Starting /dee2/code/volunteer_pipeline.sh SRR7168870 current disk space = 3091263913984 free memory = 1467801560 SRR7168870 SRAfilesize 015471eb4b0973ed4bf13191335aea11 SRR7168870.sra SRR7168870.sra file validated SRR7168870 is paired end SRR7168870 is conventional basespace SRR7168870 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168870_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.072 34.0 33.0 34.0 32.0 34.0 2 33.23625 34.0 33.0 34.0 32.0 34.0 3 33.20875 34.0 33.0 34.0 32.0 34.0 4 33.35675 34.0 33.0 34.0 33.0 34.0 5 33.3605 34.0 33.0 34.0 33.0 34.0 6 37.1795 38.0 38.0 38.0 36.0 38.0 7 37.3815 38.0 38.0 38.0 37.0 38.0 8 37.46525 38.0 38.0 38.0 37.0 38.0 9 37.5605 38.0 38.0 38.0 38.0 38.0 10-14 37.597449999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5668 38.0 38.0 38.0 38.0 38.0 20-24 37.5055 38.0 38.0 38.0 37.8 38.0 25-29 37.48505 38.0 38.0 38.0 38.0 38.0 30-34 37.450900000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.41525 38.0 38.0 38.0 37.2 38.0 40-44 37.45065 38.0 38.0 38.0 37.4 38.0 45-49 37.39135 38.0 38.0 38.0 37.0 38.0 50-54 37.35725 38.0 38.0 38.0 37.0 38.0 55-59 37.256299999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.2325 38.0 38.0 38.0 37.0 38.0 65-69 37.148649999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.14015 38.0 38.0 38.0 36.4 38.0 75-79 37.0823 38.0 38.0 38.0 36.0 38.0 80-84 37.005250000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.914 38.0 38.0 38.0 36.0 38.0 90-94 36.739700000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.73695 38.0 38.0 38.0 35.0 38.0 100-104 36.623000000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.56315000000001 38.0 38.0 38.0 34.2 38.0 110-114 36.333299999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.2022 38.0 37.8 38.0 33.8 38.0 120-124 36.02405 38.0 37.0 38.0 33.2 38.0 125-129 35.6948 38.0 36.6 38.0 31.6 38.0 130-134 35.248799999999996 38.0 36.0 38.0 29.8 38.0 135-139 34.674350000000004 38.0 35.0 38.0 27.2 38.0 140-144 34.2469 38.0 33.4 38.0 25.8 38.0 145-149 33.33825 38.0 33.0 38.0 20.6 38.0 150-151 28.3745 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.0 19 2.0 20 10.0 21 1.0 22 7.0 23 8.0 24 8.0 25 20.0 26 15.0 27 21.0 28 19.0 29 23.0 30 31.0 31 42.0 32 69.0 33 85.0 34 134.0 35 255.0 36 684.0 37 2557.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.66362451108214 12.25554106910039 13.089960886571056 40.990873533246415 2 22.525000000000002 17.349999999999998 34.825 25.3 3 21.4 22.75 24.224999999999998 31.624999999999996 4 23.474999999999998 32.75 20.375 23.400000000000002 5 22.825 35.475 23.474999999999998 18.224999999999998 6 17.549999999999997 37.925 25.45 19.075 7 14.000000000000002 24.575 43.725 17.7 8 18.975 23.674999999999997 31.275 26.075 9 17.275 24.224999999999998 32.775 25.724999999999998 10-14 20.48 29.709999999999997 26.895000000000003 22.915 15-19 19.6 28.410000000000004 28.194999999999997 23.794999999999998 20-24 20.44 29.005 27.63 22.925 25-29 19.905 29.345 27.894999999999996 22.855 30-34 20.225 28.9 27.450000000000003 23.425 35-39 20.275000000000002 29.425 27.41 22.89 40-44 19.495 29.21 28.1 23.195 45-49 19.955000000000002 29.32 27.96 22.765 50-54 19.835 28.810000000000002 27.689999999999998 23.665 55-59 20.07 29.15 27.715 23.064999999999998 60-64 20.275000000000002 28.92 27.884999999999998 22.919999999999998 65-69 20.22 28.610000000000003 27.375 23.794999999999998 70-74 19.919999999999998 28.555000000000003 28.349999999999998 23.175 75-79 20.330000000000002 29.345 27.505000000000003 22.82 80-84 20.465 28.465 27.48 23.59 85-89 20.48 28.59 27.845 23.085 90-94 20.535 28.345 28.15 22.97 95-99 20.255000000000003 28.77 27.955000000000002 23.02 100-104 19.86 28.999999999999996 27.735 23.405 105-109 20.125 28.62 27.805000000000003 23.45 110-114 20.04 28.93 27.54 23.49 115-119 20.424999999999997 28.76 27.415 23.400000000000002 120-124 20.735 29.255 26.840000000000003 23.169999999999998 125-129 20.265 28.999999999999996 27.715 23.02 130-134 20.599999999999998 28.634999999999998 27.1 23.665 135-139 20.995 27.97 27.465 23.57 140-144 21.375 28.265 27.01 23.35 145-149 20.64 28.49 27.07 23.799999999999997 150-151 20.75 28.749999999999996 26.900000000000002 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 1.0 22 1.5 23 1.5 24 4.0 25 4.0 26 3.0 27 7.5 28 12.0 29 15.5 30 21.5 31 25.0 32 40.5 33 57.5 34 64.5 35 82.0 36 109.5 37 130.5 38 157.0 39 181.0 40 193.5 41 214.5 42 235.5 43 254.5 44 265.0 45 266.5 46 252.5 47 233.0 48 220.0 49 183.0 50 153.5 51 141.5 52 111.0 53 80.5 54 63.0 55 51.5 56 44.5 57 34.0 58 22.0 59 17.0 60 12.0 61 8.5 62 7.0 63 4.