Starting /dee2/code/volunteer_pipeline.sh SRR7168874 current disk space = 3091331072000 free memory = 1578435296 SRR7168874 SRAfilesize 90fd59ada46551ac8e9678cce6f4042d SRR7168874.sra SRR7168874.sra file validated SRR7168874 is paired end SRR7168874 is conventional basespace SRR7168874 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95975 34.0 33.0 34.0 32.0 34.0 2 33.1425 34.0 33.0 34.0 32.0 34.0 3 33.226 34.0 33.0 34.0 32.0 34.0 4 33.24725 34.0 33.0 34.0 33.0 34.0 5 33.3845 34.0 33.0 34.0 33.0 34.0 6 37.082 38.0 37.0 38.0 36.0 38.0 7 37.35075 38.0 38.0 38.0 37.0 38.0 8 37.459 38.0 38.0 38.0 37.0 38.0 9 37.48625 38.0 38.0 38.0 37.0 38.0 10-14 37.4912 38.0 38.0 38.0 37.6 38.0 15-19 37.51965 38.0 38.0 38.0 37.8 38.0 20-24 37.4745 38.0 38.0 38.0 37.4 38.0 25-29 37.449799999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.4378 38.0 38.0 38.0 37.0 38.0 35-39 37.37395 38.0 38.0 38.0 37.0 38.0 40-44 37.3282 38.0 38.0 38.0 37.0 38.0 45-49 37.2879 38.0 38.0 38.0 37.0 38.0 50-54 37.20525 38.0 38.0 38.0 36.8 38.0 55-59 37.1385 38.0 38.0 38.0 36.2 38.0 60-64 36.991200000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.010749999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.00445 38.0 38.0 38.0 35.8 38.0 75-79 36.92075000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.68305 38.0 38.0 38.0 34.8 38.0 85-89 36.5538 38.0 38.0 38.0 34.2 38.0 90-94 36.415549999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.22709999999999 38.0 38.0 38.0 33.8 38.0 100-104 36.21325 38.0 38.0 38.0 33.4 38.0 105-109 36.13195 38.0 37.4 38.0 33.4 38.0 110-114 35.84935 38.0 37.0 38.0 31.8 38.0 115-119 35.633799999999994 38.0 37.0 38.0 30.6 38.0 120-124 35.32295 38.0 36.4 38.0 28.8 38.0 125-129 35.0099 38.0 36.0 38.0 27.8 38.0 130-134 34.512299999999996 38.0 35.2 38.0 24.4 38.0 135-139 33.936099999999996 38.0 34.2 38.0 22.4 38.0 140-144 33.35705 38.0 33.2 38.0 20.2 38.0 145-149 32.014250000000004 38.0 32.6 38.0 10.8 38.0 150-151 27.930125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 5.0 16 3.0 17 1.0 18 5.0 19 8.0 20 2.0 21 2.0 22 11.0 23 7.0 24 15.0 25 23.0 26 13.0 27 26.0 28 47.0 29 46.0 30 49.0 31 66.0 32 87.0 33 112.0 34 171.0 35 246.0 36 701.0 37 2351.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.34696016771489 11.713836477987421 11.373165618448636 40.56603773584906 2 21.45 17.424999999999997 36.0 25.124999999999996 3 20.25 21.375 25.7 32.675 4 22.75 31.35 22.625 23.275000000000002 5 23.1 34.35 23.599999999999998 18.95 6 18.8 36.875 25.35 18.975 7 13.15 24.474999999999998 44.125 18.25 8 18.2 24.6 31.974999999999998 25.224999999999998 9 18.675 22.75 34.5 24.075 10-14 19.81 29.37 27.6 23.22 15-19 20.22 28.185 28.375 23.22 20-24 19.11 28.62 28.28 23.990000000000002 25-29 19.45 28.720000000000002 28.285 23.544999999999998 30-34 19.455 28.705000000000002 28.395 23.445 35-39 19.86 28.68 27.79 23.669999999999998 40-44 20.125 29.025000000000002 27.46 23.39 45-49 19.845 28.09 27.965 24.099999999999998 50-54 19.759999999999998 28.425 28.28 23.535 55-59 19.985 28.34 28.16 23.515 60-64 19.985 28.59 27.284999999999997 24.14 