 58 24.0 59 22.0 60 14.5 61 6.5 62 6.5 63 4.0 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 3.8875 0.0 0.0 0.0 0.0 116-117 4.4 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.3375 0.0 0.0 0.0 0.0 122-123 5.925 0.0 0.0 0.0 0.0 124-125 6.4875 0.0 0.0 0.0 0.0 126-127 7.05 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.4 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.5125 0.0 0.0 0.0 0.0 136-137 10.35 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATTT 10 0.006830828 145.0 2 CCATAGT 10 0.006830828 145.0 1 GGAGGCC 10 0.006830828 145.0 5 GGTGCGG 10 0.006830828 145.0 145 TCTGGTT 20 3.5877043E-4 108.75 2 CTGGTTT 25 8.7132835E-4 87.0 3 AAAAAAA 55 4.8029233E-6 26.363638 145 >>END_MODULE SRR7168867 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168867_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00725 33.0 33.0 34.0 32.0 34.0 2 33.11025 34.0 33.0 34.0 32.0 34.0 3 33.1425 34.0 33.0 34.0 33.0 34.0 4 33.0975 34.0 33.0 34.0 33.0 34.0 5 33.066 34.0 33.0 34.0 33.0 34.0 6 37.21525 38.0 38.0 38.0 37.0 38.0 7 37.33825 38.0 38.0 38.0 37.0 38.0 8 37.349 38.0 38.0 38.0 37.0 38.0 9 37.36825 38.0 38.0 38.0 37.0 38.0 10-14 37.31155 38.0 38.0 38.0 37.0 38.0 15-19 37.270849999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.26205 38.0 38.0 38.0 37.0 38.0 25-29 37.242650000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.2547 38.0 38.0 38.0 37.0 38.0 35-39 37.21175 38.0 38.0 38.0 37.0 38.0 40-44 37.236900000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.245549999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.148799999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.10665 38.0 38.0 38.0 37.0 38.0 60-64 37.127199999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.09285 38.0 38.0 38.0 37.0 38.0 70-74 37.0274 38.0 38.0 38.0 37.0 38.0 75-79 36.9524 38.0 38.0 38.0 36.2 38.0 80-84 36.84780000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.7902 38.0 38.0 38.0 36.0 38.0 90-94 36.71775 38.0 38.0 38.0 35.6 38.0 95-99 36.7202 38.0 38.0 38.0 35.8 38.0 100-104 36.59590000000001 38.0 38.0 38.0 35.2 38.0 105-109 36.489549999999994 38.0 38.0 38.0 34.8 38.0 110-114 36.3245 38.0 38.0 38.0 34.0 38.0 115-119 36.252250000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.01425 38.0 38.0 38.0 33.6 38.0 125-129 35.7909 38.0 37.2 38.0 32.8 38.0 130-134 35.555350000000004 38.0 36.4 38.0 31.8 38.0 135-139 35.1905 38.0 36.2 38.0 30.6 38.0 140-144 34.70995 38.0 36.0 38.0 29.0 38.0 145-149 33.565549999999995 38.0 33.6 38.0 21.2 38.0 150-151 28.756999999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 2.0 5 2.0 6 1.0 7 2.0 8 1.0 9 2.0 10 0.0 11 2.0 12 2.0 13 4.0 14 3.0 15 2.0 16 5.0 17 2.0 18 3.0 19 4.0 20 1.0 21 5.0 22 5.0 23 7.0 24 11.0 25 9.0 26 17.0 27 23.0 28 21.0 29 23.0 30 42.0 31 38.0 32 39.0 33 79.0 34 127.0 35 206.0 36 526.0 37 2777.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.65 18.2 17.275 27.875 2 28.15 25.6 30.875000000000004 15.375 3 22.45 28.175 28.675 20.7 4 25.05 34.125 22.175 18.65 5 24.85 36.3 21.475 17.375 6 20.0 37.65 23.599999999999998 18.75 7 19.7 20.325 39.675 20.3 8 22.45 25.525 26.674999999999997 25.35 9 23.400000000000002 24.15 28.7 23.75 10-14 23.7 28.675 26.090000000000003 21.535 15-19 23.455000000000002 28.310000000000002 27.439999999999998 20.794999999999998 20-24 23.615 28.134999999999998 27.415 20.835 25-29 23.345 28.32 27.24 21.095 30-34 23.43 27.900000000000002 27.99 20.68 35-39 23.35 28.03 27.529999999999998 21.09 40-44 23.735 27.405 27.825 21.035 45-49 23.625 27.145000000000003 28.38 20.849999999999998 50-54 23.294999999999998 28.015 27.71 20.979999999999997 55-59 23.9 27.705000000000002 27.74 20.655 60-64 23.255 27.139999999999997 28.52 21.085 65-69 23.52 27.41 27.845 21.224999999999998 70-74 