Starting /dee2/code/volunteer_pipeline.sh SRR7168871 current disk space = 3091384582144 free memory = 1579985120 SRR7168871 SRAfilesize 9fdce842988185c4f201dfee6aac6cee SRR7168871.sra SRR7168871.sra file validated SRR7168871 is paired end SRR7168871 is conventional basespace SRR7168871 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.02875 34.0 33.0 34.0 32.0 34.0 2 33.18075 34.0 33.0 34.0 32.0 34.0 3 33.1965 34.0 33.0 34.0 32.0 34.0 4 33.3375 34.0 33.0 34.0 33.0 34.0 5 33.341 34.0 33.0 34.0 33.0 34.0 6 37.13225 38.0 37.0 38.0 36.0 38.0 7 37.37 38.0 38.0 38.0 37.0 38.0 8 37.37425 38.0 38.0 38.0 37.0 38.0 9 37.51975 38.0 38.0 38.0 37.0 38.0 10-14 37.54095 38.0 38.0 38.0 38.0 38.0 15-19 37.49335 38.0 38.0 38.0 37.6 38.0 20-24 37.449349999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.47145 38.0 38.0 38.0 37.2 38.0 30-34 37.43855 38.0 38.0 38.0 37.0 38.0 35-39 37.42495 38.0 38.0 38.0 37.0 38.0 40-44 37.38635 38.0 38.0 38.0 37.0 38.0 45-49 37.36625 38.0 38.0 38.0 37.0 38.0 50-54 37.2922 38.0 38.0 38.0 37.0 38.0 55-59 37.2076 38.0 38.0 38.0 36.8 38.0 60-64 37.1915 38.0 38.0 38.0 36.4 38.0 65-69 37.12365 38.0 38.0 38.0 36.0 38.0 70-74 37.081999999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.9764 38.0 38.0 38.0 36.0 38.0 80-84 36.926050000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.87325 38.0 38.0 38.0 35.6 38.0 90-94 36.672200000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.7111 38.0 38.0 38.0 34.6 38.0 100-104 36.56615 38.0 38.0 38.0 34.2 38.0 105-109 36.49815 38.0 38.0 38.0 34.0 38.0 110-114 36.20285 38.0 37.2 38.0 33.6 38.0 115-119 35.966649999999994 38.0 37.0 38.0 33.0 38.0 120-124 35.7386 38.0 36.8 38.0 31.0 38.0 125-129 35.4726 38.0 36.0 38.0 30.4 38.0 130-134 35.07854999999999 38.0 35.6 38.0 28.8 38.0 135-139 34.5372 38.0 34.4 38.0 26.0 38.0 140-144 33.97035 38.0 33.2 38.0 23.4 38.0 145-149 32.96015 38.0 33.0 38.0 18.2 38.0 150-151 27.911 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 2.0 17 0.0 18 2.0 19 7.0 20 1.0 21 5.0 22 4.0 23 9.0 24 4.0 25 12.0 26 17.0 27 16.0 28 34.0 29 37.0 30 44.0 31 58.0 32 70.0 33 110.0 34 140.0 35 263.0 36 721.0 37 2439.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.23113084356228 13.136589187777487 13.423870462261686 38.20840950639854 2 22.375 18.325 33.4 25.900000000000002 3 20.275000000000002 24.05 24.474999999999998 31.2 4 23.525 30.45 22.825 23.200000000000003 5 21.475 34.8 23.7 20.025000000000002 6 17.625 37.0 25.324999999999996 20.05 7 14.2 25.15 43.1 17.549999999999997 8 17.7 25.525 31.25 25.525 9 16.925 25.4 33.825 23.849999999999998 10-14 19.61 29.825000000000003 26.900000000000002 23.665 15-19 19.939999999999998 28.51 28.134999999999998 23.415 20-24 19.91 28.53 27.93 23.630000000000003 25-29 19.235 29.085 28.18 23.5 30-34 19.23 28.799999999999997 28.215 23.755000000000003 35-39 20.225 28.685 27.38 23.71 40-44 19.15 28.775000000000002 28.349999999999998 23.724999999999998 45-49 20.275000000000002 28.51 27.74 23.474999999999998 50-54 20.025000000000002 29.035 27.875 23.064999999999998 55-59 20.595 28.505000000000003 27.584999999999997 23.315 60-64 19.89 28.444999999999997 28.139999999999997 23.525 65-69 19.830000000000002 28.735 27.500000000000004 23.935000000000002 70-74 20.025000000000002 28.425 28.465 23.085 75-79 19.744999999999997 28.38 28.24 23.635 80-84 19.705000000000002 28.22 28.28 23.794999999999998 85-89 19.895 29.054999999999996 27.58 23.47 90-94 20.125 28.575 27.900000000000002 23.400000000000002 95-99 20.599999999999998 27.985 27.925 23.49 100-104 20.880000000000003 28.305000000000003 27.384999999999998 23.43 105-109 20.805 28.384999999999998 27.48 23.330000000000002 110-114 20.71 28.16 27.794999999999998 23.335 115-119 20.715 28.560000000000002 27.35 23.375 120-124 20.325 28.9 