Starting /dee2/code/volunteer_pipeline.sh SRR7168869 current disk space = 3091408105472 free memory = 1494712348 SRR7168869 SRAfilesize 5ef5cb8d0e6d416c46c562074017ab18 SRR7168869.sra SRR7168869.sra file validated SRR7168869 is paired end SRR7168869 is conventional basespace SRR7168869 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17725 34.0 33.0 34.0 32.0 34.0 2 33.20775 34.0 33.0 34.0 32.0 34.0 3 33.24425 34.0 33.0 34.0 32.0 34.0 4 33.46625 34.0 33.0 34.0 33.0 34.0 5 33.42875 34.0 33.0 34.0 33.0 34.0 6 37.224 38.0 38.0 38.0 36.0 38.0 7 37.2985 38.0 38.0 38.0 37.0 38.0 8 37.45925 38.0 38.0 38.0 37.0 38.0 9 37.38075 38.0 38.0 38.0 37.0 38.0 10-14 37.50165 38.0 38.0 38.0 37.2 38.0 15-19 37.46585 38.0 38.0 38.0 37.4 38.0 20-24 37.424549999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.39535 38.0 38.0 38.0 37.0 38.0 30-34 37.44735000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.39675 38.0 38.0 38.0 37.0 38.0 40-44 37.386300000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.325649999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3741 38.0 38.0 38.0 37.0 38.0 55-59 37.29520000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.219 38.0 38.0 38.0 36.4 38.0 65-69 37.153749999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.10125 38.0 38.0 38.0 36.0 38.0 75-79 37.018950000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.92305 38.0 38.0 38.0 35.8 38.0 85-89 36.846000000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.7453 38.0 38.0 38.0 35.0 38.0 95-99 36.65645 38.0 38.0 38.0 34.6 38.0 100-104 36.530950000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.4207 38.0 38.0 38.0 34.0 38.0 110-114 36.2174 38.0 37.4 38.0 33.4 38.0 115-119 36.091550000000005 38.0 37.2 38.0 33.0 38.0 120-124 35.844550000000005 38.0 37.0 38.0 31.8 38.0 125-129 35.66025 38.0 36.6 38.0 31.4 38.0 130-134 35.2574 38.0 36.0 38.0 29.4 38.0 135-139 35.077799999999996 38.0 35.8 38.0 28.2 38.0 140-144 34.53315 38.0 34.8 38.0 26.8 38.0 145-149 33.646350000000005 38.0 33.0 38.0 22.6 38.0 150-151 28.908749999999998 35.0 24.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 2.0 20 6.0 21 1.0 22 6.0 23 6.0 24 5.0 25 6.0 26 18.0 27 18.0 28 27.0 29 32.0 30 50.0 31 58.0 32 72.0 33 104.0 34 143.0 35 240.0 36 637.0 37 2561.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.80501174628035 12.633777081701906 12.242234403549986 38.31897676846776 2 22.0 18.7 33.900000000000006 25.4 3 19.575 23.575 25.924999999999997 30.925000000000004 4 23.075000000000003 30.75 22.675 23.5 5 22.136068034017008 35.392696348174084 23.336668334167083 19.13456728364182 6 18.7 37.375 24.8 19.125 7 14.625 23.974999999999998 43.675000000000004 17.724999999999998 8 18.65 25.474999999999998 29.9 25.974999999999998 9 18.35 24.2 32.025 25.424999999999997 10-14 19.82 29.520000000000003 26.795 23.865 15-19 19.794999999999998 28.57 27.715 23.919999999999998 20-24 19.505 28.544999999999998 28.29 23.66 25-29 19.435 28.549999999999997 27.915 24.099999999999998 30-34 19.15 28.705000000000002 28.055000000000003 24.09 35-39 20.125 28.175 28.04 23.66 40-44 20.05 28.935 27.71 23.305 45-49 19.81 28.43 28.115000000000002 23.645 50-54 20.035 28.549999999999997 28.18 23.235 55-59 19.77 28.73 28.060000000000002 23.44 60-64 20.175 29.275000000000002 27.36 23.189999999999998 65-69 20.21 27.900000000000002 28.175 23.715 70-74 19.805 28.315 28.16 23.72 75-79 19.814999999999998 