Starting /dee2/code/volunteer_pipeline.sh SRR7168876 current disk space = 3090756939776 free memory = 1530828204 SRR7168876 SRAfilesize 48191e4bcb9dd29da324ce251821261a SRR7168876.sra SRR7168876.sra file validated SRR7168876 is paired end SRR7168876 is conventional basespace SRR7168876 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29725 34.0 33.0 34.0 32.0 34.0 2 33.2545 34.0 33.0 34.0 32.0 34.0 3 33.25425 34.0 33.0 34.0 32.0 34.0 4 33.3975 34.0 33.0 34.0 33.0 34.0 5 33.36875 34.0 33.0 34.0 33.0 34.0 6 37.11325 38.0 38.0 38.0 36.0 38.0 7 37.401 38.0 38.0 38.0 37.0 38.0 8 37.51075 38.0 38.0 38.0 37.0 38.0 9 37.5165 38.0 38.0 38.0 37.0 38.0 10-14 37.572 38.0 38.0 38.0 38.0 38.0 15-19 37.5323 38.0 38.0 38.0 38.0 38.0 20-24 37.46175 38.0 38.0 38.0 37.6 38.0 25-29 37.47285 38.0 38.0 38.0 37.6 38.0 30-34 37.4568 38.0 38.0 38.0 37.6 38.0 35-39 37.39775 38.0 38.0 38.0 37.0 38.0 40-44 37.40555 38.0 38.0 38.0 37.0 38.0 45-49 37.36915 38.0 38.0 38.0 37.0 38.0 50-54 37.2846 38.0 38.0 38.0 37.0 38.0 55-59 37.21525 38.0 38.0 38.0 37.0 38.0 60-64 37.216449999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.1373 38.0 38.0 38.0 36.2 38.0 70-74 37.114549999999994 38.0 38.0 38.0 36.2 38.0 75-79 36.96975 38.0 38.0 38.0 36.0 38.0 80-84 36.8636 38.0 38.0 38.0 35.8 38.0 85-89 36.82085 38.0 38.0 38.0 35.6 38.0 90-94 36.62435000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.59285 38.0 38.0 38.0 34.6 38.0 100-104 36.46075 38.0 38.0 38.0 34.2 38.0 105-109 36.388099999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.153549999999996 38.0 37.8 38.0 33.8 38.0 115-119 35.93815 38.0 37.2 38.0 33.0 38.0 120-124 35.72595 38.0 37.0 38.0 31.0 38.0 125-129 35.50165 38.0 36.2 38.0 30.6 38.0 130-134 35.00075 38.0 35.6 38.0 28.2 38.0 135-139 34.526849999999996 38.0 34.6 38.0 26.2 38.0 140-144 34.0642 38.0 33.4 38.0 23.8 38.0 145-149 33.086749999999995 38.0 33.0 38.0 18.6 38.0 150-151 28.048875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 7.0 19 13.0 20 2.0 21 3.0 22 5.0 23 5.0 24 10.0 25 8.0 26 16.0 27 29.0 28 21.0 29 41.0 30 42.0 31 55.0 32 56.0 33 99.0 34 136.0 35 243.0 36 668.0 37 2532.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.88819875776397 12.03416149068323 11.93064182194617 38.14699792960663 2 21.73043260815204 17.104276069017253 33.78344586146537 27.38184546136534 3 20.875 21.95 25.575 31.6 4 24.75 30.049999999999997 20.150000000000002 25.05 5 22.650000000000002 34.949999999999996 22.8 19.6 6 19.55 36.225 24.775 19.45 7 14.649999999999999 25.25 42.525 17.575 8 17.75 24.349999999999998 31.374999999999996 26.525 9 17.1 24.325 34.675 23.9 10-14 19.43 29.555 27.41 23.605 15-19 20.115 28.365000000000002 27.63 23.89 20-24 19.5 29.060000000000002 28.005000000000003 23.435 25-29 20.14 28.725 27.57 23.565 30-34 19.36 29.04 28.389999999999997 23.21 35-39 20.07 28.565 27.88 23.485 40-44 20.11 28.475 27.839999999999996 23.575 45-49 19.900000000000002 28.82 27.85 23.43 50-54 20.19 28.845 27.16 23.805 55-59 20.135 28.53 27.955000000000002 23.380000000000003 60-64 19.865 28.82 27.965 23.35 65-69 19.74 29.755 27.395000000000003 23.11 70-74 19.965 28.22 28.389999999999997 23.425 75-79 20.34 29.049999999999997 27.560000000000002 23.05 80-84 20.445 28.389999999999997 27.52 23.645 85-89 20.605 28.775000000000002 27.655 22.965 90-94 20.76 28.77 27.58 22.89 95-99 20.11 28.725 27.615000000000002 23.549999999999997 100-104 20.3 28.875 27.650000000000002 23.175 105-109 20.905 28.32 27.439999999999998 23.335 110-114 20.485 29.04 26.965 23.51 115-119 20.880000000000003 28.165000000000003 27.66 23.294999999999998 120-124 20.89 29.15 27.0 22.96 125-129 20.455000000000002 28.449999999999996 27.49 23.605 130-134 20.75 28.494999999999997 27.315 23.44 135-139 21.26 28.46 26.99 23.29 140-144 21.015 28.175 27.1 23.71 145-149 20.53 28.565 26.919999999999998 23.985 150-151 20.25 29.6625 26.437500000000004 23.