Starting /dee2/code/volunteer_pipeline.sh SRR7168873 current disk space = 3091407654912 free memory = 1579662812 SRR7168873 SRAfilesize 2fc3711117ae68909cc37af271dea7b8 SRR7168873.sra SRR7168873.sra file validated SRR7168873 is paired end SRR7168873 is conventional basespace SRR7168873 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168873_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31775 34.0 33.0 34.0 33.0 34.0 2 33.3225 34.0 34.0 34.0 33.0 34.0 3 33.4475 34.0 34.0 34.0 33.0 34.0 4 33.51225 34.0 34.0 34.0 33.0 34.0 5 33.4995 34.0 34.0 34.0 33.0 34.0 6 37.3425 38.0 38.0 38.0 36.0 38.0 7 37.5135 38.0 38.0 38.0 37.0 38.0 8 37.5245 38.0 38.0 38.0 38.0 38.0 9 37.64475 38.0 38.0 38.0 38.0 38.0 10-14 37.61645 38.0 38.0 38.0 38.0 38.0 15-19 37.58595 38.0 38.0 38.0 38.0 38.0 20-24 37.564299999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.48745 38.0 38.0 38.0 38.0 38.0 30-34 37.486149999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.46704999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.3808 38.0 38.0 38.0 37.2 38.0 45-49 37.4243 38.0 38.0 38.0 37.4 38.0 50-54 37.375299999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.328 38.0 38.0 38.0 37.0 38.0 60-64 37.2863 38.0 38.0 38.0 37.0 38.0 65-69 37.25195 38.0 38.0 38.0 37.0 38.0 70-74 37.11880000000001 38.0 38.0 38.0 36.8 38.0 75-79 36.5663 38.0 38.0 38.0 36.0 38.0 80-84 36.49915 38.0 38.0 38.0 36.0 38.0 85-89 36.43585 38.0 38.0 38.0 35.6 38.0 90-94 36.2739 38.0 38.0 38.0 35.0 38.0 95-99 36.1908 38.0 38.0 38.0 34.6 38.0 100-104 36.06755 38.0 38.0 38.0 34.0 38.0 105-109 35.9671 38.0 38.0 38.0 34.0 38.0 110-114 35.83495 38.0 38.0 38.0 33.6 38.0 115-119 35.67325 38.0 38.0 38.0 33.0 38.0 120-124 35.4173 38.0 37.2 38.0 31.2 38.0 125-129 35.226150000000004 38.0 36.8 38.0 31.0 38.0 130-134 34.9525 38.0 36.0 38.0 29.0 38.0 135-139 34.609899999999996 38.0 36.0 38.0 27.6 38.0 140-144 34.128699999999995 38.0 34.8 38.0 25.0 38.0 145-149 33.45465 38.0 33.0 38.0 20.6 38.0 150-151 29.038375000000002 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 6.0 16 6.0 17 2.0 18 15.0 19 43.0 20 3.0 21 7.0 22 5.0 23 9.0 24 12.0 25 12.0 26 9.0 27 14.0 28 24.0 29 29.0 30 40.0 31 33.0 32 55.0 33 70.0 34 87.0 35 197.0 36 539.0 37 2772.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.46888831033585 13.069513147617808 11.950013017443375 35.51158552460297 2 22.925 16.45 31.924999999999997 28.7 3 20.25 21.4 25.85 32.5 4 22.075 27.950000000000003 21.25 28.725 5 24.418313735301474 32.874655991994 21.841381035776834 20.8656492369277 6 21.025 34.375 23.875 20.724999999999998 7 14.475 28.225 40.175 17.125 8 17.95 26.575 30.349999999999998 25.124999999999996 9 17.65 26.400000000000002 32.5 23.45 10-14 19.8 29.970000000000002 26.345000000000002 23.885 15-19 20.23 28.505000000000003 27.12 24.145 20-24 19.675 29.07 27.3 23.955000000000002 25-29 20.26 28.92 26.755000000000003 24.065 30-34 19.383722675203842 29.218148166675007 26.842078935520984 24.55605022260017 35-39 19.95699569956996 28.76787678767877 26.972697269726975 24.302430243024304 40-44 19.7 28.015 27.500000000000004 24.785 45-49 20.925 28.310000000000002 27.255000000000003 23.51 50-54 20.305 27.965 27.389999999999997 24.34 55-59 20.035 28.37 27.55 24.044999999999998 60-64 20.485 28.33 26.76 24.425 65-69 20.125 30.014999999999997 25.624999999999996 24.235 70-74 19.814999999999998 29.925 26.075 24.185000000000002 75-79 19.919999999999998 29.645 26.290000000000003 24.145 80-84 20.355 28.765 26.479999999999997 24.4 85-89 20.285 28.64 26.634999999999998 24.44 90-94 20.4 28.29 26.889999999999997 24.42 95-99 20.69 28.015 27.01 24.285 100-104 20.555 27.794999999999998 27.165 24.485 105-109 21.4 27.834999999999997 26.445 24.32 110-114 21.035 28.095 26.69 24.18 