28.63 28.139999999999997 23.415 80-84 20.1 28.470000000000002 27.565 23.865 85-89 20.44 28.435 27.825 23.3 90-94 20.105 28.375 27.49 24.03 95-99 20.895 27.944999999999997 27.48 23.68 100-104 20.11 28.705000000000002 27.79 23.395 105-109 20.16 28.365000000000002 27.815 23.66 110-114 20.325 28.249999999999996 27.505000000000003 23.919999999999998 115-119 20.3 28.939999999999998 27.445000000000004 23.315 120-124 20.125 28.38 27.400000000000002 24.095 125-129 20.51 28.804999999999996 27.32 23.365 130-134 20.365 29.26 27.150000000000002 23.225 135-139 21.0 28.294999999999998 26.88 23.825 140-144 20.735 27.985 27.505000000000003 23.775 145-149 20.43 28.444999999999997 27.065 24.060000000000002 150-151 20.115374968648105 28.75595685979433 27.037873087534486 24.090795084023075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.5 24 2.5 25 4.5 26 7.0 27 11.0 28 13.5 29 12.5 30 19.5 31 30.0 32 39.0 33 45.5 34 59.0 35 75.5 36 87.5 37 102.5 38 137.5 39 176.0 40 195.0 41 215.5 42 237.0 43 253.5 44 266.5 45 281.0 46 268.5 47 241.0 48 231.0 49 204.5 50 171.0 51 136.5 52 103.5 53 89.5 54 72.0 55 52.5 56 42.0 57 33.5 58 25.0 59 19.5 60 12.5 61 7.5 62 5.0 63 2.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2250000000000005 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82456140350877 99.575 2 0.15037593984962408 0.3 3 0.0 0.0 4 0.0 0.0 5 0.02506265664160401 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCACAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.675000000000001 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.637499999999999 0.0 0.0 0.0 0.0 138-139 7.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGTAT 10 0.006333164 148.66666 1 TTGATAG 10 0.0068378756 144.95 7 CCCCTTT 10 0.0068378756 144.95 2 TTTGATA 10 0.0068378756 144.95 6 AACTCCA 35 0.0029944414 63.714283 145 ACGTCTG 35 0.00354369 20.707142 135-139 CACGTCT 35 0.00354369 20.707142 135-139 CTGAACT 35 0.00354369 20.707142 140-144 AGCACAC 35 0.00354369 20.707142 130-134 GAGCACA 40 0.0076702754 18.11875 130-134 TGAACTC 40 0.0076702754 18.11875 140-144 >>END_MODULE SRR7168869 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168869_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.45 33.0 32.0 34.0 27.0 34.0 2 31.53825 33.0 32.0 34.0 27.0 34.0 3 31.5785 33.0 32.0 34.0 27.0 34.0 4 31.49575 33.0 32.0 34.0 27.0 34.0 5 31.3835 33.0 32.0 34.0 27.0 34.0 6 35.268 38.0 37.0 38.0 29.0 38.0 7 35.4905 38.0 37.0 38.0 29.0 38.0 8 35.42 38.0 37.0 38.0 29.0 38.0 9 35.288 38.0 37.0 38.0 29.0 38.0 10-14 35.20675 38.0 37.0 38.0 28.6 38.0 15-19 35.1438 38.0 37.0 38.0 28.0 38.0 20-24 34.99105 38.0 36.6 38.0 27.6 38.0 25-29 34.8691 38.0 36.8 38.0 26.6 38.0 30-34 34.9147 38.0 36.0 38.0 27.0 38.0 35-39 34.7016 38.0 36.0 38.0 25.4 38.0 40-44 34.69505 38.0 36.0 38.0 25.4 38.0 45-49 34.57695 38.0 36.0 38.0 25.4 38.0 50-54 34.367200000000004 38.0 36.0 38.0 22.8 38.0 55-59 34.23434999999999 38.0 35.8 38.0 19.4 38.0 60-64 34.016299999999994 38.0 35.2 38.0 17.6 38.0 65-69 33.87925 38.0 35.0 38.0 16.0 38.0 70-74 33.71939999999999 38.0 34.2 38.0 16.0 38.0 75-79 33.6025 38.0 34.0 38.0 16.0 38.0 80-84 33.201550000000005 38.0 34.0 38.0 15.6 38.0 85-89 32.8458 38.0 33.4 38.0 15.0 38.0 90-94 32.38045 38.0 31.4 38.0 15.0 38.0 95-99 32.3357 38.0 31.8 38.0 15.0 38.0 100-104 31.8397 37.6 30.6 38.0 15.0 38.0 105-109 31.682000000000006 37.6 30.4 38.0 15.0 38.0 110-114 31.342949999999995 