65-69 20.375 28.705000000000002 27.625 23.294999999999998 70-74 20.095 28.33 28.42 23.155 75-79 19.189999999999998 29.03 28.365000000000002 23.415 80-84 20.255000000000003 28.175 28.115000000000002 23.455000000000002 85-89 20.315 29.310000000000002 26.935 23.44 90-94 20.02 28.675 27.205000000000002 24.099999999999998 95-99 20.665 28.95 27.41 22.975 100-104 20.275000000000002 28.43 27.650000000000002 23.645 105-109 20.7 28.794999999999998 27.084999999999997 23.419999999999998 110-114 20.815 28.189999999999998 27.26 23.735 115-119 20.565 28.605000000000004 27.74 23.09 120-124 20.87 28.660000000000004 27.245 23.225 125-129 20.39 28.525 27.405 23.68 130-134 21.205 28.499999999999996 26.88 23.415 135-139 20.87 28.410000000000004 27.0 23.72 140-144 21.099999999999998 28.685 26.195 24.02 145-149 21.18 28.804999999999996 26.345000000000002 23.669999999999998 150-151 21.375 27.750000000000004 27.437499999999996 23.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 4.5 23 3.0 24 1.5 25 3.0 26 5.5 27 6.5 28 11.0 29 12.5 30 18.0 31 33.0 32 41.0 33 47.5 34 60.0 35 68.0 36 88.0 37 125.5 38 143.0 39 177.0 40 209.5 41 219.5 42 248.5 43 257.5 44 267.0 45 277.5 46 259.5 47 231.0 48 221.0 49 209.5 50 172.5 51 136.5 52 107.5 53 82.0 54 60.5 55 46.0 56 33.5 57 22.5 58 19.5 59 21.5 60 16.0 61 7.5 62 7.0 63 6.0 64 2.5 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.3625 0.0 0.0 0.0 0.0 128-129 6.925000000000001 0.0 0.0 0.0 0.0 130-131 7.525 0.0 0.0 0.0 0.0 132-133 8.025 0.0 0.0 0.0 0.0 134-135 8.575 0.0 0.0 0.0 0.0 136-137 9.0875 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTG 10 0.006836113 144.9625 5 CAGATCG 20 0.005942617 28.992498 140-144 >>END_MODULE SRR7168874 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168874_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8855 33.0 33.0 34.0 32.0 34.0 2 32.9855 33.0 33.0 34.0 32.0 34.0 3 32.98925 34.0 33.0 34.0 32.0 34.0 4 32.93075 34.0 33.0 34.0 32.0 34.0 5 32.93575 34.0 33.0 34.0 32.0 34.0 6 37.125 38.0 38.0 38.0 37.0 38.0 7 37.26325 38.0 38.0 38.0 37.0 38.0 8 37.1075 38.0 38.0 38.0 37.0 38.0 9 37.057 38.0 38.0 38.0 37.0 38.0 10-14 37.0895 38.0 38.0 38.0 37.0 38.0 15-19 37.09585 38.0 38.0 38.0 37.0 38.0 20-24 37.01815 38.0 38.0 38.0 36.8 38.0 25-29 37.084399999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.9722 38.0 38.0 38.0 36.4 38.0 35-39 36.978100000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.839400000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.8912 38.0 38.0 38.0 36.0 38.0 50-54 36.73535 38.0 38.0 38.0 36.0 38.0 55-59 36.701049999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.69435 38.0 38.0 38.0 35.6 38.0 65-69 36.6749 38.0 38.0 38.0 35.6 38.0 70-74 36.504 38.0 38.0 38.0 34.8 38.0 75-79 36.42535 38.0 38.0 38.0 34.4 38.0 80-84 36.397949999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.27265 38.0 38.0 38.0 34.2 38.0 90-94 36.23015 38.0 38.0 38.0 33.8 38.0 95-99 36.13545 38.0 38.0 38.0 33.8 38.0 100-104 35.97735 38.0 38.0 38.0 33.4 38.0 105-109 35.7046 38.0 37.4 38.0 31.2 38.0 110-114 35.65689999999999 38.0 37.2 38.0 31.4 38.0 