23.724999999999998 27.93 27.29 21.055 75-79 23.735 27.555000000000003 27.655 21.055 80-84 23.755000000000003 28.110000000000003 27.584999999999997 20.549999999999997 85-89 23.655 27.810000000000002 27.68 20.855 90-94 23.76 27.295 27.915 21.029999999999998 95-99 23.186159307965397 28.201410070503524 27.42137106855343 21.19105955297765 100-104 23.5 27.944999999999997 27.24 21.315 105-109 23.571178558927947 28.10140507025351 27.816390819540977 20.511025551277566 110-114 23.89 28.560000000000002 26.919999999999998 20.630000000000003 115-119 24.8062403120156 27.44137206860343 27.346367318365917 20.40602030101505 120-124 24.104999999999997 27.384999999999998 28.105000000000004 20.405 125-129 25.105 27.965 26.884999999999998 20.044999999999998 130-134 25.405 27.99 26.695 19.91 135-139 25.7 27.655 26.88 19.765 140-144 26.240000000000002 27.725 26.51 19.525000000000002 145-149 25.995 27.495000000000005 26.595000000000002 19.915 150-151 26.700000000000003 27.3875 26.737499999999997 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 2.0 26 2.0 27 2.0 28 6.0 29 8.5 30 12.5 31 20.5 32 27.5 33 32.0 34 43.0 35 56.5 36 67.0 37 81.5 38 111.0 39 155.0 40 187.5 41 221.0 42 251.5 43 261.0 44 287.5 45 279.0 46 268.0 47 272.5 48 255.0 49 213.0 50 161.5 51 147.0 52 135.5 53 109.5 54 85.0 55 68.5 56 47.5 57 31.0 58 25.0 59 19.0 60 15.5 61 11.5 62 5.0 63 4.5 64 2.0 65 1.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.2125 0.0 0.0 0.0 0.0 112-113 3.5875 0.0 0.0 0.0 0.0 114-115 3.9125 0.0 0.0 0.0 0.0 116-117 4.45 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.387499999999999 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.5625 0.0 0.0 0.0 0.0 126-127 7.137499999999999 0.0 0.0 0.0 0.0 128-129 7.824999999999999 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 8.95 0.0 0.0 0.0 0.0 134-135 9.537500000000001 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831921 spots for SRR7168867.sra Written 831921 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra Read 831914 spots for SRR7168867.sra Written 831914 spots for SRR7168867.sra SRR ids: ['SRR7168867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7z2cqgxk SRR7168867.sra spots: 16638287 blocks: [[1, 831914], [831915, 1663828], [1663829, 2495742], [2495743, 3327656], [3327657, 4159570], [4159571, 4991484], [4991485, 5823398], [5823399, 6655312], [6655313, 7487226], [7487227, 8319140], [8319141, 9151054], [9151055, 9982968], [9982969, 10814882], [10814883, 11646796], [11646797, 12478710], [12478711, 13310624], [13310625, 14142538], [14142539, 14974452], [14974453, 15806366], [15806367, 16638287]] SRR7168867 file size 5616469 SRR7168867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168867 SRR7168867_1.fastq SRR7168867_2.fastq Input file: SRR7168867_1.fastq Paired file: SRR7168867_2.fastq trimmed: SRR7168867-trimmed-pair1.fastq, SRR7168867-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 12:43:17 2025 >> started Sat Feb 15 12:47:56 2025 >> done (278.604s) 16638287 read pairs processed; of these: 21094 ( 0.13%) short read pairs filtered out after trimming by size control 25120 ( 0.15%) empty read pairs filtered out after trimming by size control 16592073 (99.72%) read pairs available; of these: 8918258 (53.75%) trimmed read pairs available after processing 7673815 (46.