37.0 29.8 38.0 15.0 38.0 115-119 30.68175 37.0 27.6 38.0 13.6 38.0 120-124 29.87135 36.0 25.2 38.0 8.6 38.0 125-129 29.420250000000003 36.0 23.6 38.0 2.0 38.0 130-134 28.26535 35.0 20.2 38.0 2.0 38.0 135-139 26.87865 33.0 14.2 38.0 2.0 38.0 140-144 25.48235 33.0 12.8 38.0 2.0 38.0 145-149 23.4476 32.2 2.0 38.0 2.0 38.0 150-151 18.485875 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 16.0 4 11.0 5 5.0 6 6.0 7 10.0 8 5.0 9 10.0 10 11.0 11 12.0 12 14.0 13 20.0 14 18.0 15 21.0 16 24.0 17 32.0 18 30.0 19 41.0 20 44.0 21 50.0 22 50.0 23 44.0 24 51.0 25 84.0 26 75.0 27 85.0 28 93.0 29 83.0 30 127.0 31 124.0 32 148.0 33 196.0 34 310.0 35 418.0 36 782.0 37 913.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 20.1 18.099999999999998 26.650000000000002 2 28.446334751063297 25.819364523392547 29.572179134350762 16.162121591193397 3 21.296296296296298 28.803803803803802 29.679679679679676 20.22022022022022 4 22.96518908089156 36.4137240170298 22.664663160530928 17.95642374154771 5 25.400400400400404 34.75975975975976 22.57257257257257 17.26726726726727 6 19.45 38.45 23.3 18.8 7 18.325 19.5 41.475 20.7 8 22.35 24.275 28.249999999999996 25.124999999999996 9 22.15 25.6 29.475 22.775000000000002 10-14 23.46852027804171 28.359253888083213 26.784017602640397 21.388208231234685 15-19 23.2746549309862 28.300660132026405 27.650530106021204 20.774154830966193 20-24 22.60969630259669 28.648621604042628 27.99819882923901 20.74348326412168 25-29 23.19203243080927 28.416996146339024 27.811420849807316 20.579550573044394 30-34 22.682011508631476 28.501376032024016 27.6257192894671 21.19089316987741 35-39 22.618272841051315 28.58072590738423 27.939924906132667 20.86107634543179 40-44 23.073461019152873 28.484272640896137 27.71915787368105 20.72310846626994 45-49 22.763414512176826 27.954193128969347 28.489273391008652 20.793118967845174 50-54 23.025361412635686 28.257715972187487 27.917562903306486 20.79935971187034 55-59 23.60680340170085 28.344172086043024 27.723861930965484 20.325162581290645 60-64 23.3184977746662 28.31424713707056 28.029204380657095 20.338050707606143 65-69 23.257443082311735 28.071053289967473 28.2661996497373 20.40530397798349 70-74 23.68012810889256 27.893709653205224 27.923735174898663 20.50242706300355 75-79 23.01956663163689 28.39413501476255 27.57844167542411 21.007856678176452 80-84 23.717017974265257 28.198067390977823 27.577229259500324 20.507685375256596 85-89 23.331163303119837 27.943312133807403 27.948319895838548 20.777204667234216 90-94 23.135410934920714 28.923015356910607 27.447351308088642 20.494222400080037 95-99 23.62618130906545 28.091404570228512 27.66638331916596 20.616030801540077 100-104 23.77618880944047 28.38641932096605 27.486374318715935 20.351017550877543 105-109 23.57853678051708 28.079211881782268 28.104215632344854 20.238035705355802 110-114 23.808332916520783 28.58000300105037 27.299554844195466 20.31210923823338 115-119 23.883135724648557 28.39561758967432 27.53514432938116 20.18610235629596 120-124 23.807617236374558 28.552124518292377 27.646263950753212 19.99399429457985 125-129 24.386948253428084 28.48563707336603 27.504754278850967 19.622660394354916 130-134 24.393544506816358 28.648757016840413 26.934643143544506 20.023055332798716 135-139 24.31174291720893 28.691560716788466 26.964661127239964 20.03203523876264 140-144 23.965784603071384 28.85298384272923 27.132209494272423 20.049022059926966 145-149 25.047504750475046 29.062906290629066 26.292629262926294 19.596959695969595 150-151 25.474999999999998 28.999999999999996 26.4125 19.