Starting /dee2/code/volunteer_pipeline.sh SRR7168868 current disk space = 3091671883776 free memory = 1449324140 SRR7168868 SRAfilesize 0c47b0f15d53d31d08e6327606f96946 SRR7168868.sra SRR7168868.sra file validated SRR7168868 is paired end SRR7168868 is conventional basespace SRR7168868 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24775 34.0 33.0 34.0 32.0 34.0 2 33.0805 34.0 33.0 34.0 32.0 34.0 3 33.104 34.0 33.0 34.0 32.0 34.0 4 33.2165 34.0 33.0 34.0 32.0 34.0 5 33.24975 34.0 33.0 34.0 32.0 34.0 6 37.02125 38.0 37.0 38.0 36.0 38.0 7 37.26625 38.0 38.0 38.0 37.0 38.0 8 37.4215 38.0 38.0 38.0 37.0 38.0 9 37.41825 38.0 38.0 38.0 37.0 38.0 10-14 37.482800000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.484 38.0 38.0 38.0 37.0 38.0 20-24 37.4024 38.0 38.0 38.0 37.0 38.0 25-29 37.35979999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.357000000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.3553 38.0 38.0 38.0 37.0 38.0 40-44 37.28505 38.0 38.0 38.0 37.0 38.0 45-49 37.235 38.0 38.0 38.0 37.0 38.0 50-54 37.23350000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.200300000000006 38.0 38.0 38.0 36.2 38.0 60-64 37.16355 38.0 38.0 38.0 36.0 38.0 65-69 37.0797 38.0 38.0 38.0 36.0 38.0 70-74 37.04295 38.0 38.0 38.0 36.0 38.0 75-79 36.8767 38.0 38.0 38.0 35.4 38.0 80-84 36.86605 38.0 38.0 38.0 35.2 38.0 85-89 36.77505 38.0 38.0 38.0 35.0 38.0 90-94 36.700649999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.519600000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.39385 38.0 38.0 38.0 34.0 38.0 105-109 36.281600000000005 38.0 37.4 38.0 33.8 38.0 110-114 36.047 38.0 37.0 38.0 33.2 38.0 115-119 35.8888 38.0 37.0 38.0 32.2 38.0 120-124 35.71985 38.0 36.6 38.0 31.0 38.0 125-129 35.370200000000004 38.0 36.0 38.0 29.6 38.0 130-134 35.23475 38.0 35.8 38.0 29.0 38.0 135-139 34.85355 38.0 35.0 38.0 28.0 38.0 140-144 34.33505000000001 38.0 34.2 38.0 25.4 38.0 145-149 33.35125 38.0 33.0 38.0 18.8 38.0 150-151 29.4135 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 3.0 18 1.0 19 0.0 20 4.0 21 2.0 22 5.0 23 4.0 24 14.0 25 13.0 26 17.0 27 22.0 28 31.0 29 39.0 30 48.0 31 61.0 32 63.0 33 110.0 34 162.0 35 284.0 36 653.0 37 2460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.056457849961326 14.178912090745039 10.956432070121165 35.80819798917247 2 22.925 18.525 35.075 23.474999999999998 3 19.825 24.125 25.4 30.65 4 21.425 33.975 22.650000000000002 21.95 5 21.825 34.625 24.175 19.375 6 18.35 36.05 25.775 19.825 7 13.975000000000001 23.025000000000002 43.824999999999996 19.175 8 18.175 23.799999999999997 31.6 26.424999999999997 9 18.425 23.925 31.5 26.150000000000002 10-14 20.195 29.065 27.224999999999998 23.515 15-19 19.950000000000003 28.96 27.395000000000003 23.695 20-24 20.305 28.435 27.73 23.53 25-29 20.415 28.42 27.52 23.645 30-34 20.035 28.599999999999998 28.255000000000003 23.11 35-39 20.16 28.84 27.42 23.580000000000002 40-44 20.015 28.93 27.73 23.325000000000003 45-49 20.535 28.835 26.965 23.665 50-54 19.515 28.415000000000003 28.744999999999997 23.325000000000003 55-59 19.785 28.22 27.825 24.169999999999998 60-64 20.255000000000003 