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.7625 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.4625000000000004 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 3.0 0.0 0.0 0.0 0.0 110-111 3.4125 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114-115 4.112500000000001 0.0 0.0 0.0 0.0 116-117 4.4625 0.0 0.0 0.0 0.0 118-119 4.8375 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.6875 0.0 0.0 0.0 0.0 124-125 6.225 0.0 0.0 0.0 0.0 126-127 6.675000000000001 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.699999999999999 0.0 0.0 0.0 0.0 132-133 8.1875 0.0 0.0 0.0 0.0 134-135 8.65 0.0 0.0 0.0 0.0 136-137 9.274999999999999 0.0 0.0 0.0 0.0 138-139 9.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAAG 10 0.006836113 144.9625 5 TCAAATG 10 0.006836113 144.9625 7 >>END_MODULE SRR7168870 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168870_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0075 33.0 33.0 34.0 32.0 34.0 2 33.11775 34.0 33.0 34.0 33.0 34.0 3 33.164 34.0 33.0 34.0 33.0 34.0 4 33.072 34.0 33.0 34.0 33.0 34.0 5 33.12775 34.0 33.0 34.0 33.0 34.0 6 37.29125 38.0 38.0 38.0 37.0 38.0 7 37.388 38.0 38.0 38.0 37.0 38.0 8 37.2835 38.0 38.0 38.0 37.0 38.0 9 37.36325 38.0 38.0 38.0 38.0 38.0 10-14 37.28105 38.0 38.0 38.0 37.0 38.0 15-19 37.25125 38.0 38.0 38.0 37.0 38.0 20-24 37.241499999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.27745 38.0 38.0 38.0 37.0 38.0 30-34 37.26665 38.0 38.0 38.0 37.0 38.0 35-39 37.211200000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.22945 38.0 38.0 38.0 37.0 38.0 45-49 37.146750000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.090799999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.10275 38.0 38.0 38.0 37.0 38.0 60-64 37.082499999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.0277 38.0 38.0 38.0 36.6 38.0 70-74 37.00555 38.0 38.0 38.0 36.0 38.0 75-79 36.90355 38.0 38.0 38.0 36.0 38.0 80-84 36.7452 38.0 38.0 38.0 36.0 38.0 85-89 36.585449999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.65075 38.0 38.0 38.0 35.0 38.0 95-99 36.609300000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.4288 38.0 38.0 38.0 34.0 38.0 105-109 36.29639999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.090849999999996 38.0 38.0 38.0 33.6 38.0 115-119 35.84994999999999 38.0 37.8 38.0 32.8 38.0 120-124 35.7444 38.0 37.0 38.0 32.4 38.0 125-129 35.4185 38.0 36.8 38.0 30.6 38.0 130-134 35.08755 38.0 36.0 38.0 30.0 38.0 135-139 34.5667 38.0 35.2 38.0 27.4 38.0 140-144 34.0509 38.0 34.0 38.0 25.0 38.0 145-149 32.96965 38.0 33.0 38.0 16.0 38.0 150-151 27.925125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 2.0 10 1.0 11 0.0 12 2.0 13 2.0 14 2.0 15 5.0 16 4.0 17 8.0 18 3.0 19 6.0 20 7.0 21 11.0 22 9.0 23 13.0 24 9.0 25 15.0 26 17.0 27 29.0 28 24.0 29 32.0 30 34.0 31 47.0 32 50.0 33 85.0 34 131.0 35 238.0 36 595.0 37 2612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.45 16.625 18.25 31.674999999999997 2 25.525 24.625 34.599999999999994 15.25 3 21.175 27.3 29.7 21.825 4 23.400000000000002 34.175 22.55 19.875 5 24.375 36.4 23.375 15.85 6 19.175 38.550000000000004 24.725 17.549999999999997 7 18.8 18.775 42.699999999999996 19.725 8 20.8 23.9 29.25 26.05 9 21.8 24.224999999999998 31.35 22.625 10-14 22.770000000000003 29.24 26.445 21.545 15-19 22.865 27.99 28.455000000000002 20.69 20-24 22.6 28.22 27.67 21.51 25-29 22.994999999999997 