Starting /dee2/code/volunteer_pipeline.sh SRR7168875 current disk space = 3091268907008 free memory = 1446817208 SRR7168875 SRAfilesize e93640d64fa58a7460acf4504ee64b5a SRR7168875.sra SRR7168875.sra file validated SRR7168875 is paired end SRR7168875 is conventional basespace SRR7168875 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39 34.0 33.0 34.0 32.0 34.0 2 33.1555 34.0 33.0 34.0 32.0 34.0 3 33.156 34.0 33.0 34.0 32.0 34.0 4 33.23775 34.0 33.0 34.0 32.0 34.0 5 33.31075 34.0 33.0 34.0 33.0 34.0 6 37.08625 38.0 37.0 38.0 36.0 38.0 7 37.3395 38.0 38.0 38.0 37.0 38.0 8 37.375 38.0 38.0 38.0 37.0 38.0 9 37.461 38.0 38.0 38.0 37.0 38.0 10-14 37.445949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.45395 38.0 38.0 38.0 37.0 38.0 20-24 37.4541 38.0 38.0 38.0 37.0 38.0 25-29 37.3754 38.0 38.0 38.0 37.0 38.0 30-34 37.387600000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.355650000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.3196 38.0 38.0 38.0 37.0 38.0 45-49 37.306999999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2547 38.0 38.0 38.0 36.8 38.0 55-59 37.25169999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.194 38.0 38.0 38.0 36.4 38.0 65-69 37.19135 38.0 38.0 38.0 36.0 38.0 70-74 37.11985 38.0 38.0 38.0 36.0 38.0 75-79 37.02105 38.0 38.0 38.0 36.0 38.0 80-84 36.98165 38.0 38.0 38.0 36.0 38.0 85-89 36.8698 38.0 38.0 38.0 35.0 38.0 90-94 36.79525 38.0 38.0 38.0 35.0 38.0 95-99 36.64569999999999 38.0 38.0 38.0 34.8 38.0 100-104 36.49720000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.428200000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.17475 38.0 37.0 38.0 33.6 38.0 115-119 36.000600000000006 38.0 37.0 38.0 32.8 38.0 120-124 35.78465 38.0 36.8 38.0 31.4 38.0 125-129 35.3887 38.0 36.0 38.0 29.8 38.0 130-134 35.27380000000001 38.0 36.0 38.0 29.4 38.0 135-139 35.04765 38.0 35.8 38.0 28.2 38.0 140-144 34.5353 38.0 34.4 38.0 27.2 38.0 145-149 33.477500000000006 38.0 33.0 38.0 21.4 38.0 150-151 29.416125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 3.0 18 5.0 19 1.0 20 2.0 21 4.0 22 5.0 23 5.0 24 9.0 25 11.0 26 15.0 27 20.0 28 23.0 29 27.0 30 41.0 31 77.0 32 72.0 33 107.0 34 147.0 35 262.0 36 643.0 37 2520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.69270298047277 12.923946557040084 10.560123329907503 38.82322713257965 2 21.775 18.25 35.4 24.575 3 20.65 23.325000000000003 25.45 30.575000000000003 4 22.650000000000002 31.15 22.05 24.15 5 22.1 35.125 23.9 18.875 6 18.3 34.849999999999994 26.275 20.575 7 13.425 24.7 43.275000000000006 18.6 8 17.2 24.85 30.825000000000003 27.125 9 18.8 24.6 32.475 24.125 10-14 19.37 29.535 27.18 23.915 15-19 19.8 28.535 28.384999999999998 23.28 20-24 19.63 28.985 27.755000000000003 23.630000000000003 25-29 20.28 28.58 27.91 23.23 30-34 19.265 28.82 28.335 23.580000000000002 35-39 19.950000000000003 28.645 27.555000000000003 23.849999999999998 40-44 19.950000000000003 28.165000000000003 28.37 23.515 45-49 20.380000000000003 28.205000000000002 28.08 23.335 50-54 20.23 29.065 27.900000000000002 22.805 55-59 20.1 28.655 27.900000000000002 23.345 60-64 19.915 28.84 28.185 23.06 65-69 19.85 29.23 27.54 23.380000000000003 70-74 20.05 28.444999999999997 