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 2.0 23 1.0 24 2.0 25 3.0 26 5.0 27 8.0 28 10.0 29 15.5 30 18.5 31 25.5 32 46.0 33 56.5 34 64.0 35 81.0 36 90.5 37 103.0 38 143.5 39 174.0 40 193.0 41 224.5 42 247.0 43 268.0 44 255.0 45 247.5 46 276.5 47 262.0 48 212.0 49 183.5 50 167.0 51 132.5 52 110.0 53 91.5 54 65.5 55 53.5 56 39.0 57 32.5 58 28.0 59 16.5 60 13.5 61 10.5 62 4.5 63 2.0 64 2.0 65 2.0 66 1.0 67 0.0 68 0.5 69 1.0 70 1.0 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34393136512742 98.425 2 0.6308352258390109 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025233409033560434 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 13 0.325 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.4000000000000004 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.7375 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.6 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.65 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 8.8625 0.0 0.0 0.0 0.0 138-139 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGGT 10 0.006836113 144.9625 7 >>END_MODULE SRR7168876 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7168876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9975 33.0 33.0 34.0 32.0 34.0 2 33.132 34.0 33.0 34.0 33.0 34.0 3 33.15925 34.0 33.0 34.0 33.0 34.0 4 33.1475 34.0 33.0 34.0 33.0 34.0 5 33.16175 34.0 33.0 34.0 33.0 34.0 6 37.36525 38.0 38.0 38.0 37.0 38.0 7 37.3615 38.0 38.0 38.0 37.0 38.0 8 37.40925 38.0 38.0 38.0 38.0 38.0 9 37.30875 38.0 38.0 38.0 37.0 38.0 10-14 37.3335 38.0 38.0 38.0 37.0 38.0 15-19 37.2926 38.0 38.0 38.0 37.0 38.0 20-24 37.290350000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.242 38.0 38.0 38.0 37.0 38.0 30-34 37.290299999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.27605 38.0 38.0 38.0 37.0 38.0 40-44 37.23265 38.0 38.0 38.0 37.0 38.0 45-49 37.19315 38.0 38.0 38.0 37.0 38.0 50-54 37.13355 38.0 38.0 38.0 37.0 38.0 55-59 37.08970000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.0943 38.0 38.0 38.0 37.0 38.0 65-69 37.0201 38.0 38.0 38.0 36.8 38.0 70-74 36.953700000000005 38.0 38.0 38.0 36.6 38.0 75-79 36.8475 38.0 38.0 38.0 36.0 38.0 80-84 36.67765 38.0 38.0 38.0 35.4 38.0 85-89 36.558499999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.49235 38.0 38.0 38.0 34.8 38.0 95-99 36.50365 38.0 38.0 38.0 35.0 38.0 100-104 36.28315 38.0 38.0 38.0 34.0 38.0 105-109 36.28855 38.0 38.0 38.0 34.0 38.0 110-114 36.099450000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.871849999999995 38.0 38.0 38.0 33.0 38.0 120-124 35.74065 38.0 37.8 38.0 32.8 38.0 125-129 35.46265 38.0 36.8 38.0 31.4 38.0 130-134 35.25255 38.0 36.2 38.0 31.0 38.0 135-139 34.67015 38.0 35.6 38.0 27.8 38.0 140-144 34.1543 38.0 34.4 38.0 24.8 38.0 145-149 33.171299999999995 38.0 33.0 38.0 17.8 38.0 150-151 28.2275 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 2.0 9 0.0 10 2.0 11 3.0 12 1.0 13 3.0 14 2.0 15 4.0 16 2.0 17 15.0 18 4.0 19 4.0 20 12.0 21 6.0 22 13.0 23 8.0 24 10.0 25 12.0 26 21.0 27 20.0 28 28.0 29 28.0 30 39.0 31 41.0 32 56.0 33 66.0 34 119.0 35 251.0 36 572.0 37 2651.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 18.425 16.45 27.825 2 27.175 24.925 31.424999999999997 16.475 3 20.45 28.449999999999996 31.85 19.25 4 23.549999999999997 33.900000000000006 23.425 19.125 5 24.825 37.85 20.375 16.950000000000003 6 21.475 37.925 23.0 17.599999999999998 7 18.675 20.674999999999997 39.300000000000004 21.349999999999998 8 21.825 25.174999999999997 26.900000000000002 26.1 9 21.475 23.9 30.025000000000002 24.6 10-14 23.125 29.48 26.669999999999998 20.724999999999998 15-19 22.905 28.355000000000004 27.975 20.765 20-24 22.425 28.26 28.18 21.135 25-29 23.165 28.02 28.475 20.34 30-34 22.485 28.9 27.935 20.68 35-39 22.37 27.54 28.565 21.525 40-44 22.805 28.65 27.87 20.674999999999997 