115-119 35.54335 38.0 37.4 38.0 31.2 38.0 120-124 35.2411 38.0 36.4 38.0 29.4 38.0 125-129 35.004949999999994 38.0 36.0 38.0 28.2 38.0 130-134 34.442899999999995 38.0 35.6 38.0 25.0 38.0 135-139 33.96470000000001 38.0 33.8 38.0 23.0 38.0 140-144 33.285999999999994 38.0 33.0 38.0 18.2 38.0 145-149 32.09305 38.0 33.0 38.0 8.4 38.0 150-151 27.189375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 2.0 5 2.0 6 1.0 7 1.0 8 2.0 9 1.0 10 2.0 11 2.0 12 1.0 13 4.0 14 4.0 15 3.0 16 6.0 17 9.0 18 7.0 19 12.0 20 12.0 21 4.0 22 16.0 23 19.0 24 14.0 25 23.0 26 26.0 27 32.0 28 35.0 29 48.0 30 47.0 31 51.0 32 82.0 33 100.0 34 128.0 35 239.0 36 574.0 37 2484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 18.7 15.725 28.9 2 24.975 25.95 33.074999999999996 16.0 3 20.825 28.425 30.675 20.075000000000003 4 23.75 35.75 22.075 18.425 5 23.75 37.724999999999994 21.55 16.975 6 19.275000000000002 37.974999999999994 24.2 18.55 7 18.675 19.35 40.875 21.099999999999998 8 20.424999999999997 24.125 29.15 26.3 9 21.125 25.424999999999997 29.5 23.95 10-14 23.355 29.14 25.814999999999998 21.69 15-19 22.895 28.199999999999996 27.915 20.990000000000002 20-24 23.01 28.485 28.22 20.285 25-29 23.015 28.07 28.025 20.89 30-34 22.814999999999998 28.560000000000002 27.965 20.66 35-39 23.01 28.315 28.42 20.255000000000003 40-44 23.29 28.315 27.96 20.435 45-49 22.89 27.55 28.310000000000002 21.25 50-54 23.325000000000003 27.655 28.77 20.25 55-59 23.215 28.23 28.139999999999997 20.415 60-64 23.34 27.855 27.839999999999996 20.965 65-69 23.225 27.634999999999998 28.33 20.810000000000002 70-74 23.080000000000002 28.470000000000002 28.065 20.385 75-79 23.25 27.35 29.075 20.325 80-84 23.294999999999998 27.91 27.82 20.974999999999998 85-89 23.445 27.235 28.675 20.645 90-94 23.25 27.93 28.060000000000002 20.76 95-99 23.74 27.43 27.900000000000002 20.93 100-104 23.830000000000002 27.810000000000002 28.205000000000002 20.155 105-109 23.365 28.215 28.044999999999998 20.375 110-114 23.71 27.79 27.855 20.645 115-119 24.275 28.605000000000004 27.145000000000003 19.975 120-124 24.165 28.065 27.779999999999998 19.99 125-129 24.37 28.435 27.76 19.435 130-134 24.965 26.91 27.889999999999997 20.235 135-139 25.014999999999997 28.395 26.99 19.6 140-144 25.180000000000003 28.505000000000003 27.250000000000004 19.064999999999998 145-149 25.974999999999998 28.51 26.565 18.95 150-151 25.174999999999997 29.2 26.937499999999996 18.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.0 24 0.5 25 3.0 26 4.5 27 4.0 28 8.0 29 15.0 30 19.5 31 20.0 32 24.5 33 34.5 34 56.0 35 81.0 36 92.0 37 117.0 38 149.5 39 174.5 40 201.5 41 222.0 42 240.5 43 264.5 44 275.5 45 269.5 46 264.0 47 245.0 48 225.0 49 203.0 50 168.5 51 141.5 52 111.0 53 77.0 54 70.0 55 63.0 56 44.5 57 36.0 58 24.0 59 15.0 60 10.0 61 6.5 62 4.5 63 1.5 64 1.5 65 2.0 66 0.