Starting /dee2/code/volunteer_pipeline.sh SRR7168872 current disk space = 3091354607616 free memory = 1579169332 SRR7168872 SRAfilesize fbb6684ab1ca858134925f03def98d8d SRR7168872.sra SRR7168872.sra file validated SRR7168872 is paired end SRR7168872 is conventional basespace SRR7168872 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05825 34.0 33.0 34.0 32.0 34.0 2 33.172 34.0 33.0 34.0 32.0 34.0 3 33.14875 34.0 33.0 34.0 32.0 34.0 4 33.26175 34.0 33.0 34.0 32.0 34.0 5 33.30025 34.0 33.0 34.0 33.0 34.0 6 36.9495 38.0 37.0 38.0 35.0 38.0 7 37.228 38.0 38.0 38.0 36.0 38.0 8 37.30375 38.0 38.0 38.0 37.0 38.0 9 37.387 38.0 38.0 38.0 37.0 38.0 10-14 37.392649999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.4816 38.0 38.0 38.0 37.0 38.0 20-24 37.42225 38.0 38.0 38.0 37.0 38.0 25-29 37.36215 38.0 38.0 38.0 37.0 38.0 30-34 37.37395 38.0 38.0 38.0 37.0 38.0 35-39 37.2799 38.0 38.0 38.0 37.0 38.0 40-44 37.2267 38.0 38.0 38.0 36.8 38.0 45-49 37.220549999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.11515000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.06585 38.0 38.0 38.0 36.0 38.0 60-64 36.898300000000006 38.0 38.0 38.0 35.8 38.0 65-69 36.843500000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.846999999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.799200000000006 38.0 38.0 38.0 35.4 38.0 80-84 36.617450000000005 38.0 38.0 38.0 34.4 38.0 85-89 36.465 38.0 38.0 38.0 34.0 38.0 90-94 36.3641 38.0 38.0 38.0 34.0 38.0 95-99 36.21005 38.0 37.6 38.0 33.8 38.0 100-104 36.2189 38.0 37.6 38.0 33.6 38.0 105-109 36.035799999999995 38.0 37.0 38.0 33.0 38.0 110-114 35.75885 38.0 37.0 38.0 31.4 38.0 115-119 35.477850000000004 38.0 36.6 38.0 29.4 38.0 120-124 35.2076 38.0 36.0 38.0 28.4 38.0 125-129 34.80665 38.0 35.4 38.0 27.4 38.0 130-134 34.37615 38.0 35.0 38.0 24.4 38.0 135-139 33.682249999999996 38.0 34.0 38.0 21.0 38.0 140-144 33.05675000000001 38.0 33.2 38.0 18.2 38.0 145-149 31.663850000000004 38.0 31.0 38.0 10.8 38.0 150-151 27.496 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 1.0 17 2.0 18 4.0 19 2.0 20 5.0 21 8.0 22 11.0 23 10.0 24 21.0 25 10.0 26 22.0 27 32.0 28 47.0 29 46.0 30 42.0 31 71.0 32 91.0 33 122.0 34 185.0 35 314.0 36 695.0 37 2248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85393844548774 14.084507042253522 10.7981220657277 35.26343244653104 2 21.75 18.55 33.650000000000006 26.05 3 19.925 24.025 26.1 29.95 4 23.3 33.1 21.55 22.05 5 22.225 35.675000000000004 24.3 17.8 6 18.725 37.25 25.05 18.975 7 14.825 25.2 41.775 18.2 8 17.825 24.425 31.65 26.1 9 18.075 25.174999999999997 32.824999999999996 23.925 10-14 20.305 29.68 26.735 23.28 15-19 20.305 27.889999999999997 28.4 23.405 20-24 19.98 28.74 27.894999999999996 23.385 25-29 20.419999999999998 28.999999999999996 27.435 23.145 30-34 20.06 29.035 27.889999999999997 23.015 35-39 20.16 28.865000000000002 27.665 23.31 40-44 19.744999999999997 29.134999999999998 27.485 23.635 45-49 20.41 28.7 27.735 23.155 50-54 19.945 28.7 28.02 23.335 55-59 20.02 28.71 27.779999999999998 23.49 60-64 20.625 29.235 27.22 22.919999999999998 65-69 20.06 28.915000000000003 27.43 23.595 70-74 20.19 28.199999999999996 27.815 23.794999999999998 75-79 20.369999999999997 28.63 27.655 23.345 80-84 20.825 28.395 27.655 23.125 85-89 20.294999999999998 28.9 27.325 23.48 90-94 20.349999999999998 28.925 27.279999999999998 23.445 95-99 20.91 28.599999999999998 27.6 22.89 100-104 20.549999999999997 28.685 27.189999999999998 23.575 105-109 20.535 28.720000000000002 27.339999999999996 23.405 110-114 20.735 28.48 27.41 23.375 115-119 20.974999999999998 28.560000000000002 27.155 23.31 120-124 20.875 28.79 27.22 23.115 125-129 21.34 27.71 27.35 23.599999999999998 130-134 21.175 28.660000000000004 27.250000000000004 22.915 135-139 20.82 28.315 26.955000000000002 23.91 140-144 20.505000000000003 28.744999999999997 27.355 23.395 145-149 20.61 28.63 27.055 23.705000000000002 150-151 21.525 28.000000000000004 27.2625 23.