45-49 22.68 28.455000000000002 28.23 20.635 50-54 23.044999999999998 28.405 27.715 20.835 55-59 22.830000000000002 28.565 28.025 20.580000000000002 60-64 22.875 27.71 28.62 20.794999999999998 65-69 22.67 28.16 28.24 20.93 70-74 23.285 28.075 28.084999999999997 20.555 75-79 22.59 28.294999999999998 28.4 20.715 80-84 23.28 28.455000000000002 27.694999999999997 20.57 85-89 23.215 28.410000000000004 27.73 20.645 90-94 23.595 28.425 27.775 20.205000000000002 95-99 22.965 28.235 28.1 20.7 100-104 23.275000000000002 27.705000000000002 27.815 21.205 105-109 23.57 28.395 28.285 19.75 110-114 23.74 27.779999999999998 27.975 20.505000000000003 115-119 23.78 28.09 27.625 20.505000000000003 120-124 23.435 28.125 27.889999999999997 20.549999999999997 125-129 24.09 28.860000000000003 27.515 19.535 130-134 24.555 27.839999999999996 27.42 20.185 135-139 25.19 27.57 27.405 19.835 140-144 24.995 28.475 26.645000000000003 19.885 145-149 25.31 27.634999999999998 27.215 19.84 150-151 25.8625 27.650000000000002 27.3875 19.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 2.5 25 2.5 26 3.0 27 5.5 28 8.5 29 15.0 30 20.5 31 22.5 32 32.0 33 47.5 34 58.0 35 75.5 36 93.0 37 112.0 38 132.5 39 168.5 40 207.5 41 235.0 42 275.0 43 278.5 44 283.5 45 280.0 46 252.0 47 243.0 48 215.0 49 185.0 50 155.5 51 124.0 52 102.0 53 85.5 54 70.0 55 50.5 56 40.5 57 32.0 58 22.0 59 17.0 60 12.5 61 7.5 62 5.5 63 3.5 64 3.0 65 3.5 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.809102402022756 1.6 3 0.025284450063211124 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.5125 0.0 0.0 0.0 0.0 122-123 4.862500000000001 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 5.7875 0.0 0.0 0.0 0.0 128-129 6.262499999999999 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.3875 0.0 0.0 0.0 0.0 134-135 7.987500000000001 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815125 spots for SRR7168876.sra Written 815125 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra Read 815120 spots for SRR7168876.sra Written 815120 spots for SRR7168876.sra SRR ids: ['SRR7168876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f5g5fr9n SRR7168876.sra spots: 16302405 blocks: [[1, 815120], [815121, 1630240], [1630241, 2445360], [2445361, 3260480], [3260481, 4075600], [4075601, 4890720], [4890721, 5705840], [5705841, 6520960], [6520961, 7336080], [7336081, 8151200], [8151201, 8966320], [8966321, 9781440], [9781441, 10596560], [10596561, 11411680], [11411681, 12226800], [12226801, 13041920], [13041921, 13857040], [13857041, 14672160], [14672161, 15487280], [15487281, 16302405]] SRR7168876 file size 5502649 SRR7168876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7168876 SRR7168876_1.fastq SRR7168876_2.fastq Input file: SRR7168876_1.fastq Paired file: SRR7168876_2.fastq trimmed: SRR7168876-trimmed-pair1.fastq, SRR7168876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Feb 15 16:45:52 2025 >> started Sat Feb 15 16:52:28 2025 >> done (395.998s) 16302405 read pairs processed; of these: 14956 ( 0.09%) short read pairs filtered out after trimming by size control 67300 ( 0.41%) empty read pairs filtered out after trimming by size control 16220149 (99.50%) read pairs available; of these: 8300941 (51.18%) trimmed read pairs available after processing 7919208 (48.