27.33 23.445 125-129 20.635 28.410000000000004 27.450000000000003 23.505000000000003 130-134 21.65 28.24 26.995 23.115 135-139 20.965 28.749999999999996 26.88 23.405 140-144 21.325 28.660000000000004 26.57 23.445 145-149 21.545 28.1 26.584999999999997 23.77 150-151 21.2625 27.975 26.775 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 3.5 23 4.0 24 3.5 25 4.5 26 7.5 27 11.0 28 12.5 29 11.5 30 13.0 31 23.0 32 35.5 33 45.5 34 62.0 35 91.5 36 109.0 37 120.0 38 146.0 39 170.0 40 193.0 41 227.0 42 248.5 43 245.0 44 250.5 45 252.0 46 250.5 47 259.0 48 248.5 49 220.5 50 165.5 51 121.0 52 105.5 53 81.5 54 60.5 55 50.5 56 45.5 57 31.0 58 15.5 59 14.0 60 11.5 61 6.5 62 5.5 63 5.0 64 2.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.35 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.887499999999999 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.0375 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCTTT 10 0.0068396386 144.9375 8 CAGACTG 10 0.0068396386 144.9375 3 TCTCGTA 25 8.728225E-4 86.962494 145 >>END_MODULE SRR7168871 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168871_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72175 33.0 33.0 34.0 32.0 34.0 2 32.86775 33.0 33.0 34.0 32.0 34.0 3 32.8615 34.0 33.0 34.0 32.0 34.0 4 32.856 34.0 33.0 34.0 32.0 34.0 5 32.87525 34.0 33.0 34.0 32.0 34.0 6 37.0955 38.0 38.0 38.0 36.0 38.0 7 37.1455 38.0 38.0 38.0 37.0 38.0 8 37.0885 38.0 38.0 38.0 37.0 38.0 9 37.10775 38.0 38.0 38.0 37.0 38.0 10-14 37.035199999999996 38.0 38.0 38.0 36.8 38.0 15-19 36.98345 38.0 38.0 38.0 36.0 38.0 20-24 36.8987 38.0 38.0 38.0 36.0 38.0 25-29 36.9293 38.0 38.0 38.0 36.0 38.0 30-34 36.946749999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.92315 38.0 38.0 38.0 36.2 38.0 40-44 36.87015 38.0 38.0 38.0 36.0 38.0 45-49 36.80245000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.695299999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.69685 38.0 38.0 38.0 35.6 38.0 60-64 36.634249999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.58639999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.50195 38.0 38.0 38.0 34.8 38.0 75-79 36.45395 38.0 38.0 38.0 34.4 38.0 80-84 36.2134 38.0 38.0 38.0 33.8 38.0 85-89 36.136900000000004 38.0 38.0 38.0 33.4 38.0 90-94 36.100199999999994 38.0 38.0 38.0 33.8 38.0 95-99 36.09045 38.0 38.0 38.0 33.8 38.0 100-104 35.857350000000004 38.0 37.6 38.0 32.8 38.0 105-109 35.78535 38.0 37.2 38.0 32.6 38.0 110-114 35.59185 38.0 37.0 38.0 31.0 38.0 115-119 35.2584 38.0 36.8 38.0 28.6 38.0 120-124 35.119150000000005 38.0 36.0 38.0 28.4 38.0 125-129 34.7635 38.0 35.8 38.0 27.2 38.0 130-134 34.4741 38.0 35.6 38.0 25.8 38.0 135-139 33.81484999999999 38.0 33.8 38.0 22.0 38.0 140-144 33.159000000000006 38.0 33.0 38.0 18.8 38.0 145-149 31.948449999999998 38.0 33.0 38.0 8.6 38.0 150-151 26.994999999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 2.0 6 3.0 7 4.0 8 1.0 9 2.0 10 3.0 11 3.0 12 2.0 13 1.0 14 2.0 15 8.0 16 8.0 17 6.0 18 5.0 19 7.0 20 10.0 21 9.0 22 15.0 23 16.0 24 19.0 25 26.0 26 24.0 27 39.0 28 26.0 29 45.0 30 48.0 31 56.0 32 76.0 33 94.0 34 176.0 35 293.0 36 624.0 37 2340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.199999999999996 18.6 18.224999999999998 27.975 2 27.625 24.8 31.55 16.025 3 20.3 29.375 29.5 20.825 4 24.075 34.575 22.425 18.925 5 24.474999999999998 36.65 21.725 17.150000000000002 6 19.525000000000002 37.375 24.85 18.25 7 18.4 19.950000000000003 42.375 19.275000000000002 8 21.875 23.925 27.875 26.325 9 21.15 25.900000000000002 29.825000000000003 23.125 10-14 23.285 29.035 26.400000000000002 21.279999999999998 15-19 22.855 27.82 28.435 20.89 20-24 22.189999999999998 28.665000000000003 28.07 21.075 25-29 23.015 27.705000000000002 28.645 20.635 30-34 22.195 28.16 28.88 