115-119 20.645 28.410000000000004 26.005 24.94 120-124 20.515 27.955000000000002 26.5 25.03 125-129 21.33 27.860000000000003 26.135 24.675 130-134 21.355 27.76 26.06 24.825 135-139 21.315 28.34 25.555 24.79 140-144 21.385 28.015 25.655 24.945 145-149 21.19 28.634999999999998 25.155 25.019999999999996 150-151 21.10887603721398 28.0110636157908 24.9685692733216 25.911491073673627 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.5 20 1.5 21 1.5 22 1.5 23 0.0 24 1.0 25 5.0 26 8.0 27 7.5 28 9.5 29 13.5 30 14.5 31 22.0 32 34.0 33 48.0 34 62.5 35 76.5 36 97.5 37 111.0 38 123.0 39 142.0 40 152.5 41 185.5 42 225.0 43 238.5 44 228.0 45 228.5 46 241.5 47 239.0 48 228.0 49 208.5 50 188.5 51 153.0 52 126.0 53 117.0 54 103.5 55 90.5 56 68.0 57 48.0 58 42.5 59 29.0 60 21.0 61 18.5 62 11.5 63 8.0 64 3.5 65 0.0 66 0.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.975 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.525 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54959854959856 95.125 2 1.1914011914011913 2.3 3 0.1036001036001036 0.3 4 0.0518000518000518 0.2 5 0.0259000259000259 0.125 6 0.0259000259000259 0.15 7 0.0 0.0 8 0.0259000259000259 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0259000259000259 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCATCATCTCGTATGC 64 1.6 TruSeq Adapter, Index 1 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCATCATCTCGTATGCC 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACGAAGCAACCCTA 6 0.15 No Hit GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.7874999999999996 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.675 0.0 0.0 0.0 0.0 114-115 4.1375 0.0 0.0 0.0 0.0 116-117 4.5375 0.0 0.0 0.0 0.0 118-119 5.1 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 6.074999999999999 0.0 0.0 0.0 0.0 124-125 6.55 0.0 0.0 0.0 0.0 126-127 7.0 0.0 0.0 0.0 0.0 128-129 7.550000000000001 0.0 0.0 0.0 0.0 130-131 8.274999999999999 0.0 0.0 0.0 0.0 132-133 8.912500000000001 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.7 0.0 0.0 0.0 0.0 138-139 11.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168873 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168873_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.962 33.0 33.0 34.0 32.0 34.0 2 33.01375 34.0 33.0 34.0 33.0 34.0 3 32.9835 34.0 33.0 34.0 33.0 34.0 4 33.0185 34.0 33.0 34.0 33.0 34.0 5 32.9725 34.0 33.0 34.0 33.0 34.0 6 37.0385 38.0 38.0 38.0 37.0 38.0 7 37.04475 38.0 38.0 38.0 37.0 38.0 8 37.0655 38.0 38.0 38.0 37.0 38.0 9 37.0765 38.0 38.0 38.0 37.0 38.0 10-14 37.037499999999994 38.0 38.0 38.0 37.2 38.0 15-19 37.03935 38.0 38.0 38.0 37.0 38.0 20-24 37.001 38.0 38.0 38.0 37.0 38.0 25-29 36.971050000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.9654 38.0 38.0 38.0 37.0 38.0 35-39 36.9303 38.0 38.0 38.0 37.2 38.0 40-44 36.9244 38.0 38.0 38.0 37.0 38.0 45-49 36.8633 38.0 38.0 38.0 37.0 38.0 50-54 36.8707 38.0 38.0 38.0 37.0 38.0 55-59 36.85615 38.0 38.0 38.0 37.0 38.0 60-64 36.86275 38.0 38.0 38.0 36.8 38.0 65-69 36.542950000000005 38.0 38.0 38.0 36.6 38.0 70-74 36.1842 38.0 38.0 38.0 36.0 38.0 75-79 36.13245 38.0 38.0 38.0 35.6 38.0 80-84 36.0166 38.0 38.0 38.0 35.0 38.0 85-89 35.91625 38.0 38.0 38.0 34.4 38.0 90-94 35.77125 38.0 38.0 38.0 34.0 38.0 95-99 35.705999999999996 38.0 38.0 38.0 34.0 38.0 100-104 35.62775 38.0 38.0 38.0 33.8 38.0 105-109 35.52165 38.0 38.0 38.0 33.2 38.0 110-114 35.39455 38.0 38.0 38.0 32.8 38.0 115-119 35.148199999999996 38.0 38.0 38.0 31.0 38.0 120-124 34.97205 38.0 37.6 38.0 30.4 38.0 125-129 34.7189 38.0 36.6 38.0 28.2 38.0 130-134 34.4589 38.0 36.0 38.0 26.8 38.0 135-139 33.7889 38.0 35.4 38.0 21.8 38.0 140-144 33.2741 38.0 33.2 38.0 15.0 38.0 145-149 32.3638 38.0 33.0 38.0 8.2 38.0 150-151 27.420375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 8.0 4 4.0 5 4.0 6 0.0 7 3.0 8 2.0 9 1.0 10 2.0 11 7.0 12 5.0 13 8.0 14 7.0 15 5.0 16 13.0 17 57.0 18 9.0 19 7.0 20 14.0 21 10.0 22 10.0 23 4.0 24 4.0 25 10.0 26 13.0 27 18.0 28 23.0 29 32.0 30 28.0 31 36.0 32 62.0 33 74.0 34 87.0 35 146.0 36 494.0 37 2773.