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 8 0.00% 26 6 0.00% 27 12 0.00% 28 6 0.00% 29 7 0.00% 30 15 0.00% 31 8 0.00% 32 9 0.00% 33 11 0.00% 34 22 0.00% 35 20 0.00% 36 23 0.00% 37 10 0.00% 38 18 0.00% 39 22 0.00% 40 21 0.00% 41 33 0.00% 42 43 0.00% 43 42 0.00% 44 40 0.00% 45 59 0.00% 46 60 0.00% 47 59 0.00% 48 77 0.00% 49 89 0.00% 50 82 0.00% 51 128 0.00% 52 142 0.00% 53 130 0.00% 54 173 0.00% 55 174 0.00% 56 155 0.00% 57 227 0.00% 58 255 0.00% 59 282 0.00% 60 314 0.00% 61 411 0.00% 62 437 0.00% 63 491 0.00% 64 535 0.00% 65 612 0.00% 66 715 0.00% 67 828 0.00% 68 890 0.01% 69 1540 0.01% 70 1637 0.01% 71 1330 0.01% 72 1469 0.01% 73 1722 0.01% 74 1991 0.01% 75 2192 0.01% 76 2412 0.01% 77 2692 0.02% 78 3074 0.02% 79 3397 0.02% 80 3766 0.02% 81 4378 0.03% 82 5063 0.03% 83 5735 0.03% 84 6938 0.04% 85 7887 0.05% 86 8686 0.05% 87 9355 0.06% 88 10215 0.06% 89 10701 0.06% 90 11999 0.07% 91 12590 0.08% 92 13474 0.08% 93 14831 0.09% 94 16410 0.10% 95 17433 0.11% 96 18132 0.11% 97 19393 0.12% 98 20169 0.12% 99 21391 0.13% 100 22628 0.14% 101 23866 0.14% 102 25521 0.15% 103 27319 0.16% 104 28597 0.17% 105 30580 0.18% 106 32080 0.19% 107 32791 0.20% 108 33874 0.20% 109 35574 0.21% 110 36633 0.22% 111 38167 0.23% 112 40377 0.24% 113 42543 0.26% 114 44517 0.27% 115 46235 0.28% 116 47424 0.29% 117 48781 0.29% 118 49772 0.30% 119 50833 0.31% 120 52624 0.32% 121 54107 0.33% 122 55460 0.33% 123 58119 0.35% 124 60757 0.37% 125 62079 0.37% 126 64923 0.39% 127 66766 0.40% 128 67522 0.41% 129 69434 0.42% 130 70798 0.43% 131 72984 0.44% 132 75642 0.46% 133 78718 0.47% 134 82181 0.50% 135 86431 0.52% 136 89606 0.54% 137 93684 0.56% 138 97535 0.59% 139 102166 0.62% 140 106707 0.64% 141 114329 0.69% 142 123522 0.74% 143 136983 0.83% 144 155004 0.93% 145 180427 1.09% 146 219441 1.32% 147 286853 1.73% 148 420627 2.54% 149 814059 4.91% 150 3890936 23.45% 151 7673815 46.25% 16592073 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=36.62 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.49 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=31.09 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7168867 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 13:13:18 Started mapping on | Feb 15 13:13:52 Finished on | Feb 15 14:34:28 Mapping speed, Million of reads per hour | 12.35 Number of input reads | 16592073 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15423512 Uniquely mapped reads % | 92.96% Average mapped length | 290.35 Number of splices: Total | 14256082 Number of splices: Annotated (sjdb) | 13935519 Number of splices: GT/AG | 13977525 Number of splices: GC/AG | 231792 Number of splices: AT/AC | 7851 Number of splices: Non-canonical | 38914 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436219 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 81524 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 750522 750522 750522 N_multimapping 436219 436219 436219 N_noFeature 480327 15094514 657180 N_ambiguous 253795 1342 100706 UnstrandedReadsAssigned:14689390 PositiveStrandReadsAssigned:327656 NegativeStrandReadsAssigned:14665626 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7168867 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168867-trimmed-pair1.fastq SRR7168867-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,592,073 reads, 14,768,263 reads pseudoaligned [quant] estimated average fragment length: 223.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7168867.ke.tsv 34699 SRR7168867.se.tsv 87100 total ==> SRR7168867.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.93 566 21.3108 Potri.005G024800.1.v4.1 1035 812.933 122 10.1479 Potri.004G059700.1.v4.1 961 738.956 3 0.274521 Potri.007G009000.2.v4.1 1416 1193.93 1 0.056636 Potri.003G141000.2.v4.1 2943 2720.93 575 14.2897 Potri.016G087400.1.v4.1 270 90.8365 834 620.839 Potri.015G069301.1.v4.1 564 345.569 0 0 Potri.010G195200.1.v4.1 1773 1550.93 13 0.566791 Potri.012G127500.1.v4.1 977 754.945 159 14.2415 ==> SRR7168867.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 796 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 173 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7168867 completed mapping pipeline successfully