20.765 35-39 22.245 28.299999999999997 28.544999999999998 20.91 40-44 22.86 28.225 27.905 21.01 45-49 22.415 27.975 28.575 21.035 50-54 23.11 28.29 28.13 20.47 55-59 22.86 28.144999999999996 27.93 21.065 60-64 23.165 28.225 28.12 20.49 65-69 23.31 27.865000000000002 27.834999999999997 20.990000000000002 70-74 22.725 27.839999999999996 27.860000000000003 21.575 75-79 22.545 28.065 28.49 20.9 80-84 23.155 27.77 28.485 20.59 85-89 23.09 28.025 27.925 20.96 90-94 22.825 28.18 28.355000000000004 20.64 95-99 23.025000000000002 27.935 28.155 20.885 100-104 22.955000000000002 28.29 27.825 20.93 105-109 23.669999999999998 28.165000000000003 27.625 20.54 110-114 23.72 28.025 28.335 19.919999999999998 115-119 24.085 28.310000000000002 27.250000000000004 20.355 120-124 24.310000000000002 28.499999999999996 27.284999999999997 19.905 125-129 24.169999999999998 27.775 27.92 20.135 130-134 24.275 28.22 27.525 19.98 135-139 24.615000000000002 28.365000000000002 27.375 19.645000000000003 140-144 24.310000000000002 28.549999999999997 27.46 19.68 145-149 25.424999999999997 28.494999999999997 27.045 19.035 150-151 25.55 27.6625 27.3 19.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 1.0 23 0.5 24 4.0 25 6.5 26 4.0 27 2.5 28 6.5 29 12.5 30 15.5 31 20.5 32 30.0 33 39.5 34 50.5 35 78.0 36 102.0 37 125.0 38 158.0 39 175.5 40 196.0 41 223.5 42 244.0 43 259.0 44 263.5 45 273.5 46 274.0 47 250.0 48 224.0 49 199.0 50 170.0 51 132.5 52 109.0 53 94.0 54 67.0 55 49.0 56 40.5 57 29.5 58 20.0 59 18.5 60 14.0 61 5.0 62 2.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.7822356800403736 1.55 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.0 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.35 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGACA 10 0.006830828 145.0 2 CTCATTT 10 0.006830828 145.0 8 >>END_MODULE Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832450 spots for SRR7168871.sra Written 832450 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra Read 832440 spots for SRR7168871.sra Written 832440 spots for SRR7168871.sra SRR ids: ['SRR7168871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8y90xj78 SRR7168871.sra spots: 16648810 blocks: [[1, 832440], [832441, 1664880], [1664881, 2497320], [2497321, 3329760], [3329761, 4162200], [4162201, 4994640], [4994641, 5827080], [5827081, 6659520], [6659521, 7491960], [7491961, 8324400], [8324401, 9156840], [9156841, 9989280], [9989281, 10821720], [10821721, 11654160], [11654161, 12486600], [12486601, 13319040], [13319041, 14151480], [14151481, 14983920], [14983921, 15816360], [15816361, 16648810]] SRR7168871 file size 5620035 SRR7168871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168871 SRR7168871_1.fastq SRR7168871_2.fastq Input file: SRR7168871_1.fastq Paired file: SRR7168871_2.fastq trimmed: SRR7168871-trimmed-pair1.fastq, SRR7168871-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 13:38:49 2025 >> started Sat Feb 15 13:44:42 2025 >> done (353.123s) 16648810 read pairs processed; of these: 23501 ( 0.14%) short read pairs filtered out after trimming by size control 25425 ( 0.15%) empty read pairs filtered out after trimming by size control 16599884 (99.71%) read pairs available; of these: 8494008 (51.17%) trimmed read pairs available after processing 8105876 (48.