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.574999999999996 19.3 18.5 23.625 2 28.175 25.75 28.050000000000004 18.025 3 23.474999999999998 27.3 29.65 19.575 4 26.3 31.5 21.675 20.525 5 27.200000000000003 34.699999999999996 20.599999999999998 17.5 6 24.517906336088156 34.5855246681693 23.040320560981716 17.856248434760833 7 20.450563204005007 23.85481852315394 35.5694618272841 20.125156445556946 8 24.024024024024023 26.151151151151154 25.05005005005005 24.774774774774773 9 24.724724724724727 26.126126126126124 26.101101101101097 23.04804804804805 10-14 24.966207759699625 27.714643304130167 25.03128911138924 22.287859824780977 15-19 25.48941070445101 26.590897711911083 26.300505682671606 21.619185900966304 20-24 25.016273596715237 28.15081868709629 25.917580491712982 20.91532722447549 25-29 25.020032051282055 28.46053685897436 25.901442307692307 20.617988782051285 30-34 24.57801152016028 27.433007763586275 26.771850738792885 21.217129977460555 35-39 23.862497494487872 27.295049108037684 27.139707356183607 21.70274604129084 40-44 25.828577150295384 27.050165214779216 26.33924101331731 20.78201662160809 45-49 24.543316150342825 26.655322556428608 26.88554126420099 21.91582002902758 50-54 24.233021370301785 27.315950152645012 26.990641109053605 21.4603873679996 55-59 24.450563204005007 27.32916145181477 27.47434292866083 20.7459324155194 60-64 24.14034736473297 29.01546623955153 25.787076430251766 21.057109965463734 65-69 25.107639931911486 28.717332532291977 26.018824471813357 20.156203063983178 70-74 24.535576586049775 28.491312402984327 26.323168594461972 20.64994241650393 75-79 24.368023226710715 28.167392501376582 26.770786404365023 20.69379786754768 80-84 24.70440881763527 28.1312625250501 26.523046092184373 20.64128256513026 85-89 25.025045081146065 27.61470647164897 26.567822079743536 20.79242636746143 90-94 24.86984381257509 27.673207849419303 26.3516219463356 21.105326391670005 95-99 25.01876407305479 28.16112084063047 26.63497623217413 20.185138854140604 100-104 24.574744846908146 27.536521913147887 27.126275765459273 20.76245747448469 105-109 24.370715107841665 27.87369263874293 26.877846169243856 20.877746084171545 110-114 24.90118577075099 27.682993946064943 27.287737029068893 20.128083254115175 115-119 25.51689612015019 27.709637046307883 26.698372966207764 20.075093867334168 120-124 25.721153846153843 28.114983974358974 26.66266025641026 19.501201923076923 125-129 25.62099358974359 27.9296875 26.817908653846157 19.631410256410255 130-134 26.167943518101243 27.85038305543037 26.568524360322463 19.413149066145913 135-139 26.48310387984981 28.205256570713395 25.546933667083856 19.76470588235294 140-144 26.8951713785339 27.675756817613212 26.624968726544907 18.804103077307982 145-149 27.002402883460153 27.347817380857027 26.396676011213454 19.253103724469366 150-151 27.0 27.5875 26.0 19.