28.22 23.285 75-79 19.950000000000003 28.044999999999998 28.4 23.605 80-84 19.85 28.825 27.685 23.64 85-89 19.955000000000002 28.965000000000003 27.639999999999997 23.44 90-94 20.200000000000003 28.735 27.77 23.294999999999998 95-99 20.794999999999998 28.255000000000003 27.485 23.465 100-104 20.630000000000003 28.88 27.334999999999997 23.155 105-109 20.265 28.435 27.800000000000004 23.5 110-114 20.349999999999998 29.020000000000003 27.21 23.419999999999998 115-119 20.669999999999998 29.93 26.484999999999996 22.915 120-124 20.560000000000002 28.48 26.895000000000003 24.065 125-129 20.495 28.939999999999998 27.139999999999997 23.425 130-134 20.895 28.73 26.44 23.935000000000002 135-139 20.815 28.475 26.945000000000004 23.765 140-144 20.945 29.060000000000002 26.325 23.669999999999998 145-149 20.8 28.444999999999997 26.46 24.295 150-151 20.925 27.3875 27.287499999999998 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 2.5 25 4.5 26 5.5 27 8.5 28 13.5 29 17.0 30 18.5 31 23.0 32 31.5 33 45.5 34 65.0 35 84.0 36 101.0 37 124.5 38 145.0 39 164.0 40 197.0 41 228.0 42 243.0 43 259.5 44 267.5 45 266.5 46 274.5 47 243.0 48 216.0 49 205.0 50 156.5 51 127.5 52 107.5 53 81.5 54 73.0 55 58.5 56 38.5 57 26.5 58 21.0 59 17.0 60 10.5 61 3.5 62 4.0 63 5.5 64 3.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.5375 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.1125 0.0 0.0 0.0 0.0 98-99 2.4125 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.2249999999999996 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 3.9125 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.65 0.0 0.0 0.0 0.0 114-115 5.1875 0.0 0.0 0.0 0.0 116-117 5.6875 0.0 0.0 0.0 0.0 118-119 6.362500000000001 0.0 0.0 0.0 0.0 120-121 7.0625 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.175 0.0 0.0 0.0 0.0 126-127 8.725000000000001 0.0 0.0 0.0 0.0 128-129 9.1875 0.0 0.0 0.0 0.0 130-131 9.8125 0.0 0.0 0.0 0.0 132-133 10.7125 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.0375 0.0 0.0 0.0 0.0 138-139 12.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7168875 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7555 33.0 33.0 34.0 32.0 34.0 2 32.891 33.0 33.0 34.0 32.0 34.0 3 32.84075 33.0 33.0 34.0 31.0 34.0 4 32.8225 34.0 33.0 34.0 32.0 34.0 5 32.856 34.0 33.0 34.0 32.0 34.0 6 37.00675 38.0 38.0 38.0 36.0 38.0 7 37.0645 38.0 38.0 38.0 37.0 38.0 8 37.06725 38.0 38.0 38.0 37.0 38.0 9 37.025 38.0 38.0 38.0 36.0 38.0 10-14 37.06420000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.02759999999999 38.0 38.0 38.0 37.0 38.0 20-24 36.98479999999999 38.0 38.0 38.0 36.6 38.0 25-29 36.9928 38.0 38.0 38.0 36.6 38.0 30-34 36.9871 38.0 38.0 38.0 37.0 38.0 35-39 36.942099999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.939299999999996 38.0 38.0 38.0 36.6 38.0 45-49 36.93795 38.0 38.0 38.0 36.2 38.0 50-54 36.9328 38.0 38.0 38.0 36.0 38.0 55-59 36.8729 38.0 38.0 38.0 36.0 38.0 60-64 36.84205 38.0 38.0 38.0 36.0 38.0 65-69 36.73394999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.64835000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.522200000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.3908 38.0 38.0 38.0 34.4 38.0 85-89 36.33515 38.0 