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 2.0 24 4.0 25 5.0 26 6.0 27 7.5 28 12.0 29 14.0 30 14.0 31 17.5 32 26.5 33 40.0 34 58.0 35 63.0 36 79.0 37 109.5 38 138.0 39 170.0 40 195.0 41 232.0 42 261.5 43 283.0 44 294.0 45 280.0 46 265.0 47 245.0 48 211.0 49 182.0 50 167.0 51 132.5 52 106.5 53 93.0 54 72.0 55 57.5 56 40.0 57 34.5 58 26.5 59 14.5 60 12.0 61 9.0 62 4.0 63 4.5 64 4.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.17500000000000002 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.02 20-24 0.065 25-29 0.095 30-34 0.075 35-39 0.125 40-44 0.015 45-49 0.015 50-54 0.045 55-59 0.05 60-64 0.015 65-69 0.075 70-74 0.08499999999999999 75-79 0.08499999999999999 80-84 0.135 85-89 0.155 90-94 0.045 95-99 0.005 100-104 0.005 105-109 0.015 110-114 0.034999999999999996 115-119 0.055 120-124 0.095 125-129 0.09 130-134 0.24 135-139 0.11 140-144 0.045 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGTCT 10 0.0068133115 145.10127 7 GATGCTG 10 0.0068133115 145.10127 9 CGTGTAG 35 0.003520776 20.728752 135-139 >>END_MODULE Read 824284 spots for SRR7168869.sra Written 824284 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra Read 824273 spots for SRR7168869.sra Written 824273 spots for SRR7168869.sra SRR ids: ['SRR7168869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1pukx74c SRR7168869.sra spots: 16485471 blocks: [[1, 824273], [824274, 1648546], [1648547, 2472819], [2472820, 3297092], [3297093, 4121365], [4121366, 4945638], [4945639, 5769911], [5769912, 6594184], [6594185, 7418457], [7418458, 8242730], [8242731, 9067003], [9067004, 9891276], [9891277, 10715549], [10715550, 11539822], [11539823, 12364095], [12364096, 13188368], [13188369, 14012641], [14012642, 14836914], [14836915, 15661187], [15661188, 16485471]] SRR7168869 file size 5564684 SRR7168869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168869 SRR7168869_1.fastq SRR7168869_2.fastq Input file: SRR7168869_1.fastq Paired file: SRR7168869_2.fastq trimmed: SRR7168869-trimmed-pair1.fastq, SRR7168869-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 13:19:15 2025 >> started Sat Feb 15 13:24:51 2025 >> done (335.588s) 16485471 read pairs processed; of these: 74561 ( 0.45%) short read pairs filtered out after trimming by size control 209994 ( 1.27%) empty read pairs filtered out after trimming by size control 16200916 (98.27%) read pairs available; of these: 9650839 (59.57%) trimmed read pairs available after processing 6550077 (40.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 7 0.00% 21 2 0.00% 22 7 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 8 0.00% 27 5 0.00% 28 10 0.00% 29 14 0.00% 30 18 0.00% 31 8 0.00% 32 16 0.00% 33 16 0.00% 34 12 0.00% 35 20 0.00% 36 21 0.00% 37 21 0.00% 38 25 0.00% 39 23 0.00% 40 25 0.00% 41 36 0.00% 42 32 0.00% 43 39 0.00% 44 33 0.00% 45 56 0.00% 46 57 0.00% 47 62 0.00% 48 56 0.00% 49 73 0.00% 50 106 0.00% 51 96 0.00% 52 135 0.00% 53 140 0.00% 54 167 0.00% 55 152 0.00% 56 180 0.00% 57 214 0.00% 58 243 0.00% 59 319 0.00% 60 286 0.00% 61 350 0.00% 62 400 0.00% 63 466 0.00% 64 585 0.00% 65 630 0.00% 66 723 0.00% 67 814 0.01% 68 976 0.01% 69 2096 0.01% 70 1797 0.01% 71 1396 0.01% 72 1457 0.01% 73 1648 0.01% 74 1829 0.01% 75 1936 0.01% 76 2242 