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 1.5 24 2.5 25 2.0 26 1.5 27 2.5 28 2.0 29 2.5 30 6.5 31 10.5 32 13.0 33 16.0 34 21.5 35 30.0 36 45.5 37 74.0 38 98.5 39 120.5 40 146.0 41 175.5 42 218.0 43 264.0 44 276.5 45 275.0 46 287.0 47 261.0 48 246.5 49 249.0 50 202.5 51 166.0 52 147.5 53 130.5 54 126.0 55 95.0 56 64.0 57 56.5 58 42.5 59 29.0 60 22.5 61 14.5 62 14.0 63 13.5 64 6.5 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.17500000000000002 7 0.125 8 0.1 9 0.1 10-14 0.125 15-19 0.135 20-24 0.145 25-29 0.16 30-34 0.17500000000000002 35-39 0.22 40-44 0.13 45-49 0.095 50-54 0.095 55-59 0.125 60-64 0.105 65-69 0.13 70-74 0.145 75-79 0.11499999999999999 80-84 0.2 85-89 0.18 90-94 0.12 95-99 0.075 100-104 0.06 105-109 0.08499999999999999 110-114 0.065 115-119 0.125 120-124 0.16 125-129 0.16 130-134 0.145 135-139 0.125 140-144 0.075 145-149 0.12 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.63084474296048 95.45 2 1.1108240764660295 2.15 3 0.15499870834409715 0.44999999999999996 4 0.051666236114699046 0.2 5 0.025833118057349523 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025833118057349523 1.625 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 65 1.625 Illumina Single End PCR Primer 1 (100% over 50bp) GTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.55 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.225 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.3 0.0 0.0 0.0 0.0 116-117 4.737500000000001 0.0 0.0 0.0 0.0 118-119 5.262499999999999 0.0 0.0 0.0 0.0 120-121 5.675 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.675 0.0 0.0 0.0 0.0 126-127 7.1625 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 10.1875 0.0 0.0 0.0 0.0 136-137 11.175 0.0 0.0 0.0 0.0 138-139 12.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAAG 10 0.006882143 144.6375 145 >>END_MODULE Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578170 spots for SRR7168873.sra Written 578170 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra Read 578163 spots for SRR7168873.sra Written 578163 spots for SRR7168873.sra SRR ids: ['SRR7168873.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jzss65wd SRR7168873.sra spots: 11563267 blocks: [[1, 578163], [578164, 1156326], [1156327, 1734489], [1734490, 2312652], [2312653, 2890815], [2890816, 3468978], [3468979, 4047141], [4047142, 4625304], [4625305, 5203467], [5203468, 5781630], [5781631, 6359793], [6359794, 6937956], [6937957, 7516119], [7516120, 8094282], [8094283, 8672445], [8672446, 9250608], [9250609, 9828771], [9828772, 10406934], [10406935, 10985097], [10985098, 11563267]] SRR7168873 file size 3896711 SRR7168873 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168873 SRR7168873_1.fastq SRR7168873_2.fastq Input file: SRR7168873_1.fastq Paired file: SRR7168873_2.fastq trimmed: SRR7168873-trimmed-pair1.fastq, SRR7168873-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 12:43:03 2025 >> started Sat Feb 15 12:47:39 2025 >> done (276.105s) 11563267 read pairs processed; of these: 45705 ( 0.40%) short read pairs filtered out after trimming by size control 238157 ( 2.06%) empty read pairs filtered out after trimming by size control 11279405 (97.55%) read pairs available; of these: 6162167 (54.63%) trimmed read pairs available after processing 5117238 (45.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 10 0.00% 21 10 0.00% 22 6 0.00% 23 8 0.00% 24 12 0.00% 25 12 0.00% 26 16 0.00% 27 14 0.00% 28 15 0.00% 29 18 0.00% 30 22 0.00% 31 15 0.00% 32 16 0.00% 33 14 0.00% 34 23 0.00% 35 25 0.00% 36 17 0.00% 37 26 0.00% 38 34 0.00% 39 33 0.00% 40 25 0.00% 41 39 0.00% 42 35 0.00% 43 40 0.00% 44 67 0.00% 45 71 0.00% 46 78 0.00% 47 114 0.00% 48 89 0.00% 49 114 0.00% 50 112 0.00% 51 143 0.00% 52 139 0.00% 53 154 0.00% 54 184 0.00% 55 172 0.00% 56 225 0.00% 57 223 0.00% 58 245 0.00% 59 282 0.00% 60 299 0.00% 61 360 0.00% 62 388 0.00% 63 434 0.00% 64 475 0.00% 65 612 0.01% 66 754 0.01% 67 1145 0.01% 68 2239 0.02% 69 13819 0.12% 70 14930 0.13% 71 5052 0.04% 72 3224 0.03% 73 2894 0.03% 74 2622 0.02% 75 2691 0.02% 76 2812 0.02% 77 2834 0.03% 78 2881 0.03% 79 3141 0.03% 80 3440 0.03% 81 3847 0.03% 82 4102 0.04% 83 5077 0.05% 84 6894 0.06% 85 8063 0.07% 86 8418 0.07% 87 9139 0.08% 88 9711 0.09% 89 10341 0.09% 90 10685 0.09% 