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 1 0.00% 22 7 0.00% 23 4 0.00% 24 14 0.00% 25 7 0.00% 26 2 0.00% 27 6 0.00% 28 5 0.00% 29 9 0.00% 30 13 0.00% 31 8 0.00% 32 3 0.00% 33 11 0.00% 34 14 0.00% 35 14 0.00% 36 18 0.00% 37 10 0.00% 38 15 0.00% 39 16 0.00% 40 30 0.00% 41 19 0.00% 42 43 0.00% 43 27 0.00% 44 42 0.00% 45 49 0.00% 46 52 0.00% 47 70 0.00% 48 57 0.00% 49 84 0.00% 50 105 0.00% 51 105 0.00% 52 132 0.00% 53 140 0.00% 54 156 0.00% 55 169 0.00% 56 227 0.00% 57 204 0.00% 58 248 0.00% 59 326 0.00% 60 317 0.00% 61 374 0.00% 62 419 0.00% 63 478 0.00% 64 512 0.00% 65 588 0.00% 66 634 0.00% 67 815 0.00% 68 993 0.01% 69 2672 0.02% 70 2119 0.01% 71 1399 0.01% 72 1587 0.01% 73 1813 0.01% 74 1894 0.01% 75 2170 0.01% 76 2244 0.01% 77 2771 0.02% 78 2812 0.02% 79 3307 0.02% 80 3744 0.02% 81 4204 0.03% 82 4706 0.03% 83 5185 0.03% 84 6721 0.04% 85 7602 0.05% 86 8101 0.05% 87 8728 0.05% 88 9420 0.06% 89 9965 0.06% 90 10798 0.07% 91 11541 0.07% 92 12582 0.08% 93 13486 0.08% 94 14408 0.09% 95 15277 0.09% 96 16046 0.10% 97 17176 0.10% 98 17703 0.11% 99 18660 0.11% 100 19993 0.12% 101 20716 0.12% 102 22196 0.13% 103 23279 0.14% 104 24616 0.15% 105 25630 0.15% 106 26804 0.16% 107 27814 0.17% 108 28643 0.17% 109 29531 0.18% 110 30622 0.18% 111 32090 0.19% 112 33094 0.20% 113 35379 0.21% 114 36258 0.22% 115 37977 0.23% 116 38893 0.23% 117 39885 0.24% 118 40963 0.25% 119 41851 0.25% 120 43182 0.26% 121 44912 0.27% 122 45767 0.28% 123 48008 0.29% 124 50453 0.30% 125 51877 0.31% 126 53849 0.32% 127 55117 0.33% 128 56904 0.34% 129 58481 0.35% 130 60314 0.36% 131 62173 0.37% 132 64756 0.39% 133 67594 0.41% 134 70468 0.42% 135 73769 0.44% 136 77242 0.47% 137 81257 0.49% 138 85380 0.51% 139 90874 0.55% 140 95252 0.57% 141 102410 0.62% 142 111661 0.67% 143 123761 0.75% 144 141527 0.85% 145 167428 1.01% 146 204052 1.23% 147 271428 1.64% 148 410354 2.47% 149 794990 4.79% 150 3964087 23.88% 151 8105876 48.83% 16599884 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=11 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=43.34 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=23.89 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7168871 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 15:05:06 Started mapping on | Feb 15 15:05:24 Finished on | Feb 15 18:48:24 Mapping speed, Million of reads per hour | 4.47 Number of input reads | 16599884 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15481800 Uniquely mapped reads % | 93.26% Average mapped length | 291.64 Number of splices: Total | 14550683 Number of splices: Annotated (sjdb) | 14215569 Number of splices: GT/AG | 14263503 Number of splices: GC/AG | 236481 Number of splices: AT/AC | 8303 Number of splices: Non-canonical | 42396 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455641 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 73233 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 683317 683317 683317 N_multimapping 455641 455641 455641 N_noFeature 630121 15130049 827427 N_ambiguous 268987 1698 113258 UnstrandedReadsAssigned:14582692 PositiveStrandReadsAssigned:350053 NegativeStrandReadsAssigned:14541115 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168871 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168871-trimmed-pair1.fastq SRR7168871-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,599,884 reads, 14,561,736 reads pseudoaligned [quant] estimated average fragment length: 233.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7168871.ke.tsv 34699 SRR7168871.se.tsv 87100 total ==> SRR7168871.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.02 684 25.9308 Potri.005G024800.1.v4.1 1035 802.022 234 19.7439 Potri.004G059700.1.v4.1 961 728.054 4 0.371791 Potri.007G009000.2.v4.1 1416 1183.02 0 0 Potri.003G141000.2.v4.1 2943 2710.02 944 23.5723 Potri.016G087400.1.v4.1 270 86.0293 761 598.606 Potri.015G069301.1.v4.1 564 335.542 0 0 Potri.010G195200.1.v4.1 1773 1540.02 59 2.59256 Potri.012G127500.1.v4.1 977 744.033 87 7.9128 ==> SRR7168871.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 585 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 97 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168871 completed mapping pipeline successfully