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 2.5 26 5.5 27 8.5 28 15.0 29 23.0 30 32.0 31 34.5 32 33.5 33 43.0 34 60.0 35 84.0 36 97.0 37 111.5 38 136.5 39 156.5 40 185.5 41 204.5 42 225.0 43 259.0 44 269.0 45 271.0 46 260.5 47 254.0 48 235.0 49 202.5 50 172.5 51 132.0 52 110.0 53 95.5 54 73.5 55 51.5 56 46.0 57 33.0 58 20.0 59 20.0 60 14.0 61 8.0 62 4.0 63 1.0 64 1.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.6125 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGAAT 10 0.005853838 152.57895 1 ACGAATC 10 0.0068378756 144.95 2 TGAACTC 45 0.008969499 48.316666 145 GTCTGAA 40 0.0076702754 18.11875 140-144 CGTCTGA 40 0.0076702754 18.11875 140-144 >>END_MODULE SRR7168872 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168872_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78275 33.0 33.0 34.0 32.0 34.0 2 32.92875 33.0 33.0 34.0 32.0 34.0 3 32.93625 34.0 33.0 34.0 32.0 34.0 4 32.88425 34.0 33.0 34.0 32.0 34.0 5 32.9 34.0 33.0 34.0 32.0 34.0 6 37.047 38.0 38.0 38.0 36.0 38.0 7 37.104 38.0 38.0 38.0 37.0 38.0 8 37.088 38.0 38.0 38.0 37.0 38.0 9 36.965 38.0 38.0 38.0 36.0 38.0 10-14 37.0017 38.0 38.0 38.0 36.6 38.0 15-19 37.0128 38.0 38.0 38.0 36.6 38.0 20-24 36.96424999999999 38.0 38.0 38.0 36.4 38.0 25-29 36.9872 38.0 38.0 38.0 36.4 38.0 30-34 37.00725 38.0 38.0 38.0 37.0 38.0 35-39 36.9206 38.0 38.0 38.0 36.2 38.0 40-44 36.860299999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.8609 38.0 38.0 38.0 36.0 38.0 50-54 36.722249999999995 38.0 38.0 38.0 35.6 38.0 55-59 36.768150000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.725300000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.638799999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.54175 38.0 38.0 38.0 35.0 38.0 75-79 36.47615 38.0 38.0 38.0 34.6 38.0 80-84 36.48365 38.0 38.0 38.0 34.4 38.0 85-89 36.2861 38.0 38.0 38.0 34.0 38.0 90-94 36.28645 38.0 38.0 38.0 34.0 38.0 95-99 36.121249999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.890049999999995 38.0 37.8 38.0 32.8 38.0 105-109 35.58635 38.0 37.4 38.0 30.6 38.0 110-114 35.585300000000004 38.0 37.0 38.0 31.0 38.0 115-119 35.42550000000001 38.0 37.0 38.0 30.6 38.0 120-124 35.0904 38.0 36.4 38.0 28.2 38.0 125-129 35.02465 38.0 36.2 38.0 28.2 38.0 130-134 34.3914 38.0 35.4 38.0 24.6 38.0 135-139 33.942550000000004 38.0 34.2 38.0 23.2 38.0 140-144 33.29195 38.0 33.0 38.0 18.2 38.0 145-149 32.158699999999996 38.0 33.0 38.0 8.4 38.0 150-151 26.95975 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 2.0 5 2.0 6 3.0 7 2.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 8.0 15 5.0 16 5.0 17 9.0 18 11.0 19 8.0 20 7.0 21 13.0 22 14.0 23 15.0 24 20.0 25 23.0 26 20.0 27 31.0 28 45.0 29 32.0 30 49.0 31 56.0 32 82.0 33 110.0 34 132.0 35 249.0 36 543.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 19.6 16.1 26.125 2 25.55 25.874999999999996 31.724999999999998 16.85 3 20.625 28.525 31.4 19.45 4 23.375 35.25 22.275 19.1 5 23.775 37.175000000000004 22.025 17.025000000000002 6 19.425 37.8 24.15 18.625 7 18.875 20.3 40.65 20.175 8 20.875 25.15 27.675 26.3 9 21.625 25.3 30.4 22.675 10-14 23.11 28.775000000000002 27.27 20.845 15-19 22.905 28.23 27.96 20.905 20-24 22.900000000000002 28.1 27.675 21.325 25-29 22.585 28.79 27.665 20.96 30-34 22.53 27.6 28.62 21.25 35-39 22.695 28.665000000000003 28.095 20.544999999999998 40-44 23.075000000000003 28.73 27.685 20.51 45-49 23.044999999999998 27.88 28.34 20.735 50-54 23.015 27.700000000000003 28.595 20.69 55-59 22.555 28.139999999999997 28.16 21.145 