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9249999999999998 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5875000000000004 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 4.0125 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.0125 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.3375 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.475 0.0 0.0 0.0 0.0 132-133 7.987500000000001 0.0 0.0 0.0 0.0 134-135 8.55 0.0 0.0 0.0 0.0 136-137 9.0625 0.0 0.0 0.0 0.0 138-139 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAA 10 0.006830828 145.0 9 >>END_MODULE Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834741 spots for SRR7168874.sra Written 834741 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra Read 834734 spots for SRR7168874.sra Written 834734 spots for SRR7168874.sra SRR ids: ['SRR7168874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0vpwxpnb SRR7168874.sra spots: 16694687 blocks: [[1, 834734], [834735, 1669468], [1669469, 2504202], [2504203, 3338936], [3338937, 4173670], [4173671, 5008404], [5008405, 5843138], [5843139, 6677872], [6677873, 7512606], [7512607, 8347340], [8347341, 9182074], [9182075, 10016808], [10016809, 10851542], [10851543, 11686276], [11686277, 12521010], [12521011, 13355744], [13355745, 14190478], [14190479, 15025212], [15025213, 15859946], [15859947, 16694687]] SRR7168874 file size 5635581 SRR7168874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168874 SRR7168874_1.fastq SRR7168874_2.fastq Input file: SRR7168874_1.fastq Paired file: SRR7168874_2.fastq trimmed: SRR7168874-trimmed-pair1.fastq, SRR7168874-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 13:45:09 2025 >> started Sat Feb 15 13:49:53 2025 >> done (284.613s) 16694687 read pairs processed; of these: 13729 ( 0.08%) short read pairs filtered out after trimming by size control 21842 ( 0.13%) empty read pairs filtered out after trimming by size control 16659116 (99.79%) read pairs available; of these: 8627659 (51.79%) trimmed read pairs available after processing 8031457 (48.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 10 0.00% 21 3 0.00% 22 2 0.00% 23 6 0.00% 24 7 0.00% 25 6 0.00% 26 6 0.00% 27 7 0.00% 28 12 0.00% 29 14 0.00% 30 6 0.00% 31 13 0.00% 32 15 0.00% 33 16 0.00% 34 14 0.00% 35 18 0.00% 36 21 0.00% 37 21 0.00% 38 36 0.00% 39 43 0.00% 40 53 0.00% 41 57 0.00% 42 59 0.00% 43 55 0.00% 44 75 0.00% 45 66 0.00% 46 90 0.00% 47 86 0.00% 48 116 0.00% 49 122 0.00% 50 140 0.00% 51 140 0.00% 52 161 0.00% 53 193 0.00% 54 215 0.00% 55 253 0.00% 56 289 0.00% 57 310 0.00% 58 324 0.00% 59 364 0.00% 60 407 0.00% 61 515 0.00% 62 640 0.00% 63 585 0.00% 64 705 0.00% 65 803 0.00% 66 891 0.01% 67 1016 0.01% 68 1119 0.01% 69 1833 0.01% 70 1727 0.01% 71 1683 0.01% 72 1803 0.01% 73 2092 0.01% 74 2265 0.01% 75 2384 0.01% 76 2746 0.02% 77 2922 0.02% 78 3425 0.02% 79 3740 0.02% 80 4307 0.03% 81 4767 0.03% 82 5257 0.03% 83 5974 0.04% 84 7006 0.04% 85 8036 0.05% 86 8336 0.05% 87 8777 0.05% 88 9833 0.06% 89 10409 0.06% 90 11304 0.07% 91 12254 0.07% 92 13057 0.08% 93 14076 0.08% 94 15307 0.09% 95 16125 0.10% 96 17226 0.10% 97 18035 0.11% 98 18702 0.11% 99 19721 0.12% 100 21192 0.13% 101 22023 0.13% 102 23407 0.14% 103 24406 0.15% 104 25998 0.16% 105 27463 0.16% 106 28184 0.17% 107 29389 0.18% 108 30530 0.18% 109 31761 0.19% 110 32929 0.20% 111 34209 