28.035 27.935 23.775 65-69 20.325 28.384999999999998 27.41 23.880000000000003 70-74 20.64 27.810000000000002 28.055000000000003 23.494999999999997 75-79 20.185 28.494999999999997 27.32 24.0 80-84 20.044999999999998 28.444999999999997 27.88 23.630000000000003 85-89 20.96 28.4 27.339999999999996 23.3 90-94 20.105 28.349999999999998 27.384999999999998 24.16 95-99 20.605 27.93 27.884999999999998 23.580000000000002 100-104 20.755000000000003 28.105000000000004 27.575 23.565 105-109 20.380000000000003 29.110000000000003 27.33 23.18 110-114 20.36 28.395 27.315 23.93 115-119 20.885 28.610000000000003 27.63 22.875 120-124 20.87 28.59 26.619999999999997 23.919999999999998 125-129 20.645 28.044999999999998 27.46 23.849999999999998 130-134 21.01 28.68 26.38 23.93 135-139 21.46 28.43 26.615 23.494999999999997 140-144 20.64 28.595 26.400000000000002 24.365000000000002 145-149 21.205 28.23 26.27 24.295 150-151 21.9375 28.287499999999998 26.4625 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 3.0 25 6.0 26 7.5 27 8.5 28 6.5 29 13.0 30 22.5 31 29.0 32 36.5 33 40.0 34 54.0 35 82.5 36 92.5 37 113.0 38 140.5 39 162.5 40 205.5 41 224.0 42 228.5 43 267.5 44 280.0 45 266.0 46 244.5 47 214.0 48 211.5 49 193.5 50 161.5 51 132.5 52 117.5 53 103.0 54 70.0 55 53.0 56 50.0 57 41.5 58 29.0 59 23.0 60 19.0 61 13.5 62 9.5 63 7.0 64 4.0 65 2.0 66 2.5 67 2.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.5875000000000004 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.525 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 6.0375 0.0 0.0 0.0 0.0 124-125 6.5 0.0 0.0 0.0 0.0 126-127 7.199999999999999 0.0 0.0 0.0 0.0 128-129 7.8625 0.0 0.0 0.0 0.0 130-131 8.7125 0.0 0.0 0.0 0.0 132-133 9.275 0.0 0.0 0.0 0.0 134-135 9.8 0.0 0.0 0.0 0.0 136-137 10.399999999999999 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGGCT 10 0.006836113 144.9625 4 >>END_MODULE SRR7168868 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168868_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69675 33.0 33.0 34.0 32.0 34.0 2 32.8065 33.0 33.0 34.0 32.0 34.0 3 32.82075 33.0 33.0 34.0 31.0 34.0 4 32.71575 33.0 33.0 34.0 32.0 34.0 5 32.75425 33.0 33.0 34.0 32.0 34.0 6 36.99975 38.0 38.0 38.0 36.0 38.0 7 36.9995 38.0 38.0 38.0 37.0 38.0 8 37.00625 38.0 38.0 38.0 36.0 38.0 9 36.88125 38.0 38.0 38.0 36.0 38.0 10-14 36.95605 38.0 38.0 38.0 36.2 38.0 15-19 36.9686 38.0 38.0 38.0 36.2 38.0 20-24 36.906 38.0 38.0 38.0 36.4 38.0 25-29 36.9387 38.0 38.0 38.0 36.0 38.0 30-34 36.933299999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.8544 38.0 38.0 38.0 36.0 38.0 40-44 36.86805 38.0 38.0 38.0 36.0 38.0 45-49 36.81715 38.0 38.0 38.0 36.0 38.0 50-54 36.777300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.7057 38.0 38.0 38.0 36.0 38.0 60-64 36.66725000000001 38.0 38.0 38.0 35.4 38.0 65-69 36.59445 38.0 38.0 38.0 35.2 38.0 70-74 36.5099 38.0 38.0 38.0 34.6 38.0 75-79 36.41055 38.0 38.0 38.0 34.6 38.0 80-84 36.2441 38.0 38.0 38.0 34.0 38.0 85-89 36.1688 38.0 38.0 38.0 34.0 38.0 90-94 36.0726 38.0 38.0 38.0 33.8 38.0 95-99 36.04835 38.0 38.0 38.0 33.8 38.0 100-104 35.92105 38.0 38.0 38.0 33.2 38.0 105-109 35.853 38.0 37.6 38.0 33.0 38.0 110-114 35.54795 38.0 37.0 38.0 30.6 38.0 115-119 35.29 38.0 36.8 38.0 29.2 38.0 120-124 35.21195 38.0 36.2 38.0 29.6 38.0 125-129 34.89425 38.0 36.0 38.0 27.8 38.0 130-134 34.4961 38.0 35.4 38.0 25.6 38.0 135-139 33.937 38.0 34.6 38.0 22.2 38.0 140-144 33.36055 38.0 33.4 38.0 21.0 38.0 145-149 32.136449999999996 38.0 33.0 38.0 8.6 38.0 150-151 26.86125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 3.0 5 1.0 6 4.