38.0 38.0 34.0 38.0 90-94 36.25125 38.0 38.0 38.0 34.0 38.0 95-99 36.132250000000006 38.0 38.0 38.0 33.8 38.0 100-104 36.102850000000004 38.0 38.0 38.0 33.6 38.0 105-109 35.9535 38.0 37.8 38.0 33.2 38.0 110-114 35.7606 38.0 37.2 38.0 32.4 38.0 115-119 35.4856 38.0 37.0 38.0 31.0 38.0 120-124 35.342650000000006 38.0 36.6 38.0 30.6 38.0 125-129 35.0693 38.0 36.0 38.0 28.4 38.0 130-134 34.555600000000005 38.0 35.6 38.0 26.2 38.0 135-139 33.9439 38.0 34.6 38.0 23.0 38.0 140-144 33.21315 38.0 33.4 38.0 16.2 38.0 145-149 32.15005 38.0 32.8 38.0 8.6 38.0 150-151 26.863 33.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 1.0 5 4.0 6 2.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 3.0 13 5.0 14 2.0 15 3.0 16 1.0 17 5.0 18 4.0 19 6.0 20 11.0 21 13.0 22 11.0 23 21.0 24 16.0 25 17.0 26 17.0 27 30.0 28 24.0 29 37.0 30 50.0 31 62.0 32 68.0 33 91.0 34 153.0 35 272.0 36 637.0 37 2414.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 19.625 15.0 27.150000000000002 2 24.3 26.6 33.5 15.6 3 22.325 28.65 29.4 19.625 4 23.65 35.8 21.475 19.075 5 23.9 36.65 23.0 16.45 6 20.075000000000003 37.4 23.95 18.575 7 18.099999999999998 19.725 42.425000000000004 19.75 8 22.025 23.549999999999997 29.175 25.25 9 23.549999999999997 24.15 28.549999999999997 23.75 10-14 23.5 29.175 26.424999999999997 20.9 15-19 23.36 28.015 28.744999999999997 19.88 20-24 22.775000000000002 28.63 28.175 20.419999999999998 25-29 23.175 28.384999999999998 28.16 20.28 30-34 22.89 27.83 28.705000000000002 20.575 35-39 23.01 28.17 28.365000000000002 20.455000000000002 40-44 23.365 27.79 28.305000000000003 20.54 45-49 22.67 28.544999999999998 28.33 20.455000000000002 50-54 23.155 27.275 29.110000000000003 20.46 55-59 22.58 27.705000000000002 28.67 21.044999999999998 60-64 23.135 28.53 28.01 20.325 65-69 22.75 28.345 28.13 20.775 70-74 23.02 27.825 27.855 21.3 75-79 22.675 28.26 28.22 20.845 80-84 23.585 28.04 27.750000000000004 20.625 85-89 23.03 28.305000000000003 27.875 20.79 90-94 23.169999999999998 28.105000000000004 28.455000000000002 20.27 95-99 24.19 27.29 27.62 20.9 100-104 24.675 27.584999999999997 27.534999999999997 20.205000000000002 105-109 24.38 27.575 28.325 19.72 110-114 23.815 27.76 27.845 20.580000000000002 115-119 24.67 27.779999999999998 27.98 19.57 120-124 23.96 28.78 27.3 19.96 125-129 24.69 28.125 27.74 19.445 130-134 24.836241812090602 28.046402320116005 27.2063603180159 19.91099554977749 135-139 25.074999999999996 28.15 26.900000000000002 19.875 140-144 25.874999999999996 28.415000000000003 26.35 19.36 145-149 25.81 28.355000000000004 26.634999999999998 19.2 150-151 26.0375 28.462500000000002 27.0625 18.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 1.5 24 2.5 25 3.5 26 6.0 27 5.5 28 7.0 29 12.0 30 15.0 31 21.0 32 31.0 33 34.0 34 55.0 35 78.5 36 97.5 37 126.0 38 145.0 39 171.5 40 193.0 41 218.5 42 255.0 43 282.5 44 283.0 45 274.5 46 276.0 47 261.5 48 227.0 49 190.5 50 161.0 51 127.0 52 88.5 53 76.0 54 74.5 55 56.5 56 41.5 57 28.0 58 18.0 59 13.5 60 9.0 61 6.0 62 5.5 63 6.0 64 5.5 65 3.