28.294999999999998 28.24 20.47 30-34 22.45 27.939999999999998 28.9 20.71 35-39 22.525000000000002 28.060000000000002 28.475 20.94 40-44 22.905 28.294999999999998 28.67 20.13 45-49 22.425 28.07 28.84 20.665 50-54 22.905 28.294999999999998 28.37 20.43 55-59 22.6 27.82 28.865000000000002 20.715 60-64 22.655 27.85 28.939999999999998 20.555 65-69 22.82 28.555000000000003 27.650000000000002 20.974999999999998 70-74 22.31 27.894999999999996 29.13 20.665 75-79 22.884999999999998 28.315 28.305000000000003 20.495 80-84 22.81 28.065 28.535 20.59 85-89 23.705000000000002 27.935 28.37 19.99 90-94 22.84 27.72 28.689999999999998 20.75 95-99 23.51 28.725 27.72 20.044999999999998 100-104 23.7 27.994999999999997 28.199999999999996 20.105 105-109 23.21 27.98 28.62 20.19 110-114 24.195 27.985 27.805000000000003 20.015 115-119 23.805 27.85 28.035 20.31 120-124 23.805 28.095 28.58 19.52 125-129 24.145 27.224999999999998 28.28 20.349999999999998 130-134 24.404999999999998 27.560000000000002 28.115000000000002 19.919999999999998 135-139 24.990000000000002 27.72 27.22 20.07 140-144 24.68 27.825 27.68 19.814999999999998 145-149 25.724999999999998 28.37 26.584999999999997 19.32 150-151 25.687500000000004 27.5625 27.2625 19.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.5 25 3.5 26 5.0 27 7.0 28 11.5 29 16.5 30 24.0 31 25.0 32 30.5 33 46.0 34 56.0 35 64.5 36 83.5 37 117.0 38 163.5 39 186.5 40 214.0 41 252.5 42 251.0 43 275.0 44 296.5 45 276.0 46 259.0 47 237.5 48 203.0 49 190.0 50 167.5 51 119.5 52 91.0 53 74.5 54 64.5 55 47.0 56 30.0 57 25.0 58 20.0 59 13.0 60 8.0 61 9.0 62 8.0 63 6.0 64 4.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 1.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03967652261815 97.975 2 0.8845084660096033 1.7500000000000002 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.0250000000000004 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.6500000000000004 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.3625 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.725 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.5875 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.6125 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.65 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 9.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTCT 10 0.006830828 145.0 2 >>END_MODULE Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840312 spots for SRR7168870.sra Written 840312 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra Read 840293 spots for SRR7168870.sra Written 840293 spots for SRR7168870.sra SRR ids: ['SRR7168870.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7rzv_f0 SRR7168870.sra spots: 16805879 blocks: [[1, 840293], [840294, 1680586], [1680587, 2520879], [2520880, 3361172], [3361173, 4201465], [4201466, 5041758], [5041759, 5882051], [5882052, 6722344], [6722345, 7562637], [7562638, 8402930], [8402931, 9243223], [9243224, 10083516], [10083517, 10923809], [10923810, 11764102], [11764103, 12604395], [12604396, 13444688], [13444689, 14284981], [14284982, 15125274], [15125275, 15965567], [15965568, 16805879]] SRR7168870 file size 5673260 SRR7168870 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168870 SRR7168870_1.fastq SRR7168870_2.fastq Input file: SRR7168870_1.fastq Paired file: SRR7168870_2.fastq trimmed: SRR7168870-trimmed-pair1.fastq, SRR7168870-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 12:27:10 2025 >> started Sat Feb 15 12:44:26 2025 >> done (1036.193s) 16805879 read pairs processed; of these: 13536 ( 0.08%) short read pairs filtered out after trimming by size control 15027 ( 0.09%) empty read pairs filtered out after trimming by size control 16777316 (99.83%) read pairs available; of these: 8611711 (51.33%) trimmed read pairs available after processing 8165605 (48.