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 5.0 13 6.0 14 3.0 15 3.0 16 7.0 17 5.0 18 5.0 19 6.0 20 9.0 21 10.0 22 10.0 23 13.0 24 17.0 25 22.0 26 26.0 27 25.0 28 31.0 29 50.0 30 46.0 31 60.0 32 72.0 33 108.0 34 147.0 35 258.0 36 640.0 37 2387.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 19.3 15.8 26.900000000000002 2 25.674999999999997 26.0 32.0 16.325 3 21.099999999999998 28.7 29.349999999999998 20.849999999999998 4 22.75 37.05 22.15 18.05 5 23.925 35.625 22.7 17.75 6 20.474999999999998 36.175000000000004 23.375 19.975 7 19.650000000000002 20.125 39.125 21.099999999999998 8 20.775 24.5 28.549999999999997 26.174999999999997 9 22.825 25.025 28.825 23.325000000000003 10-14 23.755000000000003 28.01 26.745 21.490000000000002 15-19 22.765 28.144999999999996 27.994999999999997 21.095 20-24 23.27 28.465 28.01 20.255000000000003 25-29 22.535 28.435 28.105000000000004 20.925 30-34 22.935 28.215 28.17 20.68 35-39 22.955000000000002 28.71 27.500000000000004 20.835 40-44 23.400000000000002 28.255000000000003 27.915 20.43 45-49 23.385 28.310000000000002 27.865000000000002 20.44 50-54 23.1 27.515 28.23 21.154999999999998 55-59 23.625 26.985 28.32 21.07 60-64 23.51 27.689999999999998 27.93 20.87 65-69 23.71 27.615000000000002 28.27 20.405 70-74 23.125 27.21 28.645 21.02 75-79 23.52 27.82 28.03 20.630000000000003 80-84 23.015 28.01 28.02 20.955 85-89 23.880000000000003 28.105000000000004 26.924999999999997 21.09 90-94 23.745 27.675 27.98 20.599999999999998 95-99 23.369999999999997 28.355000000000004 27.915 20.36 100-104 23.595 27.485 28.095 20.825 105-109 23.66 27.860000000000003 28.275 20.205000000000002 110-114 23.955000000000002 28.915000000000003 26.96 20.169999999999998 115-119 24.505 27.860000000000003 27.884999999999998 19.75 120-124 24.03 28.345 27.310000000000002 20.315 125-129 24.975 27.939999999999998 27.034999999999997 20.05 130-134 25.424999999999997 27.755000000000003 27.139999999999997 19.68 135-139 24.975 28.37 26.77 19.885 140-144 25.495 27.715 27.38 19.41 145-149 25.535000000000004 28.18 26.784999999999997 19.5 150-151 27.0125 27.4125 26.787499999999998 18.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.5 27 3.0 28 5.5 29 9.0 30 12.0 31 16.0 32 24.0 33 35.0 34 48.5 35 62.0 36 92.5 37 126.0 38 149.0 39 163.5 40 193.5 41 229.5 42 265.5 43 286.0 44 266.5 45 267.5 46 267.0 47 245.5 48 224.5 49 197.5 50 169.0 51 140.0 52 101.5 53 79.0 54 74.0 55 62.5 56 42.0 57 28.5 58 27.0 59 22.5 60 12.5 61 8.0 62 8.5 63 4.5 64 3.0 65 3.0 66 2.5 67 2.5 68 1.5 69 1.5 70 2.5 71 2.