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.5375 0.0 0.0 0.0 0.0 94-95 1.7875 0.0 0.0 0.0 0.0 96-97 2.1625 0.0 0.0 0.0 0.0 98-99 2.4875 0.0 0.0 0.0 0.0 100-101 2.7249999999999996 0.0 0.0 0.0 0.0 102-103 2.9625 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 4.012499999999999 0.0 0.0 0.0 0.0 110-111 4.362500000000001 0.0 0.0 0.0 0.0 112-113 4.775 0.0 0.0 0.0 0.0 114-115 5.35 0.0 0.0 0.0 0.0 116-117 5.8625 0.0 0.0 0.0 0.0 118-119 6.5625 0.0 0.0 0.0 0.0 120-121 7.2875 0.0 0.0 0.0 0.0 122-123 7.875 0.0 0.0 0.0 0.0 124-125 8.375 0.0 0.0 0.0 0.0 126-127 8.925 0.0 0.0 0.0 0.0 128-129 9.425 0.0 0.0 0.0 0.0 130-131 10.0125 0.0 0.0 0.0 0.0 132-133 10.9125 0.0 0.0 0.0 0.0 134-135 11.5625 0.0 0.0 0.0 0.0 136-137 12.2125 0.0 0.0 0.0 0.0 138-139 12.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra Read 855994 spots for SRR7168875.sra Written 855994 spots for SRR7168875.sra Read 855990 spots for SRR7168875.sra Written 855990 spots for SRR7168875.sra SRR ids: ['SRR7168875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4agbbedg SRR7168875.sra spots: 17119804 blocks: [[1, 855990], [855991, 1711980], [1711981, 2567970], [2567971, 3423960], [3423961, 4279950], [4279951, 5135940], [5135941, 5991930], [5991931, 6847920], [6847921, 7703910], [7703911, 8559900], [8559901, 9415890], [9415891, 10271880], [10271881, 11127870], [11127871, 11983860], [11983861, 12839850], [12839851, 13695840], [13695841, 14551830], [14551831, 15407820], [15407821, 16263810], [16263811, 17119804]] SRR7168875 file size 5779639 SRR7168875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168875 SRR7168875_1.fastq SRR7168875_2.fastq Input file: SRR7168875_1.fastq Paired file: SRR7168875_2.fastq trimmed: SRR7168875-trimmed-pair1.fastq, SRR7168875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 12:41:09 2025 >> started Sat Feb 15 12:47:10 2025 >> done (360.582s) 17119804 read pairs processed; of these: 20370 ( 0.12%) short read pairs filtered out after trimming by size control 31107 ( 0.18%) empty read pairs filtered out after trimming by size control 17068327 (99.70%) read pairs available; of these: 10135645 (59.38%) trimmed read pairs available after processing 6932682 (40.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 11 0.00% 21 3 0.00% 22 6 0.00% 23 12 0.00% 24 9 0.00% 25 4 0.00% 26 10 0.00% 27 8 0.00% 28 16 0.00% 29 15 0.00% 30 14 0.00% 31 18 0.00% 32 15 0.00% 33 22 0.00% 34 11 0.00% 35 22 0.00% 36 34 0.00% 37 39 0.00% 38 38 0.00% 39 48 0.00% 40 71 0.00% 41 66 0.00% 42 77 0.00% 43 81 0.00% 44 100 0.00% 45 116 0.00% 46 126 0.00% 47 120 0.00% 48 162 0.00% 49 180 0.00% 50 185 0.00% 51 263 0.00% 52 297 0.00% 53 309 0.00% 54 326 0.00% 55 368 0.00% 56 393 0.00% 57 446 0.00% 58 522 0.00% 59 602 0.00% 60 669 0.00% 61 784 0.00% 62 950 0.01% 63 1064 0.01% 64 1222 0.01% 65 1407 0.01% 66 1433 0.01% 67 1729 0.01% 68 1835 0.01% 69 2693 0.02% 70 2773 0.02% 71 2767 0.02% 72 3160 0.02% 73 3472 0.02% 74 3993 0.02% 75 4398 0.03% 76 4786 0.03% 77 5203 0.03% 78 5743 0.03% 79 6320 0.04% 80 6950 0.04% 81 7944 0.05% 82 9080 0.05% 83 10190 0.06% 84 11525 0.07% 85 12866 0.08% 86 13450 0.08% 87 14390 0.08% 88 15252 0.09% 89 16066 0.09% 90 17521 0.10% 91 18973 0.11% 92 20275 0.12% 93 22281 0.13% 94 23860 0.14% 95 25276 0.15% 96 26219 0.15% 97 27159 0.16% 98 27361 0.16% 99 28831 0.17% 100 30540 0.18% 101 31535 0.18% 102 33717 0.20% 103 