91 11428 0.10% 92 11872 0.11% 93 13175 0.12% 94 14145 0.13% 95 15067 0.13% 96 15713 0.14% 97 16161 0.14% 98 16377 0.15% 99 17288 0.15% 100 18274 0.16% 101 19136 0.17% 102 20477 0.18% 103 21629 0.19% 104 22857 0.20% 105 24408 0.22% 106 24945 0.22% 107 25821 0.23% 108 26737 0.24% 109 28364 0.25% 110 29660 0.26% 111 29875 0.26% 112 31290 0.28% 113 33430 0.30% 114 34707 0.31% 115 36116 0.32% 116 37322 0.33% 117 38003 0.34% 118 38103 0.34% 119 38592 0.34% 120 40057 0.36% 121 41194 0.37% 122 42973 0.38% 123 44977 0.40% 124 46739 0.41% 125 48055 0.43% 126 49845 0.44% 127 51034 0.45% 128 51718 0.46% 129 53180 0.47% 130 53737 0.48% 131 55167 0.49% 132 56981 0.51% 133 59821 0.53% 134 61416 0.54% 135 64428 0.57% 136 66442 0.59% 137 69041 0.61% 138 71508 0.63% 139 73665 0.65% 140 75566 0.67% 141 80022 0.71% 142 85169 0.76% 143 92197 0.82% 144 102162 0.91% 145 115344 1.02% 146 136915 1.21% 147 173465 1.54% 148 255663 2.27% 149 495222 4.39% 150 2591259 22.97% 151 5117238 45.37% 11279405 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=17 prefix-density=1.01 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=80.92 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.1 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=22 prefix-density=0.79 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=29.55 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.2 sequence=AACCTGAAACCGTGTACGTACAAGCAGTGGGAGCACGCTTAGGCGTGTGACTGCGTACCTTTTGTATAATGGGTCAGCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAAACCGAGTCTTAACTGGGCGTTAAGTTGCAGGGTATAGACCCGAAACCCGGTGATCTAGCCATGGGCAGGTTGAAGGTTGGGTAACACTAACTGGAGGACCGAACCGACTAATGTTGAAAAATTA SRR7168873 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 15:41:10 Started mapping on | Feb 15 15:41:24 Finished on | Feb 15 17:12:45 Mapping speed, Million of reads per hour | 7.41 Number of input reads | 11279405 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 9973174 Uniquely mapped reads % | 88.42% Average mapped length | 289.46 Number of splices: Total | 8763032 Number of splices: Annotated (sjdb) | 8614659 Number of splices: GT/AG | 8568923 Number of splices: GC/AG | 170282 Number of splices: AT/AC | 4442 Number of splices: Non-canonical | 19385 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249899 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 130341 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.97% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1086797 1086797 1086797 N_multimapping 249899 249899 249899 N_noFeature 236597 9728098 334308 N_ambiguous 211468 833 63693 UnstrandedReadsAssigned:9525109 PositiveStrandReadsAssigned:244243 NegativeStrandReadsAssigned:9575173 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7168873 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168873-trimmed-pair1.fastq SRR7168873-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,279,405 reads, 9,710,381 reads pseudoaligned [quant] estimated average fragment length: 205.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,376 rounds 52401 SRR7168873.ke.tsv 34699 SRR7168873.se.tsv 87100 total ==> SRR7168873.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.61 207 9.48544 Potri.005G024800.1.v4.1 1035 830.606 132 13.2071 Potri.004G059700.1.v4.1 961 756.612 13 1.42791 Potri.007G009000.2.v4.1 1416 1211.61 0 0 Potri.003G141000.2.v4.1 2943 2738.61 411.496 12.4872 Potri.016G087400.1.v4.1 270 91.526 405.607 368.291 Potri.015G069301.1.v4.1 564 360.613 0 0 Potri.010G195200.1.v4.1 1773 1568.61 2 0.105961 Potri.012G127500.1.v4.1 977 772.612 32 3.44206 ==> SRR7168873.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 262 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7168873 completed mapping pipeline successfully