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5790533736153072 1.15 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.525 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.512499999999999 0.0 0.0 0.0 0.0 126-127 7.199999999999999 0.0 0.0 0.0 0.0 128-129 7.875 0.0 0.0 0.0 0.0 130-131 8.7875 0.0 0.0 0.0 0.0 132-133 9.375 0.0 0.0 0.0 0.0 134-135 9.925 0.0 0.0 0.0 0.0 136-137 10.475000000000001 0.0 0.0 0.0 0.0 138-139 11.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCCA 10 0.006830828 145.0 4 CTTAACT 10 0.006830828 145.0 8 >>END_MODULE Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975214 spots for SRR7168868.sra Written 975214 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra Read 975211 spots for SRR7168868.sra Written 975211 spots for SRR7168868.sra SRR ids: ['SRR7168868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w8lwzc8_ SRR7168868.sra spots: 19504223 blocks: [[1, 975211], [975212, 1950422], [1950423, 2925633], [2925634, 3900844], [3900845, 4876055], [4876056, 5851266], [5851267, 6826477], [6826478, 7801688], [7801689, 8776899], [8776900, 9752110], [9752111, 10727321], [10727322, 11702532], [11702533, 12677743], [12677744, 13652954], [13652955, 14628165], [14628166, 15603376], [15603377, 16578587], [16578588, 17553798], [17553799, 18529009], [18529010, 19504223]] SRR7168868 file size 6587640 SRR7168868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168868 SRR7168868_1.fastq SRR7168868_2.fastq Input file: SRR7168868_1.fastq Paired file: SRR7168868_2.fastq trimmed: SRR7168868-trimmed-pair1.fastq, SRR7168868-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 10:19:12 2025 >> started Sat Feb 15 10:19:43 2025 >> done (30.701s) 19504223 read pairs processed; of these: 30779 ( 0.16%) short read pairs filtered out after trimming by size control 39958 ( 0.20%) empty read pairs filtered out after trimming by size control 19433486 (99.64%) read pairs available; of these: 11546300 (59.41%) trimmed read pairs available after processing 7887186 (40.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 11 0.00% 25 12 0.00% 26 13 0.00% 27 10 0.00% 28 14 0.00% 29 11 0.00% 30 9 0.00% 31 10 0.00% 32 16 0.00% 33 19 0.00% 34 21 0.00% 35 22 0.00% 36 28 0.00% 37 30 0.00% 38 37 0.00% 39 41 0.00% 40 31 0.00% 41 57 0.00% 42 69 0.00% 43 81 0.00% 44 73 0.00% 45 91 0.00% 46 92 0.00% 47 113 0.00% 48 107 0.00% 49 132 0.00% 50 166 0.00% 51 202 0.00% 52 224 0.00% 53 218 0.00% 54 285 0.00% 55 297 0.00% 56 306 0.00% 57 386 0.00% 58 392 0.00% 59 474 0.00% 60 501 0.00% 61 633 0.00% 62 698 0.00% 63 840 0.00% 64 898 0.00% 65 1034 0.01% 66 1076 0.01% 67 1308 0.01% 68 1469 0.01% 69 2270 0.01% 70 2277 0.01% 71 2128 0.01% 72 2481 0.01% 73 2871 0.01% 74 3134 0.02% 75 3545 0.02% 76 3955 0.02% 77 4277 0.02% 78 4807 0.02% 79 5348 0.03% 80 5932 0.03% 81 6809 0.04% 82 7751 0.04% 83 8741 0.04% 84 10971 0.06% 85 12066 0.06% 86 12694 0.07% 87 13744 0.07% 88 14562 0.07% 89 15386 0.08% 90 16692 0.09% 91 18500 0.10% 92 19722 0.10% 93 21739 0.11% 94 23488 0.12% 95 24838 0.13% 96 26145 0.13% 97 27483 0.14% 98 28410 0.15% 99 29402 0.15% 100 31447 0.16% 101 33216 0.17% 102 35453 0.18% 103 37903 0.20% 104 39858 0.21% 105 41953 0.22% 106 43598 0.22% 107 44735 0.23% 108 45739 0.24% 109 47635 0.25% 110 48366 0.25% 111 