35262 0.21% 104 36937 0.22% 105 38927 0.23% 106 40193 0.24% 107 41196 0.24% 108 42302 0.25% 109 43568 0.26% 110 43963 0.26% 111 45403 0.27% 112 48053 0.28% 113 49547 0.29% 114 51100 0.30% 115 53564 0.31% 116 54825 0.32% 117 56121 0.33% 118 56743 0.33% 119 57435 0.34% 120 58752 0.34% 121 60501 0.35% 122 61918 0.36% 123 64687 0.38% 124 67314 0.39% 125 69395 0.41% 126 72546 0.43% 127 73610 0.43% 128 75738 0.44% 129 77396 0.45% 130 79511 0.47% 131 81358 0.48% 132 83999 0.49% 133 88407 0.52% 134 91567 0.54% 135 96519 0.57% 136 100502 0.59% 137 106553 0.62% 138 111784 0.65% 139 118970 0.70% 140 124982 0.73% 141 134779 0.79% 142 146613 0.86% 143 162307 0.95% 144 185102 1.08% 145 216880 1.27% 146 267446 1.57% 147 351936 2.06% 148 511922 3.00% 149 973106 5.70% 150 4111574 24.09% 151 6932682 40.62% 17068327 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.40 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=45.38 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=10 prefix-density=0.42 prefix-fanout=2.8 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=70.28 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7168875 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 14:00:52 Started mapping on | Feb 15 14:01:27 Finished on | Feb 15 16:29:36 Mapping speed, Million of reads per hour | 6.91 Number of input reads | 17068327 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15963773 Uniquely mapped reads % | 93.53% Average mapped length | 288.03 Number of splices: Total | 14809349 Number of splices: Annotated (sjdb) | 14446435 Number of splices: GT/AG | 14519188 Number of splices: GC/AG | 226862 Number of splices: AT/AC | 8601 Number of splices: Non-canonical | 54698 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521118 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 84768 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599543 599543 599543 N_multimapping 521118 521118 521118 N_noFeature 643268 15578544 882241 N_ambiguous 264837 1895 117121 UnstrandedReadsAssigned:15055668 PositiveStrandReadsAssigned:383334 NegativeStrandReadsAssigned:14964411 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7168875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168875-trimmed-pair1.fastq SRR7168875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,068,327 reads, 15,009,637 reads pseudoaligned [quant] estimated average fragment length: 219.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7168875.ke.tsv 34699 SRR7168875.se.tsv 87100 total ==> SRR7168875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.44 895 32.9501 Potri.005G024800.1.v4.1 1035 816.443 182 14.7679 Potri.004G059700.1.v4.1 961 742.459 15 1.33841 Potri.007G009000.2.v4.1 1416 1197.44 0 0 Potri.003G141000.2.v4.1 2943 2724.44 972.873 23.6565 Potri.016G087400.1.v4.1 270 93.42 985 698.502 Potri.015G069301.1.v4.1 564 349.103 0 0 Potri.010G195200.1.v4.1 1773 1554.44 204 8.69415 Potri.012G127500.1.v4.1 977 758.443 253 22.0988 ==> SRR7168875.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1007 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 372 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7168875 completed mapping pipeline successfully