0.01% 77 2489 0.02% 78 2753 0.02% 79 3146 0.02% 80 3457 0.02% 81 3960 0.02% 82 4532 0.03% 83 5379 0.03% 84 9532 0.06% 85 12316 0.08% 86 12386 0.08% 87 11975 0.07% 88 12313 0.08% 89 12748 0.08% 90 13319 0.08% 91 13716 0.08% 92 14389 0.09% 93 15876 0.10% 94 16072 0.10% 95 16761 0.10% 96 17593 0.11% 97 18430 0.11% 98 18742 0.12% 99 19780 0.12% 100 20647 0.13% 101 21639 0.13% 102 23019 0.14% 103 24053 0.15% 104 25156 0.16% 105 27016 0.17% 106 27491 0.17% 107 28676 0.18% 108 29648 0.18% 109 30643 0.19% 110 32027 0.20% 111 33241 0.21% 112 35058 0.22% 113 36604 0.23% 114 37981 0.23% 115 40088 0.25% 116 41646 0.26% 117 43108 0.27% 118 44585 0.28% 119 46098 0.28% 120 47489 0.29% 121 49813 0.31% 122 52079 0.32% 123 55297 0.34% 124 57550 0.36% 125 60067 0.37% 126 63811 0.39% 127 65795 0.41% 128 68465 0.42% 129 72229 0.45% 130 75106 0.46% 131 78214 0.48% 132 82458 0.51% 133 86393 0.53% 134 92317 0.57% 135 98461 0.61% 136 104510 0.65% 137 110826 0.68% 138 117476 0.73% 139 125511 0.77% 140 134802 0.83% 141 145458 0.90% 142 161342 1.00% 143 180976 1.12% 144 205246 1.27% 145 240210 1.48% 146 293551 1.81% 147 381399 2.35% 148 545916 3.37% 149 988725 6.10% 150 3877142 23.93% 151 6550077 40.43% 16200916 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=33.42 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=42.16 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7168869 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 13:50:16 Started mapping on | Feb 15 13:50:42 Finished on | Feb 15 14:27:20 Mapping speed, Million of reads per hour | 26.53 Number of input reads | 16200916 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15171961 Uniquely mapped reads % | 93.65% Average mapped length | 289.62 Number of splices: Total | 14052106 Number of splices: Annotated (sjdb) | 13698482 Number of splices: GT/AG | 13787144 Number of splices: GC/AG | 213413 Number of splices: AT/AC | 9225 Number of splices: Non-canonical | 42324 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408426 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 36427 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 696684 696684 696684 N_multimapping 408426 408426 408426 N_noFeature 702901 14830862 918006 N_ambiguous 231489 2117 103865 UnstrandedReadsAssigned:14237571 PositiveStrandReadsAssigned:338982 NegativeStrandReadsAssigned:14150090 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7168869 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168869-trimmed-pair1.fastq SRR7168869-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,200,916 reads, 14,185,650 reads pseudoaligned [quant] estimated average fragment length: 240.605 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR7168869.ke.tsv 34699 SRR7168869.se.tsv 87100 total ==> SRR7168869.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.39 950 38.9248 Potri.005G024800.1.v4.1 1035 795.395 346 31.6974 Potri.004G059700.1.v4.1 961 721.454 12 1.212 Potri.007G009000.2.v4.1 1416 1176.39 0 0 Potri.003G141000.2.v4.1 2943 2703.39 1011.93 27.2753 Potri.016G087400.1.v4.1 270 83.953 764 663.114 Potri.015G069301.1.v4.1 564 329.906 0 0 Potri.010G195200.1.v4.1 1773 1533.39 35 1.6632 Potri.012G127500.1.v4.1 977 737.417 427 42.1935 ==> SRR7168869.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1036 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7168869 completed mapping pipeline successfully