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 7 0.00% 23 4 0.00% 24 6 0.00% 25 4 0.00% 26 10 0.00% 27 10 0.00% 28 7 0.00% 29 2 0.00% 30 12 0.00% 31 9 0.00% 32 8 0.00% 33 11 0.00% 34 12 0.00% 35 11 0.00% 36 13 0.00% 37 20 0.00% 38 18 0.00% 39 19 0.00% 40 30 0.00% 41 27 0.00% 42 39 0.00% 43 42 0.00% 44 54 0.00% 45 60 0.00% 46 51 0.00% 47 71 0.00% 48 98 0.00% 49 93 0.00% 50 118 0.00% 51 129 0.00% 52 162 0.00% 53 183 0.00% 54 168 0.00% 55 200 0.00% 56 218 0.00% 57 257 0.00% 58 291 0.00% 59 348 0.00% 60 405 0.00% 61 440 0.00% 62 512 0.00% 63 560 0.00% 64 650 0.00% 65 726 0.00% 66 881 0.01% 67 1051 0.01% 68 1173 0.01% 69 2256 0.01% 70 2190 0.01% 71 1747 0.01% 72 1871 0.01% 73 2115 0.01% 74 2250 0.01% 75 2594 0.02% 76 2862 0.02% 77 3100 0.02% 78 3577 0.02% 79 4038 0.02% 80 4456 0.03% 81 5100 0.03% 82 5688 0.03% 83 6339 0.04% 84 7230 0.04% 85 8093 0.05% 86 8800 0.05% 87 9671 0.06% 88 10281 0.06% 89 11071 0.07% 90 11861 0.07% 91 12719 0.08% 92 13966 0.08% 93 15271 0.09% 94 16223 0.10% 95 17488 0.10% 96 18611 0.11% 97 19405 0.12% 98 20441 0.12% 99 21173 0.13% 100 22357 0.13% 101 23455 0.14% 102 25219 0.15% 103 25999 0.15% 104 28053 0.17% 105 28739 0.17% 106 30357 0.18% 107 31247 0.19% 108 32132 0.19% 109 33579 0.20% 110 34743 0.21% 111 36108 0.22% 112 37385 0.22% 113 38978 0.23% 114 40035 0.24% 115 41625 0.25% 116 43272 0.26% 117 44195 0.26% 118 45314 0.27% 119 46474 0.28% 120 47507 0.28% 121 49438 0.29% 122 50471 0.30% 123 52675 0.31% 124 54478 0.32% 125 55966 0.33% 126 58079 0.35% 127 59562 0.36% 128 60928 0.36% 129 62526 0.37% 130 64459 0.38% 131 66562 0.40% 132 68305 0.41% 133 70894 0.42% 134 73748 0.44% 135 77527 0.46% 136 79783 0.48% 137 83834 0.50% 138 87398 0.52% 139 93616 0.56% 140 98191 0.59% 141 104588 0.62% 142 113586 0.68% 143 124151 0.74% 144 142628 0.85% 145 166076 0.99% 146 201469 1.20% 147 265641 1.58% 148 398238 2.37% 149 769225 4.58% 150 3939166 23.48% 151 8165605 48.67% 16777316 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=413.15 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=36.03 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7168870 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 13:33:04 Started mapping on | Feb 15 13:33:14 Finished on | Feb 15 15:25:37 Mapping speed, Million of reads per hour | 8.96 Number of input reads | 16777316 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15744164 Uniquely mapped reads % | 93.84% Average mapped length | 291.06 Number of splices: Total | 14446989 Number of splices: Annotated (sjdb) | 14082130 Number of splices: GT/AG | 14149986 Number of splices: GC/AG | 240634 Number of splices: AT/AC | 8084 Number of splices: Non-canonical | 48285 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470284 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 130904 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574185 574185 574185 N_multimapping 470284 470284 470284 N_noFeature 755740 15327389 1032103 N_ambiguous 254894 2008 112835 UnstrandedReadsAssigned:14733530 PositiveStrandReadsAssigned:414767 NegativeStrandReadsAssigned:14599226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168870 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168870-trimmed-pair1.fastq SRR7168870-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,777,316 reads, 14,664,996 reads pseudoaligned [quant] estimated average fragment length: 229.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR7168870.ke.tsv 34699 SRR7168870.se.tsv 87100 total ==> SRR7168870.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.04 907 35.9123 Potri.005G024800.1.v4.1 1035 806.037 169 14.8521 Potri.004G059700.1.v4.1 961 732.081 0 0 Potri.007G009000.2.v4.1 1416 1187.04 0 0 Potri.003G141000.2.v4.1 2943 2714.04 941.762 24.5799 Potri.016G087400.1.v4.1 270 88.6326 757.768 605.617 Potri.015G069301.1.v4.1 564 339.735 0 0 Potri.010G195200.1.v4.1 1773 1544.04 19 0.871667 Potri.012G127500.1.v4.1 977 748.062 115 10.8897 ==> SRR7168870.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1387 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 45 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7168870 completed mapping pipeline successfully