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 2 0.00% 21 9 0.00% 22 3 0.00% 23 10 0.00% 24 6 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 5 0.00% 29 10 0.00% 30 8 0.00% 31 5 0.00% 32 15 0.00% 33 11 0.00% 34 13 0.00% 35 9 0.00% 36 16 0.00% 37 17 0.00% 38 16 0.00% 39 19 0.00% 40 24 0.00% 41 33 0.00% 42 49 0.00% 43 37 0.00% 44 55 0.00% 45 47 0.00% 46 65 0.00% 47 59 0.00% 48 86 0.00% 49 83 0.00% 50 89 0.00% 51 120 0.00% 52 116 0.00% 53 143 0.00% 54 156 0.00% 55 192 0.00% 56 173 0.00% 57 200 0.00% 58 262 0.00% 59 315 0.00% 60 326 0.00% 61 350 0.00% 62 421 0.00% 63 468 0.00% 64 533 0.00% 65 611 0.00% 66 665 0.00% 67 778 0.00% 68 1020 0.01% 69 2578 0.02% 70 2359 0.01% 71 1459 0.01% 72 1525 0.01% 73 1732 0.01% 74 2021 0.01% 75 2142 0.01% 76 2250 0.01% 77 2581 0.02% 78 2931 0.02% 79 3218 0.02% 80 3611 0.02% 81 4159 0.03% 82 4727 0.03% 83 5264 0.03% 84 6424 0.04% 85 7026 0.04% 86 7699 0.05% 87 8552 0.05% 88 8806 0.05% 89 9607 0.06% 90 10694 0.07% 91 11357 0.07% 92 12578 0.08% 93 13669 0.08% 94 14488 0.09% 95 15656 0.10% 96 16118 0.10% 97 17147 0.11% 98 17911 0.11% 99 18700 0.12% 100 20331 0.13% 101 21165 0.13% 102 22627 0.14% 103 24073 0.15% 104 25191 0.16% 105 26657 0.16% 106 27712 0.17% 107 28683 0.18% 108 29745 0.18% 109 31274 0.19% 110 32541 0.20% 111 33681 0.21% 112 35246 0.22% 113 36556 0.23% 114 38612 0.24% 115 40127 0.25% 116 41042 0.25% 117 42232 0.26% 118 43192 0.27% 119 44505 0.27% 120 45071 0.28% 121 47362 0.29% 122 49432 0.30% 123 51124 0.32% 124 52765 0.33% 125 54149 0.33% 126 56585 0.35% 127 57917 0.36% 128 59103 0.36% 129 61069 0.38% 130 62794 0.39% 131 64147 0.40% 132 67275 0.41% 133 70367 0.43% 134 73191 0.45% 135 76107 0.47% 136 79061 0.49% 137 82692 0.51% 138 85708 0.53% 139 91440 0.56% 140 96656 0.60% 141 103562 0.64% 142 111520 0.69% 143 122596 0.76% 144 138969 0.86% 145 162766 1.00% 146 196958 1.21% 147 259798 1.60% 148 386822 2.38% 149 745738 4.60% 150 3796332 23.41% 151 7919208 48.82% 16220149 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=38.93 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.0 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=14 prefix-density=0.46 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=29.49 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7168876 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 15 17:54:52 Started mapping on | Feb 15 17:55:14 Finished on | Feb 15 19:25:23 Mapping speed, Million of reads per hour | 10.80 Number of input reads | 16220149 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15064162 Uniquely mapped reads % | 92.87% Average mapped length | 291.27 Number of splices: Total | 14026933 Number of splices: Annotated (sjdb) | 13688189 Number of splices: GT/AG | 13764995 Number of splices: GC/AG | 207968 Number of splices: AT/AC | 8613 Number of splices: Non-canonical | 45357 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474700 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 171077 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 694491 694491 694491 N_multimapping 474700 474700 474700 N_noFeature 609335 14693979 860849 N_ambiguous 243405 2233 122866 UnstrandedReadsAssigned:14211422 PositiveStrandReadsAssigned:367950 NegativeStrandReadsAssigned:14080447 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7168876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7168876-trimmed-pair1.fastq SRR7168876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,220,149 reads, 14,180,046 reads pseudoaligned [quant] estimated average fragment length: 233.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7168876.ke.tsv 34699 SRR7168876.se.tsv 87100 total ==> SRR7168876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.39 819 34.1714 Potri.005G024800.1.v4.1 1035 802.39 251 23.3024 Potri.004G059700.1.v4.1 961 728.402 2 0.204537 Potri.007G009000.2.v4.1 1416 1183.39 0 0 Potri.003G141000.2.v4.1 2943 2710.39 738.715 20.3029 Potri.016G087400.1.v4.1 270 88.821 1020 855.454 Potri.015G069301.1.v4.1 564 336.51 0 0 Potri.010G195200.1.v4.1 1773 1540.39 176.933 8.55639 Potri.012G127500.1.v4.1 977 744.396 234 23.4166 ==> SRR7168876.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 823 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 48 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 97 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7168876 completed mapping pipeline successfully