50322 0.26% 112 53008 0.27% 113 56095 0.29% 114 57919 0.30% 115 60780 0.31% 116 62700 0.32% 117 63713 0.33% 118 64982 0.33% 119 65748 0.34% 120 67900 0.35% 121 69750 0.36% 122 72227 0.37% 123 75636 0.39% 124 78980 0.41% 125 81347 0.42% 126 85243 0.44% 127 87243 0.45% 128 88050 0.45% 129 90687 0.47% 130 93241 0.48% 131 95188 0.49% 132 99349 0.51% 133 103680 0.53% 134 109060 0.56% 135 114429 0.59% 136 120228 0.62% 137 125718 0.65% 138 132838 0.68% 139 140422 0.72% 140 146853 0.76% 141 158533 0.82% 142 172839 0.89% 143 191269 0.98% 144 217431 1.12% 145 255531 1.31% 146 313084 1.61% 147 408472 2.10% 148 591981 3.05% 149 1114144 5.73% 150 4665026 24.01% 151 7887186 40.59% 19433486 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=10.40 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=2.8 sequence=TGCTTGCTTCTAATCTTAA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=12 prefix-density=0.44 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=58.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.5 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7168868 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 10:20:58 Started mapping on | Feb 15 10:20:59 Finished on | Feb 15 10:23:23 Mapping speed, Million of reads per hour | 485.84 Number of input reads | 19433486 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17861486 Uniquely mapped reads % | 91.91% Average mapped length | 288.63 Number of splices: Total | 16551070 Number of splices: Annotated (sjdb) | 16126747 Number of splices: GT/AG | 16230773 Number of splices: GC/AG | 258160 Number of splices: AT/AC | 10274 Number of splices: Non-canonical | 51863 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540200 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 280477 % of reads mapped to too many loci | 1.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1057862 1057862 1057862 N_multimapping 540200 540200 540200 N_noFeature 777575 17490364 996741 N_ambiguous 283192 1799 129942 UnstrandedReadsAssigned:16800719 PositiveStrandReadsAssigned:369323 NegativeStrandReadsAssigned:16734803 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7168868 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168868-trimmed-pair1.fastq SRR7168868-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,433,486 reads, 16,974,126 reads pseudoaligned [quant] estimated average fragment length: 217.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR7168868.ke.tsv 34699 SRR7168868.se.tsv 87100 total ==> SRR7168868.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.21 1139 38.1757 Potri.005G024800.1.v4.1 1035 818.214 287 21.176 Potri.004G059700.1.v4.1 961 744.224 16 1.29791 Potri.007G009000.2.v4.1 1416 1199.21 0 0 Potri.003G141000.2.v4.1 2943 2726.21 1171.43 25.941 Potri.016G087400.1.v4.1 270 92.5725 837 545.849 Potri.015G069301.1.v4.1 564 350.713 0 0 Potri.010G195200.1.v4.1 1773 1556.21 101 3.91815 Potri.012G127500.1.v4.1 977 760.224 195 15.4854 ==> SRR7168868.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 985 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7168868 completed mapping pipeline successfully