0.21% 112 35505 0.21% 113 36556 0.22% 114 37906 0.23% 115 39361 0.24% 116 40705 0.24% 117 42379 0.25% 118 43199 0.26% 119 44387 0.27% 120 45462 0.27% 121 47159 0.28% 122 48140 0.29% 123 50022 0.30% 124 51981 0.31% 125 53520 0.32% 126 55591 0.33% 127 56988 0.34% 128 59026 0.35% 129 60996 0.37% 130 62738 0.38% 131 64421 0.39% 132 66583 0.40% 133 70227 0.42% 134 72110 0.43% 135 75510 0.45% 136 79291 0.48% 137 83189 0.50% 138 87250 0.52% 139 93552 0.56% 140 98804 0.59% 141 105675 0.63% 142 115233 0.69% 143 128473 0.77% 144 145187 0.87% 145 170805 1.03% 146 209639 1.26% 147 278075 1.67% 148 416589 2.50% 149 805084 4.83% 150 3953587 23.73% 151 8031457 48.21% 16659116 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=29.98 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=10.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.39 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=40.67 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7168874 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 15:06:18 Started mapping on | Feb 15 15:06:33 Finished on | Feb 15 16:51:14 Mapping speed, Million of reads per hour | 9.55 Number of input reads | 16659116 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 14032472 Uniquely mapped reads % | 84.23% Average mapped length | 284.95 Number of splices: Total | 13437337 Number of splices: Annotated (sjdb) | 13126084 Number of splices: GT/AG | 13176962 Number of splices: GC/AG | 210133 Number of splices: AT/AC | 7349 Number of splices: Non-canonical | 42893 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 427598 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 35810 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.94% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2216617 2216617 2216617 N_multimapping 427598 427598 427598 N_noFeature 534099 13774098 695460 N_ambiguous 290870 3714 190686 UnstrandedReadsAssigned:13207503 PositiveStrandReadsAssigned:254660 NegativeStrandReadsAssigned:13146326 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168874 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168874-trimmed-pair1.fastq SRR7168874-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,659,116 reads, 14,748,507 reads pseudoaligned [quant] estimated average fragment length: 224.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7168874.ke.tsv 34699 SRR7168874.se.tsv 87100 total ==> SRR7168874.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.42 775 33.636 Potri.005G024800.1.v4.1 1035 811.421 161 15.4528 Potri.004G059700.1.v4.1 961 737.482 3 0.316809 Potri.007G009000.2.v4.1 1416 1192.42 0 0 Potri.003G141000.2.v4.1 2943 2719.42 888 25.431 Potri.016G087400.1.v4.1 270 93.1946 748 625.084 Potri.015G069301.1.v4.1 564 345.516 0 0 Potri.010G195200.1.v4.1 1773 1549.42 188 9.44965 Potri.012G127500.1.v4.1 977 753.442 54 5.58177 ==> SRR7168874.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 677 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 130 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7168874 completed mapping pipeline successfully