60-64 23.07 28.134999999999998 28.384999999999998 20.41 65-69 22.925 28.23 27.79 21.055 70-74 23.235 27.965 27.625 21.175 75-79 23.09 27.785 28.52 20.605 80-84 23.39 28.000000000000004 28.005000000000003 20.605 85-89 23.330000000000002 27.6 28.215 20.855 90-94 23.415 27.685 27.96 20.94 95-99 23.22 28.015 28.29 20.474999999999998 100-104 23.53 27.315 28.585 20.57 105-109 24.085 27.21 28.444999999999997 20.26 110-114 23.794999999999998 28.08 28.33 19.794999999999998 115-119 24.385 28.07 27.33 20.215 120-124 23.94 27.98 27.805000000000003 20.275000000000002 125-129 24.705 27.195000000000004 28.025 20.075000000000003 130-134 23.68 28.59 27.325 20.405 135-139 25.335 27.62 27.575 19.470000000000002 140-144 25.335 27.589999999999996 27.185 19.89 145-149 25.525 28.605000000000004 26.76 19.11 150-151 25.387500000000003 27.787499999999998 27.737499999999997 19.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 3.0 24 3.0 25 2.0 26 3.0 27 7.0 28 10.5 29 14.0 30 18.5 31 21.0 32 33.0 33 48.5 34 57.0 35 67.5 36 87.0 37 115.5 38 130.0 39 160.5 40 198.5 41 221.5 42 244.5 43 262.5 44 289.5 45 294.0 46 269.0 47 247.0 48 217.5 49 185.0 50 165.5 51 138.5 52 103.5 53 95.0 54 81.5 55 47.5 56 31.5 57 32.0 58 29.5 59 18.5 60 11.5 61 6.5 62 6.0 63 7.5 64 3.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.074999999999999 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.300000000000001 0.0 0.0 0.0 0.0 134-135 7.862500000000001 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGGC 10 0.006830828 145.0 7 ATAGAAG 10 0.006830828 145.0 3 CTCAAAA 10 0.006830828 145.0 4 AGGGAAA 40 0.005621335 54.375 145 GTGTAGG 40 0.0076550315 18.125 140-144 TGTAGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816322 spots for SRR7168872.sra Written 816322 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra Read 816316 spots for SRR7168872.sra Written 816316 spots for SRR7168872.sra SRR ids: ['SRR7168872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4hr8jnav SRR7168872.sra spots: 16326326 blocks: [[1, 816316], [816317, 1632632], [1632633, 2448948], [2448949, 3265264], [3265265, 4081580], [4081581, 4897896], [4897897, 5714212], [5714213, 6530528], [6530529, 7346844], [7346845, 8163160], [8163161, 8979476], [8979477, 9795792], [9795793, 10612108], [10612109, 11428424], [11428425, 12244740], [12244741, 13061056], [13061057, 13877372], [13877373, 14693688], [14693689, 15510004], [15510005, 16326326]] SRR7168872 file size 5510755 SRR7168872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168872 SRR7168872_1.fastq SRR7168872_2.fastq Input file: SRR7168872_1.fastq Paired file: SRR7168872_2.fastq trimmed: SRR7168872-trimmed-pair1.fastq, SRR7168872-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 13:21:21 2025 >> started Sat Feb 15 13:28:09 2025 >> done (407.519s) 16326326 read pairs processed; of these: 18771 ( 0.11%) short read pairs filtered out after trimming by size control 20765 ( 0.13%) empty read pairs filtered out after trimming by size control 16286790 (99.76%) read pairs available; of these: 8569849 (52.62%) trimmed read pairs available after processing 7716941 (47.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 5 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 11 0.00% 29 6 0.00% 30 21 0.00% 31 8 0.00% 32 12 0.00% 33 16 0.00% 34 20 0.00% 35 14 0.00% 36 16 0.00% 37 29 0.00% 38 31 0.00% 39 30 0.00% 40 26 0.00% 41 35 0.00% 42 43 0.00% 43 41 0.00% 44 47 0.00% 45 59 0.00% 46 64 0.00% 47 59 0.00% 48 92 0.00% 49 91 0.00% 50 121 0.00% 51 130 0.00% 52 160 0.00% 53 163 0.00% 54 173 0.00% 55 184 0.00% 56 231 0.00% 57 242 0.00% 58 291 0.00% 59 334 0.00% 60 382 0.00% 61 444 0.00% 62 493 0.00% 63 610 0.00% 64 619 0.00% 65 745 0.00% 66 808 0.00% 67 943 0.01% 68 1116 0.01% 69 2030 0.01% 70 1882 0.01% 71 1690 0.01% 72 1838 0.01% 73 2034 0.01% 74 2250 0.01% 75 2421 0.01% 76 2660 0.02% 77 2922 0.02% 78 3294 0.02% 79 3700 0.02% 80 4213 0.03% 81 4767 0.03% 82 5436 0.03% 83 5986 0.04% 84 7295 0.04% 85 8160 0.05% 86 8582 0.05% 87 9178 0.06% 88 9839 0.06% 89 10536 0.06% 90 11412 0.07% 91 12366 0.08% 92 13324 0.08% 93 14621 0.09% 94 15458 0.09% 95 16461 0.10% 96 17379 0.11% 97 17662 0.11% 98 18629 0.11% 99 19581 0.12% 100 20425 0.13% 101 21734 0.13% 102 23354 0.14% 103 24694 0.15% 104 25459 0.16% 105 27056 0.17% 106 28454 0.17% 107 28436 0.17% 108 29778 0.18% 109 30726 0.19% 110 31588 0.19% 111 33159 0.20% 112 34516 0.21% 113 36260 0.22% 114 37737 0.23% 115 39529 0.24% 116 40463 0.25% 117 40666 0.25% 118 42097 0.26% 119 42864 0.26% 120 44109 0.27% 121 45685 0.28% 122 47390 0.29% 123 50049 0.31% 124 51813 0.32% 125 53281 0.33% 126 55390 0.34% 127 56806 0.35% 128 57488 0.35% 129 59403 0.36% 130 60974 0.37% 131 63621 0.39% 132 66754 0.41% 133 69300 0.43% 134 72590 0.45% 135 76548 0.47% 136 79767 0.49% 137 84106 0.52% 138 87641 0.54% 139 92399 0.57% 140 99074 0.61% 141 105979 0.65% 142 116719 0.72% 143 130511 0.80% 144 148248 0.91% 145 175063 1.07% 146 215372 1.32% 147 284667 1.75% 148 425964 2.62% 149 818213 5.02% 150 3869312 23.76% 151 7716941 47.38% 16286790 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.39 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=32.31 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=31.63 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.9 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR7168872 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 14:27:01 Started mapping on | Feb 15 14:27:04 Finished on | Feb 15 16:17:55 Mapping speed, Million of reads per hour | 8.82 Number of input reads | 16286790 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15220481 Uniquely mapped reads % | 93.45% Average mapped length | 291.04 Number of splices: Total | 13951808 Number of splices: Annotated (sjdb) | 13624980 Number of splices: GT/AG | 13668188 Number of splices: GC/AG | 229367 Number of splices: AT/AC | 8048 Number of splices: Non-canonical | 46205 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478210 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 33194 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 608350 608350 608350 N_multimapping 478210 478210 478210 N_noFeature 605846 14862066 844180 N_ambiguous 237200 1785 115715 UnstrandedReadsAssigned:14377435 PositiveStrandReadsAssigned:356630 NegativeStrandReadsAssigned:14260586 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168872 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168872-trimmed-pair1.fastq SRR7168872-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,286,790 reads, 14,260,321 reads pseudoaligned [quant] estimated average fragment length: 239.564 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7168872.ke.tsv 34699 SRR7168872.se.tsv 87100 total ==> SRR7168872.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.44 695 28.6335 Potri.005G024800.1.v4.1 1035 796.436 344 31.665 Potri.004G059700.1.v4.1 961 722.522 3 0.304398 Potri.007G009000.2.v4.1 1416 1177.44 0 0 Potri.003G141000.2.v4.1 2943 2704.44 751.002 20.3581 Potri.016G087400.1.v4.1 270 88.5474 1139 943.018 Potri.015G069301.1.v4.1 564 333.061 0 0 Potri.010G195200.1.v4.1 1773 1534.44 689.998 32.9664 Potri.012G127500.1.v4.1 977 738.482 215 21.3437 ==> SRR7168872.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 709 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 154 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 110 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7168872 completed mapping pipeline successfully